ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο"

Transcript

1 ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 2 ΕΠΙΚΡΑΤΗ 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με κίτρινο χρώμα σπέρματος και λευκό χρώμα άνθους. 113 άτομα με πράσινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 112 άτομα με πράσινο χρώμα σπέρματος και λευκό χρώμα άνθους. Ποιος είναι ο γονότυπος των γονέων τους; Κίτρινα : πράσινα 1 : 1, έστω Κ=κίτρινο και κ=πράσινο, όπου Κ>κ Ιώδες : λευκό 1 : 1, έστω Ι=ιώδες και ι=λευκό, όπου Ι>ι Οπότε: 2 περιπτώσεις: 1 η P: ΚκΙι Χ κκιι 2 η P: Κκιι Χ κκιι 2. Στην ράτσα «cocker spaniel» το μαύρο χρώμα είναι επικρατές έναντι του κόκκινου χρώματος τριχώματος, ενώ ο ομοιόμορφος χρωματισμός οφείλεται σε επικρατές γονίδιο και ο χρωματισμός με στίγματα σε υπολειπόμενο γονίδιο. Κανένα από τα γονίδια δεν είναι θνησιγόνο. Ομοιόμορφο μαύρο αρσενικό διασταυρώνεται με κόκκινο ομοιόμορφο θηλυκό και γεννιούνται 6 κουτάβια: 2 μαύρα ομοιόμορφα, 2 κόκκινα ομοιόμορφα, 1 μαύρο με στίγματα και 1 κόκκινο με στίγματα. α. Ποιος ο γονότυπος των γονέων; β. Ποια θα ήταν η αναμενόμενη φαινοτυπική αναλογία από τη διασταύρωση αυτή; Μ=μαύρο, μ=κόκκινο, όπου Μ>μ, Σ=ομοιόμορφο, σ=στίγματα, όπου Σ>σ α. P: ΜμΣσ Χ μμσσ β. 3 μαύρα ομοιόμορφα : 1 μαύρο με στίγματα : 3 κόκκινο ομοιόμορφο : 1 κόκκινα με στίγματα Άρα Μαύρα : Κόκκινα= 1 : 1 και Ομοιόμορφα : Στίγματα= 3 : 1 3. Στις τομάτες το ψηλό φυτό οφείλεται σε επικρατές γονίδιο, ενώ το φυτό νάνος οφείλεται σε υπολειπόμενο γονίδιο. Σε ένα άλλο ζεύγος χρωμοσωμάτων του φυτού υπάρχει η γενετική θέση που καθορίζει την εμφάνιση τριχών ή την έλλειψη τριχών στο στέλεχος. Από τη διασταύρωση δύο φυτών προέκυψαν στην επόμενη γενιά: 118 ψηλά με τρίχες, 112 φυτά νάνοι με τρίχες, 40 ψηλά φυτά χωρίς τρίχες και 37 φυτά νάνοι χωρίς τρίχες. Ποιοι οι γονότυποι των γονέων; Με τρίχες : χωρίς τρίχες 3 : 1, άρα Τ=τρίχες, τ=χωρίς τρίχες, όπου Τ>τ. Άτομα ετερόζυγα Ττ Χ Ττ. Ψ=ψηλό, ψ=νάνος, όπου Ψ>ψ. Αναλογία περίπου ίση 1 : 1. Άτομα Ψψ Χ ψψ Άρα: P: ΨψΤτ Χ ψψττ 4. Στα καρπούζια η πικρή γεύση οφείλεται σε επικρατές γονίδιο και η γλυκιά γεύση σε υπολειπόμενο, ενώ οι κίτρινες κηλίδες στην επιφάνεια του φρούτου επικρατούν έναντι της απουσίας κηλίδων. Από την διασταύρωση αμιγών ατόμων με πικρή γεύση και κίτρινες κηλίδες με αμιγή άτομα με γλυκιά γεύση και απουσία κηλίδων να βρεθεί: α. Η γονοτυπική και φαινοτυπική αναλογία της F 2 γενιάς. β. Αν προκύψουν 308 άτομα πόσα από αυτά θα έχουν γλυκιά γεύση και πόσα θα έχουν κίτρινες κηλίδες; γ. Πώς είναι δυνατή η απομόνωση αμιγών ατόμων με πικρή γεύση και απουσία κηλίδων; Π=πικρή, π=γλυκιά, όπου Π>π και Κ=κηλίδες, κ=απουσία κηλίδων, όπου Κ>κ 1

2 α. Φ.Α: 9 πικρή και κίτρινες κηλίδες : 3 πικρή και απουσία κηλίδων : 3 γλυκιά και κίτρινες κηλίδες : 1 γλυκιά και απουσία κηλίδων Γ.Α: 4 ΠπΚκ, 2ΠπΚΚ, 2Ππκκ, 2ΠΠΚκ, 2ππΚκ, 1ΠΠΚΚ, 1ππκκ, 1ΠΠκκ, 1ππΚΚ β /16=77 με γλυκιά γεύση /16=231 με κίτρινες κηλίδες γ. Τα άτομα αυτά έχουν γονότυπους ΠΠκκ ή Ππκκ. Γίνεται διασταύρωση ελέγχου με άτομο ππκκ 1 η περίπτωση: ΠΠκκ Χ ππκκ γαμέτες Πκ πκ F 1 Ππκκ όλα τα άτομα με πικρή γεύση και απουσία κηλίδων 2 η περίπτωση: Ππκκ Χ ππκκ γαμέτες Πκ, πκ πκ F 1 Ππκκ ππκκ 50% άτομα με 50% άτομα με γλυκιά γεύση πικρή γεύση και απουσία κηλίδων και απουσία κηλίδων 5. Ποιοι είναι οι πιθανοί απόγονοι και με ποια πιθανότητα θα προκύψουν από τη διασταύρωση μιας κανονικής Drosophila με μια άλλη που έχει «υποπλασμένα φτερά» και «άτριχο σώμα». Οι χαρακτήρες «υποπλασμένα φτερά» και «άτριχο σώμα» είναι υπολειπόμενοι και βρίσκονται σε διαφορετικά χρωμοσώματα. Έστω Α=σώμα με τρίχες, α=άτριχο σώμα, όπου Α>α και Κ=κανονικά φτερά, κ=υποπλασμένα φτερά, όπου Κ>κ Οι πιθανοί γονότυποι για την κανονική Drosophila είναι: ΑΑΚΚ, ΑαΚΚ, ΑΑΚκ, ΑαΚκ (κάθε γονότυπος έχει πιθανότητα 1/4) Οι πιθανοί γονότυποι για την άλλη Drosophila είναι: αακκ Άρα υπάρχουν 4 περιπτώσεις. 1 η περίπτωση: ΑΑΚΚ Χ αακκ F 1 ΑαΚκ 100% άτομα με τρίχες και κανονικά φτερά P 1 =1/4 1=1/4 2 η περίπτωση: ΑαΚΚ Χ αακκ F 1 ΑαΚκ, αακκ 50% άτομα με τρίχες και κανονικά φτερά (P 2 =1/4 1/2=1/8) 50% άτομα άτριχα και κανονικά φτερά (P 2 =1/4 1/2=1/8) 3 η περίπτωση: ΑΑΚκ Χ αακκ F 1 ΑαΚκ, Αακκ 50% άτομα με τρίχες και κανονικά φτερά (P 3 =1/4 1/2=1/8) 50% άτομα με τρίχες και υποπλασμένα φτερά (P 3 =1/4 1/2=1/8) 4 η περίπτωση: ΑαΚκ Χ αακκ F 1 ΑαΚκ, Αακκ, αακκ, αακκ 25% άτομα με τρίχες και κανονικά φτερά (P 4 =1/4 1/4=1/16) 25% άτομα με τρίχες και υποπλασμένα φτερά (P 4 =1/4 1/4=1/16) 25% άτομα άτριχα και κανονικά φτερά (P 4 =1/4 1/4=1/16) 25% άτομα άτριχα και υποπλασμένα φτερά (P 4 =1/4 1/4=1/16) Άρα συνολικά, - Άτομα με τρίχες και κανονικά φτερά: Pολ=P 1 +P 2 +P 3 +P 4 =9/16 - Άτομα άτριχα και κανονικά φτερά: Pολ=0+ P P 4 =3/16 - Άτομα με τρίχες και υποπλασμένα φτερά: Pολ=0+0+ P 3 + P 4 =3/16 - Άτομα άτριχα και υποπλασμένα φτερά: Pολ= P 4 =1/16 6. Από την διασταύρωση χοίρων με οπλές που μοιάζουν σαν του μουλαριού και άσπρο χρώμα γεννιούνται απόγονοι από τους οποίους οι 8 έχουν μαύρο χρώμα και φυσιολογική σχισμή. Αν τα γονίδια βρίσκονται σε διαφορετικά χρωμοσώματα, να βρείτε τον πιθανό αριθμό των υπόλοιπων ατόμων που θα έχουν νέους φαινοτύπους. Αφού προκύπτουν νέες ιδιότητες αυτό σημαίνει ότι τα γονίδια που ελέγχουν αυτές τις ιδιότητες είναι υπολειπόμενα. Έστω Α=άσπρο, α=μαύρο, όπου Α>α και Φ=σχισμή μουλαριού, φ=φυσιολογικό άτομο, όπου Φ>φ. Οι αρχικοί γονείς θα είναι ετερόζυγοι, δηλαδή ΑαΦφ και ΑαΦφ 2

3 Από τη διασταύρωση αυτή προκύπτουν 9 άτομα άσπρα με σχισμή μουλαριού 3 άτομα άσπρα με φυσιολογική σχισμή: 8 Χ 3=24 άτομα 3 άτομα μαύρα με σχισμή μουλαριού: 8 Χ 3=24 άτομα 1 άτομο μαύρο με φυσιολογική σχισμή: 8 άτομα 7. Σε ένα είδος κολοκυθιού το λευκό χρώμα του καρπού οφείλεται σε επικρατές γονίδιο και το κίτρινο χρώμα σε υπολειπόμενο γονίδιο. Το δισκοειδές σχήμα του καρπού οφείλεται σε επικρατές γονίδιο και το σφαιρικό σχήμα σε υπολειπόμενο. Από τη διασταύρωση ατόμου με λευκό και σφαιρικό καρπό με άτομο με κίτρινο και δισκοειδές καρπό προκύπτουν στην επόμενη γενιά τα εξής άτομα: 180 άτομα με λευκό χρώμα καρπού και δισκοειδές σχήμα καρπού. 185 άτομα με λευκό χρώμα καρπού και σφαιρικό σχήμα καρπού. 178 άτομα με κίτρινο χρώμα καρπού και δισκοειδές σχήμα καρπού. 183 άτομα με κίτρινο χρώμα καρπού και σφαιρικό σχήμα καρπού. Ποιος είναι ο γονότυπος των γονέων τους; Λ=λευκό, λ=κίτρινο, όπου Λ>λ και Δ=δισκοειδές, δ=σφαιρικό, όπου Δ>δ Λευκό : κίτρινο 1 : 1, άρα τα άτομα έχουν γονότυπο Λλ και λλ Δισκοειδές : σφαιρικό 1 : 1, άρα τα άτομα έχουν γονότυπο Δδ και δδ Οπότε οι πιθανές διασταυρώσεις είναι: 1 η περίπτωση: ΛλΔδ Χ λλδδ απορρίπτεται 2 η περίπτωση: Λλδδ Χ λλδδ ΕΠΙΚΡΑΤΕΣ-ΟΜΑΔΕΣ ΑΙΜΑΤΟΣ 8. Το Rh - (ρέζους αρνητικό-παράγοντας αίματος) οφείλεται σε υπολειπόμενο αυτοσωμικό γονίδιο ενώ το Rh + σε επικρατές. Κάποιος ισχυρίζεται ότι κάποιο από τα 6 παιδιά του δεν είναι δικό του. Η ανάλυση αίματος έδειξε τα εξής: Πατέρας: Ο+ Μητέρα:Α+ 1 ο παιδί: Α+ 2 ο παιδί:ο- 3 ο παιδί:α- 4 ο παιδί:ο+ 5 ο παιδί:αβ+ 6 ο παιδί:β- Έχει δίκιο; Τα 4 πρώτα μπορεί να είναι δικά του, τα 2 τελευταία (5 ο και 6 ο ) όχι. 9. Το Rh - (ρέζους αρνητικό-παράγοντας αίματος) οφείλεται σε υπολειπόμενο αυτοσωμικό γονίδιο, ενώ το Rh + σε επικρατές. Ζευγάρι υποστηρίζει ότι στο νοσοκομείο τους έδωσαν λάθος παιδί. Η γυναίκα έχει ομάδα αίματος Ο θετικό, ο άνδρας είναι Β θετικός και το παιδί είναι Ο αρνητικό. α. Έχουν δίκιο; β. Ποια η πιθανότητα το ζευγάρι αυτό να αποκτήσει κορίτσι Ο θετικό; Γονότυποι: Άνδρας I B irr, γυναίκα iirr, παιδί iirr α. Μπορεί να είναι δικό τους το παιδί β. P= 3/8 1/2=3/ Άνδρας ομάδας αίματος Α και Rh - (ρέζους αρνητικό-παράγοντας αίματος), του οποίου ο πατέρας είναι ομάδα αίματος ΑΒ και Rh + (ρέζους θετικό) και η μητέρα είναι Β και Rh + (ρέζους θετικό), παντρεύεται γυναίκα ομάδα αίματος Ο και Rh +, της οποία ο αδελφός είναι ΑΒ Rh -, ο πατέρας Α Rh + και η μητέρα Β Rh +. Το 1 ο τους παιδί είναι Α και Rh -. α. Να γράψετε τους γονότυπους όλων των ατόμων. β. Ποια η πιθανότητα να αποκτήσουν παιδί ομάδας αίματος Ο και Rh - ; γ. Ποια η πιθανότητα να αποκτήσουν αγόρι ομάδα αίματος Α Rh + ; δ. Ποια η πιθανότητα τα 2 επόμενα παιδιά να είναι το ένα Ο και Rh + και το άλλο Α και Rh - ; 3

4 α. Άνδρας:I Α irr, πατέρας άνδρα:i Α I Β Rr, μητέρα άνδρα:i B irr Γυναίκα:iiRr, αδελφός γυναίκας:i Α I Β rr, πατέρας γυναίκας:i Α irr, μητέρα γυναίκας:i B irr, 1 ο παιδί: I Α irr β. P= 1/4 γ. P= 1/4 1/2=1/8 δ. Διακρίνουμε δύο περιπτώσεις. 1 η περίπτωση: το 1 ο Ο και Rh + και το 2 ο Α και Rh - P 1 = 1/4 1/4= 1/16 2 η περίπτωση: το 1 ο Α και Rh - και το 2 ο Ο και Rh + P 2 = 1/4 1/4= 1/16 Άρα Pολ=P 1 +P 2 =2/16=1/8 ΕΠΙΚΡΑΤΕΣ-ΕΝΔΙΑΜΕΣΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 11. Από τη διασταύρωση ινδικών χοιριδίων με κοντό και άσπρο τρίχωμα με ινδικά χοιρίδια με μακρύ και κίτρινο τρίχωμα γεννήθηκαν τα εξής άτομα στην F 2 γενιά: 150 άτομα με κοντό και κρεμ χρώμα. 74 άτομα με κοντό και άσπρο χρώμα. 76 άτομα με κοντό και κίτρινο χρώμα. 51 άτομα με μακρύ και κρεμ χρώμα. 23 άτομα με μακρύ και με άσπρο χρώμα. 26 άτομα με μακρύ και με κίτρινο χρώμα. α. Να εξηγήσετε τα αποτελέσματα και να δείξετε τους γονότυπους των ατόμων της P και F 1 γενιάς. β. Εάν θηλυκό άτομο με μακρύ τρίχωμα και κρεμ χρώμα διασταυρωθεί με τα άτομα της P γενιάς ποια η πιθανότητα να γεννηθούν ινδικά χοιρίδιο με κρεμ χρώμα; Κοντό : μακρύ= 300 : 100 = 3 : 1 Άρα το γονίδιο είναι αυτοσωμικό, με το κοντό να επικρατεί του μακρύ. α. Έστω Κ=κοντό, κ=μακρύ, όπου Κ>κ Επειδή στο χρώμα του τριχώματος προέκυψε και ένας νέος φαινότυπος, ενώ η αναλογία κίτρινο χρώμα : άσπρο χρώμα= 102 : 97 1 : 1 (ακραίοι φαινότυποι) βγαίνει το συμπέρασμα ότι το χρώμα του τριχώματος οφείλεται σε ενδιάμεση κληρονομικότητα. Έστω Μ=κίτρινο χρώμα, Α=άσπρο χρώμα, όπου Μ=Α P: ΚΚΑΑ Χ κκμμ F 1 : ΚκΑΜ Χ ΚκΑΜ β. Διακρίνουμε 2 περιπτώσεις. 1 η περίπτωση: ΚΚΑΑ Χ κκαμ P 1 = 1/2 1/2= 1/4 2 η περίπτωση: κκμμ Χ κκαμ P 2 = 1/2 1/2= 1/4 Άρα Pολ=P 1 +P 2 =1/4+1/4=2/4=1/2 12. Στα βοοειδή της ράτσας Shorthorn από τη διασταύρωση ταύρου με κόκκινο χρώμα και κέρατα με αγελάδα με λευκό χρώμα χωρίς κέρατα όλοι οι απόγονοι έχουν κόκκινο-λευκό χρώμα και δε φέρουν κέρατα. Να βρεθούν οι γονότυποι των ατόμων της πατρικής (P) γενιάς καθώς και η φαινοτυπική και γονοτυπική αναλογία της F 2 γενιάς. Για το χρώμα εμφανίζονται 3 φαινότυποι, άρα ο τύπος της κληρονομικότητας είναι ενδιάμεσος (συνεπικρατής). Έστω Κ=κόκκινο, Λ=λευκό, όπου Κ=Λ. Επειδή όλα τα άτομα της F 1 γενιάς δεν έχουν κέρατα συμπεραίνουμε ότι η απουσία κεράτων επικρατεί της παρουσίας κεράτων. Έστω Α=απουσία κεράτων, α=παρουσία κεράτων, όπου Α>α. P: αακκ Χ ΑΑΛΛ γαμέτες: ακ ΑΛ F 1 : ΑαΚΛ Χ ΑαΚΛ Φ.Α: 6 λευκό-κόκκινο και απουσία κεράτων 3 λευκά και απουσία κεράτων 3 κόκκινα και απουσία κεράτων 4

5 2 λευκό-κόκκινο και παρουσία κεράτων 1 λευκό και παρουσία κεράτων 1 κόκκινο και παρουσία κεράτων Γ.Α: 4ΑαΚΛ, 2ΑαΚΚ, 2ΑαΛΛ, 2ΑΑΚΛ, 2ααΚΛ, 1ΑΑΚΚ, 1ΑΑΛΛ, 1ααΚΚ, 1ααΛΛ ΕΠΙΚΡΑΤΕΣ-ΦΥΛΟΣΥΝΔΕΤΟ 13. Γυναίκα φυσιολογική και άντρας αλφικός απόκτησαν ένα αγόρι αλφικό και δαλτωνικό. α. Ποιοι είναι οι γονότυποι των ατόμων; β. Ποια η πιθανότητα να αποκτήσουν κορίτσι αλφικό και δαλτωνικό; γ. Ποια η πιθανότητα τα 4 επόμενα παιδιά τους να είναι με την σειρά: παιδί φυσιολογικό-αγόρι δαλτωνικό-κορίτσι αλφικό-αγόρι αλφικό και δαλτωνικό; α. Α=φυσιολογικός, α=αλφικός, όπου Α>α και Χ Δ =φυσιολογικός, Χ δ =δαλτωνικός, όπου Χ Δ >Χ δ Γυναίκα ΑαΧ Δ Χ δ, άνδρας ααχ Δ Υ, 1 ο αγόρι ααχ δ Υ β. P=0 γ. P=3/8 2/4 2/4 1/4=12/512=3/ Μια γυναίκα φυσιολογική της οποίας ο πατέρας έχει δρεπανοκυτταρική αναιμία και είναι δαλτωνικός παντρεύεται με άνδρα φυσιολογικό. Ποια η πιθανότητα το παιδί που θα γεννηθεί να είναι δαλτωνικό και φορέας της δρεπανοκυτταρικής αναιμίας; Β=φυσιολογική β-αλυσίδα, β s =δρεπανοκυτταρική αναιμία, όπου Β> β s Χ Δ =φυσιολογικός, Χ δ =δαλτωνικός, όπου Χ Δ >Χ δ Οι γονότυποι είναι: Γυναίκα:Ββ s Χ Δ Χ δ, πατέρας γυναίκας:β s β s Χ δ Υ, άνδρας:ββ s Χ Δ Υ ή ΒΒΧ Δ Υ Διακρίνουμε 2 περιπτώσεις. 1 η περίπτωση: Ββ s Χ Δ Χ δ Χ Ββ s Χ Δ Υ P 1 = 1/8 1/2= 1/16 2 η περίπτωση: Ββ s Χ Δ Χ δ Χ ΒΒΧ Δ Υ P 2 = 2/16 1/2=1/16 Άρα Pολ=P 1 +P 2 =2/16=1/8 15. Από την διασταύρωση θηλυκού ατόμου Drosophila με κόκκινα μάτια και κανονικές τρίχες σώματος με αρσενικό άτομο με καφέ μάτια και διχαλωτές τρίχες σώματος στην F 2 γενιά προέκυψαν τα ακόλουθα άτομα: 40 αρσενικά με κόκκινα μάτια και κανονικές τρίχες. 83 θηλυκά με κόκκινα μάτια και κανονικές τρίχες. 42 αρσενικά με κόκκινα μάτια και διχαλωτές τρίχες. 15 αρσενικά με καφέ μάτια και κανονικές τρίχες. 29 θηλυκά με καφέ μάτια και κανονικές τρίχες. 13 αρσενικά με καφέ μάτια και διχαλωτές τρίχες. Να βρεθούν οι γονότυποι των ατόμων και η φαινοτυπική και γονοτυπική αναλογία της F 2 γενιάς. Για το χρώμα των ματιών: Στα αρσενικά, 82 κόκκινα : 28 καφέ 3 : 1 Στα θηλυκά, 83 κόκκινα : 29 καφέ 3 : 1, Άρα κόκκινα>καφέ, έστω Κ=κόκκινο, κ=καφέ, όπου Κ>κ Τα άτομα που διασταυρώνονται είναι ετερόζυγα, δηλαδή Κκ Χ Κκ Για τις τρίχες του σώματος: Στα αρσενικά, 55 κανονικές : 55 διχαλωτές= 1 : 1 Στα θηλυκά: όλες κανονικές, Άρα το γονίδιο είναι φυλοσύνδετο, έστω Χ Δ =κανονικές, Χ δ =διχαλωτές, όπου Χ Δ >Χ δ Τα άτομα που διασταυρώνονται είναι Χ Δ Χ δ Χ Χ Δ Υ, οπότε P: ΚΚΧ Δ Χ Δ Χ κκχ δ Υ γαμέτες: ΚΧ Δ κχ δ, κυ F 1 : ΚκΧ Δ Χ δ, ΚκΧ Δ Υ γαμέτες: ΚΧ Δ, ΚΧ δ, κχ Δ, κχ δ ΚΧ Δ, ΚΥ, κχ Δ, κυ 5

6 F 2 : ΚΧ Δ ΚΥ κχ Δ κυ ΚΧ Δ ΚΚΧ Δ Χ Δ ΚΚΧ Δ Υ ΚκΧ Δ Χ Δ ΚκΧ Δ Υ ΚΧ δ ΚΚΧ Δ Χ δ ΚΚΧ δ Υ ΚκΧ Δ Χ δ ΚκΧ δ Υ κχ Δ ΚκΧ Δ Χ Δ ΚκΧ Δ Υ κκχ Δ Χ Δ κκχ Δ Υ κχ δ ΚκΧ Δ Χ δ ΚκΧ δ Υ κκχ Δ Χ δ κκχ δ Υ Γ.Α: 2 ΚκΧ Δ Χ δ : 2 ΚκΧ Δ Χ Δ : 1 ΚΚΧ Δ Χ Δ : 1 ΚΚΧ Δ Χ δ : 1 κκχ Δ Χ Δ : 1 κκχ Δ Χ δ : 2 ΚκΧ Δ Υ : 2 ΚκΧ δ Υ : 1 ΚΚΧ Δ Υ : 1 ΚΚΧ δ Υ : 1 κκχ Δ Υ : 1 κκχ δ Υ Φ.Α: 6 κόκκινα και κανονικά 2 καφέ και κανονικά 3 κόκκινα και κανονικά 3 κόκκινα και διχαλωτά 1 καφέ και κανονικό 1 καφέ και διχαλωτό 2 ΜΕ ΕΝΔΙΑΜΕΣΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 16. Ραπανάκια επιμήκη με κόκκινο χρώμα διασταυρώνονται με ραπανάκια σφαιρικά με λευκό χρώμα και στην F 2 γενιά προκύπτουν τα παρακάτω άτομα: 28 άτομα ωοειδή και μωβ 13 άτομα ωοειδή και κόκκινα 14 άτομα ωοειδή και λευκά 13 άτομα επίμηκες και μωβ 15 άτομα σφαιρικά και μωβ 7 άτομα επίμηκες και κόκκινα 9 άτομα επίμηκες και λευκά 8 άτομα σφαιρικά και κόκκινα 6 άτομα σφαιρικά και λευκά Ποιος ο τρόπος κληρονόμησης των γονιδίων και ποιοι οι γονότυποι των ατόμων της πατρικής (P) και F 1 γενιάς; Από τα δεδομένα της άσκησης προκύπτει ότι: Κόκκινα : μωβ : λευκά 1 : 2 : 1 και Επιμήκες : ωοειδές : σφαιρικά 1 : 2 : 1. Άρα και οι δύο ιδιότητες εξηγούνται με βάση την ενδιάμεση κληρονομικότητα. Έστω Κ=κόκκινο, Λ=λευκό, όπου Κ=Λ και Ε=επιμήκες, Σ=σφαιρικό, όπου Ε=Σ P: ΕΕΚΚ Χ ΣΣΛΛ γαμέτες: ΕΚ ΣΛ F 1 : ΕΣΚΛ Χ ΕΣΚΛ 1 ΘΝΗΣΙΓΟΝΟ 17. Ένα υπολειπόμενο γονίδιο στον άνθρωπο όταν βρεθεί σε ομόζυγη κατάσταση προκαλεί συγκόλληση των πνευμόνων με αποτέλεσμα το θάνατο των παιδιών μόλις γεννιούνται. Ένας άνδρας με φαινυλκετονουρία και ετερόζυγος ως προς το γονίδιο αυτό των πνευμόνων παντρεύεται γυναίκα ετερόζυγη ως προς το γονίδιο αυτό των πνευμόνων. α. Ποιοι είναι οι γονότυποι των γονέων; β. Ποια η πιθανότητα το 1 ο παιδί να πεθάνει; γ. Ποια η πιθανότητα από τα 3 πρώτα παιδιά που θα γεννηθούν τα 2 να έχουν φαινυλκετονουρία και να είναι ετερόζυγα ως προς το θνησιγόνο γονίδιο και το άλλο να μην εμφανίζει φαινυλκετονουρία και να μην είναι ετερόζυγο ως προς το θνησιγόνο γονίδιο; Έστω Σ=φυσιολογικό, Σ =συγκόλληση πνευμόνων Φ=φυσιολογικό, φ=φαινυλκετονουρία, όπου Φ>φ 6

7 2 ΘΝΗΣΙΓΟΝΑ α. ΣΣ φφ Χ ΣΣ ΦΦ (1/2) ή ΣΣ Φφ (1/2) 1 η περίπτωση: ΣΣ φφ Χ ΣΣ ΦΦ P 1 = 1/2 1/4= 1/8 () P 2 = 0 (φαινυλκετονουρία και ετερόζυγος) P 3 = 1/2 1/3= 1/6 (φυσιολογικός και όχι ετερόζυγος) 2 η περίπτωση: ΣΣ φφ Χ ΣΣ Φφ P 1 = 1/2 1/4= 1/8 () P 2 = 1/2 1/3= 1/6 (φαινυλκετονουρία και ετερόζυγος) P 3 = 1/2 1/6= 1/12 (φυσιολογικός και όχι ετερόζυγος) β. Pολ=P 1 + P 1 =1/8 + 1/8=1/4 γ. Παιδί με φαινυλκετονουρία και ετερόζυγο: P 2 + P 2 =0 + 1/6=1/6 Παιδί φυσιολογικό και δεν είναι ετερόζυγο: P 3 + P 3 =1/6 + 1/12=3/12=1/4 Για τα 3 παιδιά ισχύουν οι παρακάτω συνδυασμοί: 1 ο :Φαινυλκετονουρία, 2 ο :Φαινυλκετονουρία, 3 ο :Φυσιολογικό= 1/6 1/6 1/4=1/144= Pα 1 ο :Φαινυλκετονουρία, 2 ο :Φυσιολογικό, 3 ο :Φαινυλκετονουρία= 1/6 1/4 1/6=1/144= Pβ 1 ο :Φυσιολογικό, 2 ο :Φαινυλκετονουρία, 3 ο :Φαινυλκετονουρία= 1/4 1/6 1/6=1/144= Pγ Άρα Pα+Pβ+Pγ=1/144+1/144+1/144=3/144=1/48 Παρατήρηση Τα ποσοστά P 2, P 3, P 2 και P 3 υπολογίζονται επί των ατόμων που ζουν αφού το ερώτημα αναφέρεται σε παιδιά που επιβιώνουν. 18. Στη Drosoplila διασταύρωση ατόμων με πορφυροειδές χρώμα και μικρού πάχους τρίχες δίνει τους παρακάτω απογόνους: 21 άτομα με πορφυροειδή χρώμα και μικρού πάχους τρίχες 9 άτομα με πορφυροειδή χρώμα και κανονικές τρίχες 11 άτομα με κανονικό χρώμα και μικρού πάχους τρίχες 6 άτομα με κανονικό χρώμα και κανονικές τρίχες α. Να εξηγήσετε τα αποτελέσματα και να δείξετε τον γονότυπο των γονέων. β. Ποιος θεωρητικά είναι ο αριθμός των ατόμων που έχουν πεθάνει; α. Από τα δεδομένα της άσκησης προκύπτει: Πορφυροειδές χρώμα : Κανονικό χρώμα 2 : 1 Μικρού πάχους τρίχες : Κανονικές τρίχες 2 : 1 Άρα υπάρχουν 2 θνησιγόνα αυτοσωμικά γονίδια. Έστω Π=κανονικό χρώμα, Π =θνησιγόνο, ΠΠ = πορφυροειδές χρώμα και Κ=κανονικές τρίχες, Κ =θνησιγόνο, ΚΚ =μικρού πάχους τρίχες, Άρα, P: ΠΠ ΚΚ Χ ΠΠ ΚΚ β. 9 άτομα γεννιούνται στα Χ; Χ άτομα. Άρα πεθαίνουν γύρω στα άτομα. 19. Από τη διασταύρωση θηλυκών ποντικών με κίτρινο χρώμα τριχώματος και μέσου μεγέθους πόδια με αρσενικά με κίτρινο χρώμα και κανονικά πόδια γεννήθηκαν: 20 θηλυκά με μαύρο χρώμα και κανονικά πόδια. 22 θηλυκά με μαύρο χρώμα και μέσου μεγέθους πόδια. 42 θηλυκά με κίτρινο χρώμα και κανονικά πόδια. 39 θηλυκά με κίτρινο και μέσου μεγέθους πόδια. 22 αρσενικά με μαύρο τρίχωμα και κανονικά πόδια. 43 αρσενικά με κίτρινο τρίχωμα και κανονικά πόδια. Να προσδιορίσετε τον τύπο κληρονομικότητας για κάθε γονίδιο και να δείξετε τη διασταύρωση. Για το χρώμα τριχώματος: Στα θηλυκά, κίτρινα : μαύρα 2 : 1 Στα αρσενικά, κίτρινα : μαύρα 2 : 1 Άρα υπάρχει 1 θνησιγόνο αυτοσωμικό γονίδιο. Έστω Μ=μαύρο χρώμα, Μ =θνησιγόνο, ΜΜ =κίτρινο χρώμα 7

8 Για το μέγεθος των ποδιών: Στα θηλυκά, κανονικά : μέσου μεγέθους πόδια 1 : 1 Στα αρσενικά: όλα κανονικά Επίσης : 2 : 1 Άρα υπάρχει ένα θνησιγόνο φυλοσύνδετο γονίδιο. Έστω Χ Κ =κανονικό, Χ Κ1 =θνησιγόνο P: ΜΜ Χ Κ Χ Κ1 Χ ΜΜ Χ Κ Υ γαμέτες: ΜΧ Κ, ΜΧ Κ1, Μ Χ Κ, Μ Χ Κ1 ΜΧ Κ, ΜΥ, Μ Χ Κ, Μ Υ F1: ΜΧ Κ ΜΥ Μ Χ Κ Μ Υ ΜΧ Κ ΜΧ Κ1 Μ Χ Κ Μ Χ Κ1 2 ΦΥΛΟΣΥΝΔΕΤΑ ΜΜΧ Κ Χ Κ μαύρο κανονικό ΜΜΧ Κ Χ Κ1 μαύρο μέσου μεγέθους πόδια ΜΜ Χ Κ Χ Κ κίτρινο κανονικό ΜΜ Χ Κ Χ Κ1 κίτρινο μέσου μεγέθους πόδια ΜΜΧ Κ Υ μαύρο κανονικό ΜΜΧ Κ1 Υ ΜΜ Χ Κ Υ κίτρινο κανονικό ΜΜ Χ Κ1 Υ ΜΜ Χ Κ Χ Κ κίτρινο κανονικό ΜΜ Χ Κ Χ Κ1 κίτρινο μέσου μεγέθους πόδια Μ Μ Χ Κ Χ Κ Μ Μ Χ Κ Χ Κ1 ΜΜ Χ Κ Υ κίτρινο κανονικό ΜΜ Χ Κ1 Υ Μ Μ Χ Κ Υ Μ Μ Χ Κ1 Υ 20. Ο κυαμισμός (η έλλειψη του ένζυμου γλυκοζο-6-φωσφορικής αφυδρογονάσης) οφείλεται σε υπολειπόμενο φυλοσύνδετο γονίδιο. Άνδρας κυαμικός με αιμορροφιλία από τον 1 ο του γάμο αποκτάει έναν γιο φυσιολογικό και μια κόρη κυαμική και αιμορροφιλική. Από τον 2 ο του γάμο αποκτάει έναν γιο αιμορροφιλικό και μια κόρη κυαμική. α. Να προσδιοριστούν οι γονότυποι των ατόμων. β. Ποια η πιθανότητα η 2 η κόρη να κάνει γιο που φέρει και τις δύο ιδιότητες; γ. Ποια η πιθανότητα ο 1 ος γιος να αποκτήσει κόρη κυαμική και αιμορροφιλική; δ. Εάν ο 2 ος γιος παντρευτεί γυναίκα με κυαμισμό ποια η πιθανότητα να αποκτήσουν παιδί που φέρει τουλάχιστον την μία από τις δύο ιδιότητες; Έστω Χ Κ =φυσιολογικός, Χ κ =κυαμισμός, όπου Χ Κ >Χ κ και Χ Α =φυσιολογικός, Χ α =αιμορροφιλία, όπου Χ Α >Χ α α. Άνδρας Χ κα Υ, 1 η γυναίκα Χ ΚΑ Χ κα, 1 η κόρη Χ κα Χ κα, 1 ος γιος Χ ΚΑ Υ 2 η γυναίκα Χ Κα Χ κα, 2 η κόρη Χ κα Χ κα, 2 ος γιος Χ Κα Υ β. P=25% γ. P=0 δ. Η γυναίκα του μπορεί να έχει γονότυπο Χ κα Χ κα ή Χ κα Χ κα (κάθε γονότυπος έχει πιθανότητα 1/2) Διακρίνουμε 2 περιπτώσεις: 1 η περίπτωση: Χ Κα Υ Χ Χ κα Χ κα P 1 = 1/2 1/2 =1/4 2 η περίπτωση: Χ Κα Υ Χ Χ κα Χ κα P 2 = 1/2 3/4 =3/8 Pολ= P 1 +P 2 =1/4+3/8=2/8+3/8=5/8 8

9 ΟΜΑΔΑ Β 2 ΕΠΙΚΡΑΤΗ 21. Δύο αρσενικοί σκύλοι Α και Β διασταυρώνονται με τα θηλυκά άτομα Γ και Δ. Όλα τα άτομα έχουν μαύρο χρώμα και κοντό τρίχωμα. Από τη διασταύρωση του Α σκύλου με το θηλυκό Γ και το θηλυκό Δ προκύπτουν απόγονοι που έχουν όλοι μαύρο χρώμα και κοντό τρίχωμα. Η διασταύρωση σκύλου Β με το Γ δίνει απογόνους, άλλοι εκ των οποίων έχουν μαύρο χρώμα και άλλοι καστανό, αλλά όλοι κοντό τρίχωμα. Ο ίδιος σκύλος με το θηλυκό Δ δίνει απογόνους, άλλοι εκ των οποίων έχουν κοντό και άλλοι μακρύ τρίχωμα, αλλά όλοι μαύρο. Τα γονίδια για το χρώμα και το τρίχωμα βρίσκονται σε διαφορετικά χρωμοσώματα. α. Να βρείτε τον τύπο κληρονομικότητας των εν λόγω γονιδίων. β. Να βρείτε τους γονότυπους των ατόμων Α, Β, Γ και Δ. α. Και στα δύο ζεύγη γονιδίων τα αλληλόμορφά τους έχουν σχέση επικρατέςυπολειπόμενου Μ=μαύρο, μ=καστανό, όπου Μ>μ, Κ=κοντό, κ=μακρύ, όπου Κ>κ β. Α: ΜΜΚΚ, Β: ΜμΚκ, Γ: ΜμΚΚ, Δ: ΜΜΚκ 22. Το γονίδιο D είναι επικρατές αυτοσωμικό και ελέγχει το σχηματισμό κοχλία στο αυτί (όργανο απαραίτητο για τη λειτουργία της ακοής). Το γονίδιο Ε είναι επικρατές αυτοσωμικό, ανεξάρτητο του D και ελέγχει το σχηματισμό ακουστικού νεύρου. Αν ένα άτομο είναι ομόζυγο υπολειπόμενο για ένα από τα δύο ζεύγη γονιδίων, είναι κουφό. Δύο κουφοί γονείς επισκέφθηκαν γενετιστή, ο οποίος τους διαβεβαίωσε ότι αποκλείεται να αποκτήσουν κουφό παιδί. α. Ποιοι είναι οι γονότυποι των γονέων; β. Αν ένα αγόρι τους παντρευτεί με γυναίκα που έχει ίδιο γονότυπο με αυτό, τι ποσοστό των απογόνων τους θα έχει φυσιολογική ακοή; α. Ο ένας γονέας έχει γονότυπο ddee και ο άλλος DDee β. 9 : 16 φυσιολογική ακοή ΕΠΙΚΡΑΤΕΣ-ΣΥΝΕΠΙΚΡΑΤΕΣ 23. Ένας άντρας και μια γυναίκα έχουν 12,5% πιθανότητα να αποκτήσουν παιδί με μία από τις τέσσερις ομάδες αίματος και οικογενή υπερχοληστερολαιμία ή παιδί με μία από τις τέσσερις ομάδες αίματος το οποίο είναι φυσιολογικό. Από τα δεδομένα αυτά να βρεις τους γονότυπους του άντρα και της γυναίκας. 12,5% πιθανότητα σημαίνει 1/8 Για να έχουν πιθανότητα να αποκτήσουν παιδί με μια από τις τέσσερις ομάδες αίματος θα πρέπει οι γονείς να έχουν γονότυπους I Α i Χ I B i ή I Β i Χ I Α i Η πιθανότητα αυτή είναι 1/4 (η ίδια και στις δύο περιπτώσεις) Η οικογενής υπερχοληστερολαιμία οφείλεται σε επικρατές αυτοσωμικό γονίδιο. Για να αποκτήσουν φυσιολογικό παιδί (1/2) ή παιδί με τη ασθένεια (1/2) θα πρέπει οι δύο γονείς να έχουν γονότυπους: Υυ Χ υυ ή υυ Χ Υυ, (Υ= οικογενής υπερχοληστερολαιμία) Άρα οι γονότυποι των ατόμων είναι: I Α iυυ Χ I B iυυ ή I Α iυυ Χ I B iυυ ή I Β iυυ Χ I Α iυυ ή I Β iυυ Χ I Α iυυ ΕΠΙΚΡΑΤΕΣ-ΦΥΛΟΣΥΝΔΕΤΟ 24. Από τη διασταύρωση δύο εντόμων Drosophilla προέκυψαν οι εξής απόγονοι: 21 θηλυκά με γκρι χρώμα σώματος και με σμήριγγες 20 θηλυκά με μαύρο χρώμα σώματος και με σμήριγγες 10 αρσενικά με γκρι χρώμα σώματος και με σμήριγγες 11 αρσενικά με μαύρο χρώμα σώματος και με σμήριγγες 9

10 11 αρσενικά με γκρι χρώμα σώματος και χωρίς σμήριγγες 10 αρσενικά με μαύρο χρώμα σώματος και χωρίς σμήριγγες Ποιοι είναι οι πιθανοί γονότυποι και φαινότυποι των ατόμων της πατρικής γενιάς; Για το χρώμα σώματος: Στα αρσενικά, 21 γκρι : 21 μαύρα = 1 : 1 Στα θηλυκά, 21 γκρι : 20 μαύρα 1 : 1, Άρα το γονίδιο που ελέγχει το χρώμα του σώματος είναι αυτοσωμικό. Επειδή όμως η αναλογία είναι 1 : 1 εξετάζουμε 2 περιπτώσεις. Γ=γκρι, γ=μαύρο, όπου Γ>γ και γ=γκρι, Γ=μαύρο, όπου Γ>γ. Σε κάθε περίπτωση όμως οι γονότυποι των γονέων για να προκύψει η αναλογία αυτή είναι Γγ Χ γγ Για τις σμήριγγες: Όλα τα θηλυκά με σμήριγγες 21 αρσενικά με σμήριγγες : 21 αρσενικά χωρίς σμήριγγες = 1 : 1 Άρα το γονίδιο είναι φυλοσύνδετο, έστω Χ Σ =σμήριγγες, Χ σ =χωρίς σμήριγγες, όπου Χ Σ >Χ σ Τα άτομα θα έχουν γονότυπους Χ Σ Χ σ Χ Χ Σ Υ. Άρα οι πιθανές διασταυρώσεις της P γενιάς είναι: ΓγΧ Σ Χ σ Χ γγχ Σ Υ και γγχ Σ Χ σ Χ ΓγΧ Σ Υ Πιθανοί φαινότυποι: 1) ΓγΧ Σ Χ σ : θηλυκό γκρι με σμήριγγες 2) ΓγΧ Σ Χ σ : θηλυκό μαύρο με σμήριγγες 3) γγχ Σ Υ: αρσενικό μαύρο με σμήριγγες 4) γγχ Σ Υ: αρσενικό γκρι με σμήριγγες ΟΜΑΔΕΣ ΑΙΜΑΤΟΣ-ΦΥΛΟΣΥΝΔΕΤΟ 25. Μια γυναίκα που ανήκει στην ομάδα αίματος Α και έχει κανονική όραση αποκτά πέντε παιδιά από δύο άνδρες. Ο ένας ανήκει στην ομάδα αίματος ΑΒ και είχε δαλτωνισμό και ο άλλος στην ομάδα Α και είχε κανονική όραση. Τα παιδιά είναι: α) Ένα αγόρι με Α ομάδα αίματος και δαλτωνισμό. β) Ένα αγόρι με Ο ομάδα αίματος και δαλτωνισμό. γ) Ένα κορίτσι με Α ομάδα αίματος και δαλτωνισμό. δ) Ένα κορίτσι με Β ομάδα αίματος και κανονική όραση. ε) Ένα κορίτσι με Α ομάδα αίματος και κανονική όραση. Ποιος από τους δύο άνδρες είναι ο πιο πιθανός πατέρας σε κάθε περίπτωση; Να εξηγηθούν οι απαντήσεις σας. 1 ο παιδί: 2/8 να ανήκει στον ΑΒ και 3/8 να ανήκει στον Α 2 ο παιδί: ανήκει στον Α 3 ο παιδί: ανήκει στον ΑΒ 4 ο παιδί: ανήκει στον ΑΒ 5 ο παιδί: 2/8 να ανήκει στον ΑΒ και 6/8 να ανήκει στον Α ΘΝΗΣΙΓΟΝΟ 26. Σε μια ράτσα προβάτου δίνονται οι παρακάτω διασταυρώσεις ατόμων: Φυσιολογικό τρίχωμα και γκρίζο χρώμα 25% νεκρά, x Φυσιολ. και γκρίζα: Φυσιολ. μαύρα=2:1 Φυσιολογικό τρίχωμα και γκρίζο χρώμα Μειωμένο τρίχωμα και μαύρο χρώμα x Μειωμένο τρίχωμα και μαύρο χρώμα Φυσιολογικό τρίχωμα και μαύρο χρώμα x Μειωμένο τρίχωμα και μαύρο χρώμα Όλα επιβιώνουν και έχουν μειωμένο τρίχωμα με μαύρο χρώμα Όλα επιβιώνουν και έχουν πολύ τρίχωμα και μαύρο χρώμα α. Τι συμπεραίνετε για τα γονίδια; β. Αν από τους απογόνους της διασταύρωσης: άτομα με φυσιολογικό τρίχωμα και γκρίζο χρώμα x άτομα με μειωμένο τρίχωμα και γκρίζο χρώμα πεθαίνουν 10 άτομα να βρείτε τους φαινότυπους και τον πιθανό αριθμό των υπόλοιπων ατόμων. 10

11 α. Από την 1 η διασταύρωση: Φυσιολογικό Χ Φυσιολογικό= Φυσιολογικό Από τη 2 η διασταύρωση: Μειωμένο Χ Μειωμένο = Μειωμένο Από την 3 η διασταύρωση: Φυσιολογικό Χ Μειωμένο= Πολύ τρίχωμα. Άρα η ιδιότητα εξηγείται με βάση την ενδιάμεση κληρονομικότητα (αυτοσωμικό γονίδιο). Έστω Φ=φυσιολογικό τρίχωμα, Μ=μειωμένο τρίχωμα, όπου Φ=Μ. Από την 1 η διασταύρωση Γκρίζα : Μαύρα= 2 : 1, άρα θνησιγόνο γονίδιο (αυτοσωμικό) Έστω Γ=μαύρο, Γ =θνησιγόνο, ΓΓ =γκρίζο β. ΦΦΓΓ Χ ΜΜΓΓ γαμέτες: ΦΓ, ΦΓ ΜΓ, ΜΓ F 1 : ΦΜΓΓ, ΦΜΓΓ, ΦΜΓΓ, ΦΜΓ Γ Άρα 10 άτομα πεθαίνουν 10 άτομα πολύ τρίχωμα και μαύρα 20 άτομα πολύ τρίχωμα και γκρίζα 3 ΦΥΛΟΣΥΝΔΕΤΑ πολύ τρίχωμα και μαύρα πολύ τρίχωμα και γκρίζο πολύ τρίχωμα και γκρίζο 27. Μια κυαμική (κυαμισμός είναι η έλλειψη του ένζυμου γλυκοζο-6-φωσφορικής αφυδρογονάσης και οφείλεται σε υπολειπόμενο φυλοσύνδετο γονίδιο) και ετερόζυγη ως προς τον δαλτωνισμό και την αιμορροφιλία γυναίκα παντρεύεται άνδρα δαλτωνικό. α. Ποια η πιθανότητα το 1 ο παιδί να είναι δαλτωνικό; β. Ποια η πιθανότητα το 1 ο αγόρι, όταν γεννηθεί, να φέρει και τις 3 ιδιότητες; γ. Ποια η πιθανότητα τα 2 πρώτα παιδιά να είναι με τυχαία σειρά ένα κορίτσι φυσιολογικό και ένα αγόρι που φέρει τουλάχιστον τις 2 από τις 3 ιδιότητες; Έστω Χ Κ =φυσιολογικός, Χ κ =κυαμισμός, όπου Χ Κ >Χ κ Χ Δ =φυσιολογικός, Χ δ =δαλτωνισμός, όπου Χ Δ >Χ δ και Χ Α =φυσιολογικός, Χ α =αιμορροφιλία, όπου Χ Α >Χ α Οι γονότυποι των γονέων είναι: Χ ΚδΑ Υ και Χ κδα Χ κδα (1/2) ή Χ κδα Χ κδα (1/2) Διακρίνουμε 2 περιπτώσεις: 1 η περίπτωση: Χ ΚδΑ Υ Χ Χ κδα Χ κδα P 1 = 1/2 1/2 =1/4 (παιδί δαλτωνικό) P 2 = 1/2 1/2 =1/4 (1 ο αγόρι με τις 3 ιδιότητες) P 3 = 1/2 1/4 =1/8 (κορίτσι φυσιολογικό) P 4 = 1/2 1/4 =1/8 (αγόρι με 2 τουλάχιστον ιδιότητες) 2 η περίπτωση: Χ ΚδΑ Υ Χ Χ κδα Χ κδα P 1 = 1/2 1/2 =1/4 (παιδί δαλτωνικό) P 2 = 0 (1 ο αγόρι με τις 3 ιδιότητες) P 3 = 1/2 1/4 =1/8 (κορίτσι φυσιολογικό) P 4 = 1/2 1/2 =1/4 (αγόρι με 2 τουλάχιστον ιδιότητες) α. P= P 1 +P 1 =1/4+1/4=2/4=1/2 β. P= P 2 +P 2 =1/4+0=1/4 γ. P= P 3 +P 3 =1/8+1/8=2/8=1/4 (συνολική πιθανότητα για κορίτσι φυσιολογικό) P= P 4 +P 4 =1/8+1/4=3/8 (συνολική πιθανότητα για αγόρι με τουλάχιστον 2 από τις 3 ιδιότητες) Επειδή η σειρά είναι τυχαία υπάρχουν 2 περιπτώσεις. φυσιολογικό και με 2 τουλάχιστον από τις 3 ιδιότητες= 1/4 3/8=3/32 με 2 τουλάχιστον από τις 3 ιδιότητες και φυσιολογικό= 3/8 1/4=3/32 Άρα Pολ=3/32+3/32=6/32=3/16 ΠΑΡΑΤΗΡΗΣΗ: Στο ερώτημα β δεν χρειάζεται να πολλαπλασιαστεί η πιθανότητα με το 1/2 (πιθανότητα να είναι αγόρι) επειδή το ερώτημα αναφέρεται σε άτομο που όταν γεννηθεί θα είναι υποχρεωτικά αγόρι. 11

12 ΑΥΤΟΣΩΜΙΚΟ-ΦΥΛΟΣΥΝΔΕΤΟ ΜΕ ΑΝΑΣΤΡΟΦΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 28. Από την διασταύρωση, σε ένα είδος εντόμου, αρσενικών ατόμων με ίσες κεραίες και άσπρο χρώμα σώματος με θηλυκά άτομα με ίσες κεραίες και μαύρο χρώμα σώματος γεννήθηκαν: 92 αρσενικά με ίσες κεραίες και ασπρόμαυρο χρώμα σώματος 30 αρσενικά με κυρτές κεραίες και ασπρόμαυρο χρώμα σώματος 91 θηλυκά με ίσες κεραίες και άσπρο χρώμα σώματος 29 θηλυκά με κυρτές κεραίες και άσπρο χρώμα σώματος Να εξηγήσετε τον τρόπο που κληρονομούνται τα γνωρίσματα αυτά και να βρείτε τους γονότυπους των γονέων. Για το σχήμα των κεραιών: Στα αρσενικά, ίσες : κυρτές 3 : 1 Στα θηλυκά, ίσες : κυρτές 3 : 1 Άρα πρόκειται για αυτοσωμικό γονίδιο. Έστω Ι=ίσες, ι=κυρτές, όπου Ι>ι Για το χρώμα του σώματος: Τα αρσενικά έχουν διαφορετικές αναλογίες από τα θηλυκά. Επειδή τα αρσενικά εμφανίζουν τον ενδιάμεσο φαινότυπο (ασπρόμαυρο) αυτό σημαίνει ότι το γονίδιο που ελέγχει την ιδιότητα αυτή είναι φυλοσύνδετο και εξηγείται με την ενδιάμεση κληρονομικότητα. Επίσης τα αρσενικά είναι ΧΧ, ενώ τα θηλυκά ΧΥ. Έστω Χ Α =άσπρα, Χ Μ =μαύρα, όπου Χ Α = Χ Μ Άρα ΙιΧ Α Χ Α Χ ΙιΧ Μ Υ 12

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ)

ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ) ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ) 1. Στις αλεπούδες το ασηµόµαυρο χρώµα του τριχώµατος καθορίζεται από ένα υπολειπόµενο αλληλόµορφο

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC

ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις Αλληλεπιδράσεις γονιδίων Ι ασκήσεις 1. Στους σκύλους Labrador ένα θηλυκό άτομο με καστανό χρωματισμό διασταυρώθηκε με αρσενικό που είχε χρυσαφί χρωματισμό. Όλοι οι F1 απόγονοι είχαν μαύρο χρωματισμό. Η

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.)

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) Μενδελική κληρονομικότητα κεφάλαιο 5 Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) 5. Μενδελική κληρονομικότητα Το ενδιαφέρον για την κληρονομικότητα είναι πολύ παλιό, σχεδόν όσο και η ύπαρξη του ανθρώπινου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά ΠΡΟΒΛΗΜΑ 4.1 Στο σιτάρι, φυτά με κόκκινους σπόρους διασταυρώθηκαν με φυτά που είχαν λευκούς. Όλοι οι απόγονοι είχαν κόκκινους σπόρους. Μετά από την αυτογονιμοποίηση των φυτών της F 1, πήραμε στην F 2 :

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2

ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης.

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης. Ν Ε Β Η Γονίδιο ανθεκτικότητας στο αντιβιοτικό θέση έναρξης της αντιγραφής καθώς και τις θέσεις πάνω σε αυτό που αναγνωρίζουν και κόβουν οι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Δασική Γενετική Τα πειράματα του Mendel

Δασική Γενετική Τα πειράματα του Mendel Δασική Γενετική Τα πειράματα του Mendel Χειμερινό εξάμηνο 2014-2015 Παράδοξο... Οι απόγονοι μοιάζουν στους γονείς τους Δεν είναι όμως ακριβώς ίδιοι, ούτε με τους γονείς τους, ούτε μεταξύ τους Κληρονομικότητα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ Βιολογία Θετικής Κατεύθυνσης ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Α κ Θέµα 1 ο Από τις παρακάτω πολλαπλές απαντήσεις να επιλέξετε τη σωστή. 1. Αν ένα γονίδιο βακτηριακού DNA έχει µήκος 1500 ζεύγη βάσεων,

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΦΡΟΝΤΙΣΤΗΡΙΟ «ΕΝΑ» ΓΙΟΜΠΛΙΑΚΗΣ ΛΑΖΑΡΟΣ ΠΕΤΡΟΜΕΛΙΔΗΣ ΒΑΣΙΛΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Ο µέγιστος αριθµός διαφορετικών

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 24/5/2013 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων και ΕΠΑΛ (Οµάδα Β ).

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009

ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009 ΓΥΜΝΑΣΙΟ ΚΙΤΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ 2008-2009 ΓΡΑΠΤΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΙΟΥΝΙΟΥ 2009 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ(40 μονάδες) ΗΜΕΡΟΜΗΝΙΑ: / / 2009 ΤΑΞΗ: Γ ΓΥΜΝΑΣΙΟΥ ΔΙΑΡΚΕΙΑ: 2 ώρες(βιολογία-χημεία) Όνομα μαθητή /

Διαβάστε περισσότερα

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ

ΦΡΟΝΤΙΣΤΗΡΙΟ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ ΗΡΑΚΛΕΙΤΟΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β') ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Ε Ν Δ Ε Ι Κ Τ Ι Κ Ε Σ Α Π Α Ν Τ Η Σ Ε Ι Σ Θ Ε Μ Α Τ

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 18/5/2011 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ

ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ ΛΥΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΕΡΩΤΗΣΕΙΣ 1 ο και 2 ο ΚΕΦΑΛΑΙΟ 15:Γ, 39:Γ, 14:Α, 21:Β, 15:Δ, 11:Δ, 28: I Σ, II Λ, III Σ, IV Σ, V Σ, 41:Β, 29:Α, Β, Γ, 29:Β, 30:Α, 19:Β, 20:Β, 15:Α, 37:Β, 28:Α, 11:Δ, 15:Β, 31:Δ, 32:Γ,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368)

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368) ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα