ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά"

Transcript

1 ΠΡΟΒΛΗΜΑ 4.1 Στο σιτάρι, φυτά με κόκκινους σπόρους διασταυρώθηκαν με φυτά που είχαν λευκούς. Όλοι οι απόγονοι είχαν κόκκινους σπόρους. Μετά από την αυτογονιμοποίηση των φυτών της F 1, πήραμε στην F 2 : 145 φυτά με κόκκινους σπόρους, 94 με καστανούς και 17 με λευκούς σπόρους. Εξηγείστε αυτά τα αποτελέσματα και ελέγξτε στατιστικά την υπόθεσή σας. ΠΡΟΒΛΗΜΑ 4.2 Σε μια δικαστική υπόθεση, δύο άνδρες διεκδικούν την πατρότητα τριών παιδιών. Οι ομάδες αίματος των εμπλεκομένων ατόμων που αναφέρονται παρακάτω αφορούν τα συστήματα ΑΒ0, ΜΝ και Rhesus. Μπορείτε με αυτά τα στοιχεία να αποφασίσετε ποιος είναι ο πατέρας του κάθε παιδιού; 1 ος άνδρας: ΑΒ Ν Rh - 2 os άνδρας: 0 Μ Rh + Μητέρα: Α Ν Rh + 1 ο παιδί: 0 ΜΝ Rh + 2 ο παιδί: Α Ν Rh + 3 ο παιδί: Α ΜΝ Rh - ΠΡΟΒΛΗΜΑ 4.3 Σε ένα μαιευτήριο σε τέσσερα νεογέννητα δεν σημειώθηκαν από λάθος αμέσως οι μητέρες τους. Οι εξετάσεις αίματος των παιδιών και των τεσσάρων ζευγαριών έδωσαν τα παρακάτω αποτελέσματα: Ζευγάρια Παιδιά 1. 0 ΜΝ Rh - I. B N Rh - A MN Rh - 2. AB N Rh + II. B N Rh + AB N Rh - 3. B MN Rh + III. AB MN Rh - 0 MN Rh N Rh - IV. A M Rh + A N Rh + Μπορείτε να αποφασίσετε ποιο παιδί ανήκει σε κάθε ζευγάρι;

2 ΠΡΟΒΛΗΜΑ 4.4 Στη Drosophila melanogaster το κανονικό χρώμα των ματιών είναι σκούρο κόκκινο. Έστω ότι σας δίνονται δύο ομοζυγωτικά στελέχη, ένα με ανοιχτά κόκκινα μάτια (scarlet) και ένα με σκούρα καφέ (brown). Όταν διασταυρώνετε scarlet άτομα με brown όλοι οι απόγονοι έχουν κανονικά μάτια. Μια διασταύρωση F 1 x F 1 έδωσε στην F 2 τα εξής αποτελέσματα: 432 άτομα με κανονικά μάτια, 158 με scarlet, 139 με brown και 52 με άσπρα μάτια. Εξηγείστε αυτά τα αποτελέσματα. ΠΡΟΒΛΗΜΑ 4.5 Στην Drosophila melanogaster το υπερέχον αλληλόμορφο Η ελαττώνει τον αριθμό των σμηρίγων του σώματος με αποτέλεσμα να δημιουργείται μια χωρίς σμήριγες = hairless κατάσταση, ενώ παράλληλα λειτουργεί και ως υποτελές θανατογόνο. Σ έναν άλλο, ανεξάρτητα συνδυαζόμενο τόπο, το υπερέχον αλληλόμορφο S δεν επιδρά στον αριθμό των σμηρίγων, εκτός και αν είναι παρόν το Η. Στην περίπτωση αυτή το S καταστέλλει τη δράση του Η, αποκαθιστώντας έτσι την κανονική hairy κατάσταση. Το S λειτουργεί επίσης ως υποτελές θανατογόνο. α. Ποια αναλογία hairy προς hairless ατόμων αναμένονται ανάμεσα στους ζωντανούς απογόνους μιας διασταύρωσης μυγών που και οι δυο φέρουν το Η σε κατάσταση καταστολής; β. Αν οι hairless απόγονοι επαναδιασταυρωθούν με άτομα της γονικής γενιάς, ποια αναλογία απογόνων αναμένεται ανάμεσα στους ζωντανούς απογόνους; ΠΡΟΒΛΗΜΑ 4.6 Από διασταυρώσεις μεταξύ φασιανών που διέφεραν στο χρωματισμό του πτερώματος προέκυψαν τα παρακάτω αποτελέσματα. Βρείτε τον τρόπο κληρονόμησης του γνωρίσματος και τους γονότυπους των γονέων σε όλες τις παρακάτω διασταυρώσεις. Γονείς Απόγονοι Καφετί Κίτρινο Δακτυλιωτό 1 Καφετί x Καφετί Καφετί x Κίτρινο

3 3 Κίτρινο x Καφετί Καφετί x Δακτυλιωτό Κίτρινο x Κίτρινο Κίτρινο x Δακτυλιωτό Δακτυλιωτό x Κίτρινο Δακτυλιωτό x Δακτυλιωτό ΠΡΟΒΛΗΜΑ 4.7 Οι ποικιλίες Bombay και 770B του φυτού Linum usitatissinum (λινάρι), αντιδρούν διαφορετικά στις φυλές 22 και 24 του μύκητα Melampsora lini, που προκαλεί σκωρίαση. Οι δύο ποικιλίες διασταυρώθηκαν μεταξύ τους και όλα τα φυτά της F 1 και F 2 διακρίθηκαν με βάση την αντίδρασή τους σε κάθε φυλή του μύκητα χωριστά, σε φυτά Α (ανθεκτικά) και Ε (ευαίσθητα). Τα αποτελέσματα παρουσιάζονται στον πίνακα παρακάτω: Γονείς Αριθμός φυτών Αντίδραση στη σκωρίαση Φυλή 22 Φυλή 24 Bombay Όλα Α Ε 770B Όλα Ε Α F 1 Όλα Α Α 128 Α Α F 2 44 Ε Α 14 Ε Ε 39 Α Ε Κάνετε μια υπόθεση που να εξηγεί αυτά τα αποτελέσματα και επεξεργασθείτε την με τη μέθοδο χ 2. ΠΡΟΒΛΗΜΑ 4.8 Από επαναλαμβανόμενες διασταυρώσεις υβριδίων χοίρων από τις αμιγείς σειρές Erma και Harvey με ουρά μήκους 25 εκ., γεννήθηκαν χοιρίδια που είχαν διαφορετικά μήκη ουρών όπως φαίνεται στον πίνακα που ακολουθεί.

4 Μήκος ουράς (εκ.) Αριθμός χοιριδίων Σημειώστε ότι τα χοιρίδια της φυλής Erma έχουν μήκος ουράς 15 εκ. και της Harvey 35 εκ. α. Πόσα ζευγάρια γονιδίων ελέγχουν αυτό το χαρακτηριστικό; β. Ποια είδη γενετικού μηχανισμού θα μπορούσαν να εξηγήσουν αυτό το αποτέλεσμα; ΠΡΟΒΛΗΜΑ 4.9 Πολλά πολυγονιδιακά συστήματα δεν δείχνουν συνεχή φαινοτυπική κατανομή αλλά ξαφνικές αλλαγές στο φαινότυπο σε ειδικές "κρίσιμες" γονιδιακές δόσεις. Για παράδειγμα σ ένα είδος Penstemon ο αριθμός των ανθέων σε κάθε φυτό ελέγχεται από τέσσερις ανεξάρτητους γονιδιακούς τόπους με τον εξής τρόπο: Όταν υπάρχουν δύο ή λιγότερες δόσεις από ένα υπερέχον γονίδιο, το φυτό έχει ένα άνθος, όταν υπάρχουν από τρεις μέχρι πέντε δόσεις το φυτό έχει δύο άνθη, και όταν έξη ή περισσότερες το φυτό έχει τρία άνθη. Αν αυτογονιμοποιηθεί ένα φυτό, ετεροζυγωτικό και για τους τέσσερις τόπους (Α 1 α 1 Α 2 α 2 Α 3 α 3 Α 4 α 4 ), ποια αναλογία απογόνων θα υπάρχει με ένα, δύο και τρία άνθη; ΠΡΟΒΛΗΜΑ 4.10 Ένα αυτοσωματικό υποτελές γονίδιο (tra=transformer) είναι υπεύθυνο για τη μετατροπή ενός θηλυκού ατόμου D. melanogaster σε φαινοτυπικά αρσενικό άτομο. Τα μετασχηματισμένα αυτά αρσενικά είναι στείρα, το δε γονίδιο δεν έχει καμιά επίδραση στα κανονικά αρσενικά άτομα. Διασταυρώνετε ένα ετεροζυγωτικό tra θηλυκό με ένα ομοζυγωτικό για τη μετάλλαξη αρσενικό. Ποια αναλογία φύλου περιμένετε στην F 1 γενιά; Αν επιτρέψετε στα άτομα της F 1 να διασταυρωθούν ελεύθερα μεταξύ τους, ποια θα είναι η αναλογία φύλου στην επόμενη γενιά; ΠΡΟΒΛΗΜΑ 4.11 Ένας εκτροφέας πανθήρων, δημιούργησε δύο φυλές. Η μία ήταν ροζ με κηλίδες (ροζ κηλιδωτή), και η άλλη μπλε χωρίς κηλίδες (ατόφιο μπλε). Οι αντίστροφες διασταυρώσεις ανάμεσα στις δύο αυτές φυλές έδιναν πάντα τα ίδια αποτελέσματα:

5 1/2 ατόφια ροζ 1/2 ατόφια μπλε. Οι ατόφιοι ροζ πάνθηρες που προκύψανε μ αυτόν τον τρόπο διασταυρώθηκαν μεταξύ τους και έτσι αναπτύχθηκε ένας μεγάλος αριθμός απογόνων που ήταν τεσσάρων ειδών με τις παρακάτω αναλογίες: 1/2 ατόφιο ροζ 1/6 ροζ με κηλίδες 1/4 ατόφιο μπλε 1/12 μπλε με κηλίδες Εξηγείστε αυτή την ιδιόμορφη φαινοτυπική αναλογία και προσδιορίστε τους γενότυπους, χρησιμοποιώντας σύμβολα της δικής σας εκλογής. ΠΡΟΒΛΗΜΑ 4.12 Στο φυτό πετούνια υπάρχουν δυο χρωστικές, κόκκινη και μπλε, οι οποίες όταν αναμειγνύονται δίνουν το κανονικό βυσσινί χρώμα στα πέταλα των λουλουδιών. Δύο διαφορετικά βιοσυνθετικά μονοπάτια συνθέτουν αυτές τις χρωστικές όπως φαίνεται παρακάτω. Το "άσπρο" αναφέρεται σε άχρωμα συστατικά ή στη μη ύπαρξη χρωστικής. Η κόκκινη χρωστική σχηματίζεται από ένα ενδιάμεσο προϊόν, χρώματος κίτρινου το οποίο σε φυσιολογικές συνθήκες βρίσκεται σε πολύ μικρή συγκέντρωση στα έγχρωμα πέταλα. Ένα τρίτο βιοσυνθετικό μονοπάτι τα προϊόντα του οποίου δεν συμμετέχουν φυσιολογικά στο χρωματισμό των πετάλων, δεν επηρεάζει τα κόκκινα και μπλε μονοπάτια, όμως αν δημιουργηθεί κάποιο από τα ενδιάμεσα προϊόντα του (το άσπρο 3 ) και συσσωρευτεί, μπορεί να μετατραπεί στο κίτρινο ενδιάμεσο του κόκκινου μονοπατιού. Στο διάγραμμα που ακολουθεί τα A, B, C και D αντιπροσωπεύουν ένζυμα, τα οποία δημιουργούνται από ασύνδετα γονίδια και συμβολίζονται με τα ίδια γράμματα. 1 ο Βιοσυνθετικό μονοπάτι: άσπρο 1 Ε μπλε 2 ο Βιοσυνθετικό μονοπάτι: άσπρο 2 A κίτρινο B κόκκινο 3 ο Βιοσυνθετικό μονοπάτι: άσπρο 3 D C άσπρο 4 Θεωρήστε ότι τα κανονικά αλληλόμορφα είναι υπερέχοντα και παράγουν λειτουργικό ένζυμο ενώ τα υποτελή δεν παράγουν. Βρείτε ποιοι συνδυασμοί αμιγών σειρών διασταυρώνονται για να παραχθούν στην F 2 οι εξής αναλογίες

6 Α. 9 βυσσινί : 3 πράσινο : 4 μπλε Β. 9 βυσσινί : 3 κόκκινο : 3 μπλε : 1 άσπρο Γ. 13 βυσσινί : 3 μπλε Δ. 9 βυσσινί : 3 κόκκινο : 3 πράσινο : 1 κίτρινο Σημειώστε ότι η ανάμιξη μπλε και κίτρινης χρωστικής δημιουργεί πράσινο χρώμα. Τέλος καμιά μετάλλαξη δεν είναι θανατογόνος. ΠΡΟΒΛΗΜΑ 4.13 Σε κάποιο είδος μύγας, το κανονικό χρώμα των ματιών είναι κόκκινο (R). Βρέθηκαν τέσσερις μεταλλαγμένοι φαινότυποι για το χρώμα των ματιών, οι εξής: Δύο είχαν κίτρινα μάτια (Υ 1 & Υ 2 ), ένας ήταν καφέ (Β) και ένας πορτοκαλί (Ο). Δημιουργήθηκαν αμιγείς σειρές και για τους τέσσερις φαινοτύπους και έγιναν όλες οι διασταυρώσεις μεταξύ τους. Τα άτομα από κάθε F 1 διασταυρώθηκαν μεταξύ τους ώστε να παραχθεί η F 2. Οι διασταυρώσεις και τα αποτελέσματα φαίνονται στον πίνακα που ακολουθεί: α. Χρησιμοποιώντας δικά σας σύμβολα, δείξτε τους γονότυπους κάθε σειράς. β. Δείξτε πώς προκύπτουν οι αναλογίες των F 1 και F 2 γενιών. γ. Αν κατανοείτε πώς προκύπτουν βιοχημικά αυτοί οι φαινότυποι, βρείτε ένα βιοχημικό μονοπάτι που μπορεί να εξηγήσει αυτές τις γενετικές αναλογίες, δείχνοντας ποιο γονίδιο είναι υπεύθυνο για κάθε ένζυμο. Y 1 Y 2 B O Y 1 F 1 Όλα κίτρινα Όλα κόκκινα Όλα κόκκινα Όλα κόκκινα F 2 Όλα κίτρινα 9 κόκκινα 9 κόκκινα 9 κόκκινα 7 κίτρινα 4 κίτρινα 4 πορτοκαλί 3 καφέ 3 κίτρινα Y 2 F 1 Όλα κίτρινα Όλα κόκκινα Όλα κόκκινα F 2 Όλα κίτρινα 9 κόκκινα 9 κόκκινα 4 κίτρινα 4 κίτρινα 3 καφέ 3 πορτοκαλί B F 1 Όλα καφέ Όλα κόκκινα

7 F 2 Όλα καφέ 9 κόκκινα 4 πορτοκαλί 3 καφέ O F 1 Όλα πορτοκαλί F 2 Όλα πορτοκαλί ΠΡΟΒΛΗΜΑ 4.14 Μια διασταύρωση ενός αμιγούς φυτού (σκυλάκι) με άσπρα άνθη με ένα επίσης αμιγές με κόκκινα άνθη έδωσε στην F 1 φυτά με άσπρα άνθη. Η αυτογονιμοποίηση των φυτών της F 1 έδωσε στην F 2 τα εξής αποτελέσματα: 240 με άσπρα άνθη 61 με κόκκινα άνθη (ατόφια), και 19 με κηλιδωτά κόκκινα άνθη. 320 α. Προτείνετε μια υπόθεση που να εξηγεί αυτά τα αποτελέσματα. β. Ένα φυτό της F 2 με άσπρα άνθη διασταυρώθηκε με ένα φυτό επίσης της F 2 με ατόφια κόκκινα άνθη και έδωσαν: 50% με άσπρα άνθη 25% με ατόφια κόκκινα άνθη, και 25% κηλιδωτά κόκκινα άνθη. Ποιοι ήταν οι γονότυποι των φυτών της F 2 που διασταυρώθηκαν: ΠΡΟΒΛΗΜΑ 4.15 Τα άνθη της λιανοκάπαρης (Tropaelum majus) είναι απλά (S), διπλά (D), ή υπέρδιπλα (Sd). Τα θηλυκά υπέρδιπλα είναι στείρα και προέκυψαν από μια ποικιλία με διπλά άνθη. Διασταυρώσεις ανάμεσα σε ποικιλίες έδωσαν τα αποτελέσματα που φαίνονται στον παρακάτω πίνακα: Διασταύρωση Γονείς Απόγονοι 1 Αμιγές S x Αμιγές D Όλοι S 2 F 1 απόγονοι της (1) x F 1 απόγονοι της (1) 79 S : 27 D 3 Αμιγές D x Sd 112 Sd : 108 D

8 4 Αμιγές S x Sd 8 Sd : 7S 5 Αμιγές D x Sd απόγονοι της (4) 18 Sd :19 S 6 Αμιγές D x S απόγονοι της (4) 14 D : 16 S Χρησιμοποιώντας δικά σας σύμβολα, προτείνετε μια εξήγηση για αυτά τα αποτελέσματα ερμηνεύοντας όλους τους φαινοτύπους και την προέλευση των υπέρδιπλων. ΠΡΟΒΛΗΜΑ 4.16 Η παραγωγή χρωστικής στα μάτια της Drosophila melanogaster απαιτεί την παρουσία του υπερέχοντος αλληλόμορφου Α. Ένα άλλο, ανεξάρτητα συνδυαζόμενο γονίδιο, το Q μετατρέπει τη χρωστική σε ένα προϊόν με βυσσινί χρώμα ενώ το υποτελές του αλληλόμορφο q δεν την μετατρέπει, με αποτέλεσμα να παραμένει κόκκινη. Άτομα που δεν παράγουν χρωστική έχουν άσπρα μάτια. Διασταυρώθηκαν δύο αμιγείς σειρές (στελέχη) με τα παρακάτω αποτελέσματα: Ρ: με κόκκινα μάτια x με άσπρα μάτια F 1 : με βυσσινί μάτια με κόκκινα μάτια F 1 x F 1 F 2 : και : 3/8 με βυσσινί μάτια 3/8 με κόκκινα μάτια 2/8 με άσπρα μάτια ΠΡΟΒΛΗΜΑ 4.17 Έστω ότι ένας ετεροζυγωτικός kandiyohi (Kk) βάτραχος διασταυρώνεται με έναν κανονικό (kk). Ποιες είναι οι πιθανότητες των παρακάτω συνδυασμών σ έναν πληθυσμό απογόνων με 8 άτομα; 1. Όλα τα άτομα να είναι kandiyohi. 2. Με τη σειρά να είναι: kandiyohi, kandiyohi, κανονικά, κανονικά, kandiyohi, kandiyohi, κανονικά, κανονικά. 3. Τέσσερα κανονικά και τέσσερα kandiyohi. 4. Ένα ή περισσότερα kandiyohi. 5. Δύο ή περισσότερα kandiyohi. 6. Όχι λιγότερα από δύο kandiyohi ή δύο κανονικά.

9 ΠΡΟΒΛΗΜΑ 4.18 Ένας άνδρας με βραχυδακτυλία (πολύ κοντά δάκτυλα, σπάνιο υπερέχον γνώρισμα) παντρεύεται μια φυσιολογική γυναίκα. Οι δύο σύζυγοι έχουν καστανά μάτια, ενώ οι μητέρες τους είχαν γαλανά. Αν αποκτήσουν τέσσερα παιδιά βρείτε την πιθανότητα α) Όλα να έχουν βραχυδακτυλία. β) Ένα να έχει βραχυδακτυλία και τα υπόλοιπα να είναι φυσιολογικά. γ) Όλα να έχουν γαλανά μάτια. δ) Όλα να έχουν καστανά μάτια. ε) Όλα να έχουν βραχυδακτυλία και καστανά μάτια. στ) Όλα να είναι φυσιολογικά με γαλανά μάτια. ζ) Τουλάχιστον ένα παιδί να έχει βραχυδακτυλία και γαλανά μάτια. η) Τα δύο πρώτα παιδιά να έχουν βραχυδακτυλία. θ) Τα δύο πρώτα παιδιά να έχουν βραχυδακτυλία και καστανά μάτια, και ι) Τα δυο πρώτα παιδιά να είναι το ένα με βραχυδακτυλία και γαλανά μάτια και το άλλο φυσιολογικό με καστανά μάτια, ανεξαρτήτως σειράς. Σημειώνεται ότι τα υπεύθυνα γονίδια είναι αυτοσωματικά και ασύνδετα. ΠΡΟΒΛΗΜΑ 4.19 Η κατανομή της χρωστικής στο τρίχωμα των ποντικών ελέγχεται από μια σειρά πολλαπλών αλληλομόρφων γονιδίων ως εξής: C = πλήρης χρωματισμός, c d = μερικός χρωματισμός και c l = υποτελές θανατογόνο. Η σειρά υπεροχής των τριών αλληλομόρφων είναι C > c d > c l. Ένα άτομο με πλήρη χρωματισμό, φορέας του θανατογόνου αλληλόμορφου, διασταυρώθηκε με έναν επίσης φορέα του ίδιου γονιδίου, αλλά με μερικό χρωματισμό. Ένας απόγονος της F 1 διασταυρώθηκε με τον γονέα για τον μερικό χρωματισμό του τριχώματος. Ποια είναι η πιθανότητα να πάρουμε έναν απόγονο με μερικό χρωματισμό του τριχώματος; ΠΡΟΒΛΗΜΑ 4.20 Από επανειλημμένες διασταυρώσεις ανάμεσα σε αμιγή καφέ σκυλιά με αμιγή λευκά, όλα τα κουτάβια της F 1 ήταν λευκά. Οι διασταυρώσεις F 1 x F 1 έδωσαν συνολικά 118 λευκά, 32 μαύρα και 10 καφέ κουτάβια στην F 2. Εξηγείστε αυτά τα αποτελέσματα και ελέγξετε την υπόθεσή σας στατιστικά. ΠΡΟΒΛΗΜΑ 4.21 Στον άνθρωπο το θανατογόνο γονίδιο i προκαλεί "νηπιακή αμαυρωτική ιδιωτεία" και προκαλεί τον θάνατο σε νηπιακή ηλικία. Ένα άλλο, ανεξάρτητα

10 κληρονομούμενο επίσης θανατογόνο γονίδιο, το j, προκαλεί "νεανική αμαυρωτική ιδιωτεία" και προκαλεί τον θάνατο πριν την ενηλικίωση (κάτω των 18 ετών). Από το γάμο ενός ζευγαριού που και οι δύο γονείς είναι φορείς για τα δύο αυτά γονίδια υπολογίστε 1) Ποιο ποσοστό παιδιών αναμένετε να πεθάνουν πριν την ενηλικίωση; 2) Ποια είναι η πιθανότητα να κάνουν δύο παιδιά τα οποία θα επιζήσουν και μετά την ενηλικίωση; 3) Ποια είναι η πιθανότητα να κάνουν δύο παιδιά και το ένα μόνο να επιζήσει και μετά την ενηλικίωση; ΠΡΟΒΛΗΜΑ 4.22 Στο καλαμπόκι και τα τρία υπερέχοντα γονίδια A, C και R είναι απαραίτητοι για το χρώμα των σπόρων και κληρονομούνται ανεξάρτητα. Οι γονότυποι A-C-Rείναι χρωματιστοί, ενώ όλοι οι άλλοι είναι άχρωμοι. Ένα φυτό με χρώμα διασταυρώθηκε διαδοχικά με τρία φυτά και έδωσε τα παρακάτω αποτελέσματα: Με aa cc RR, έδωσε 50% χρωματιστούς σπόρους. Με aa CC rr, έδωσε 25% χρωματιστούς σπόρους. Με AA cc rr, έδωσε 50% χρωματιστούς σπόρους. Ποιος είναι ο γονότυπος του φυτού; ΠΡΟΒΛΗΜΑ 4.23 Στα κυνηγετικά σκυλιά Labrador το υπερέχον γονίδιο Β δημιουργεί μαύρο τρίχωμα ενώ το υποτελές του αλληλόμορφο καφέ. Σε ένα άλλο ανεξάρτητο χρωμόσωμα το γονίδιο Ε συμπεριφέρεται ως υπερέχον επιστατικό στα Β και b με αποτέλεσμα να δημιουργείται "χρυσαφένιο" τρίχωμα, ενώ το e επιτρέπει την έκφραση των Β και b. Ένας εκτροφέας θέλει να διαπιστώσει το γονότυπο των τριών σκυλιών του και τα διασταυρώνει μεταξύ τους για μερικά χρόνια με τα αποτελέσματα που φαίνονται στον παρακάτω πίνακα. α. Ποιοι είναι οι γονότυποι των τριών σκυλιών; β. Πώς προκύπτουν οι αναλογίες αυτές; Διασταύρωση I 1 ο σκυλί (χρυσαφένιο ) x 2 ο σκυλί (χρυσαφένιο ) Απόγονοι 6/8 χρυσαφένια 1/8 μαύρα

11 II 1 ο σκυλί (χρυσαφένιο ) x 3 ο σκυλί (μαύρο ) 1/8 καφετιά 4/8 χρυσαφένια 3/8 μαύρα 1/8 καφετιά ΠΡΟΒΛΗΜΑ 4.24 Στα βοοειδή είναι γνωστό ένα υποτελές αυτοσωματικό γονίδιο l το οποίο λειτουργεί ως υποτελές θανατογόνο λίγο πριν τον τοκετό. Σε ένα εκτροφείο ένας ταύρος είναι ετεροζυγωτικός για το γονίδιο αυτό, αλλά χρησιμοποιείται ως επιβήτορας σε ένα κοπάδι 35 αγελάδων και αποκτά τρεις απογόνους με την καθεμία. Από αυτές οι 14 γέννησαν τουλάχιστον ένα μοσχαράκι νεκρό που σημαίνει ότι ήταν επίσης ετεροζυγωτικές για το συγκεκριμένο γονίδιο. Πόσες ακόμα αγελάδες είναι δυνατόν να είναι επίσης ετεροζυγωτικές αλλά δεν αποκαλύφθηκαν; Τα γονίδια Α, Β και C κληρονομούνται ανεξάρτητα και ελέγχουν το σχηματισμό της μαύρης χρωστικής σε κάποιο είδος. Υποθέστε ότι τα γονίδια αυτά εμπλέκονται σε ένα βιοχημικό μονοπάτι με τον εξής τρόπο: Ένζυμο Ένζυμο Ένζυμο Άσπρη Α Άσπρη Β Άσπρη C Τελική πρόδρομη ενδιάμεση ενδιάμεση μαύρη χρωστική χρωστική 1 χρωστική 2 χρωστική Τα εναλλακτικά αλληλόμορφα γονίδια a, b και c είναι υποτελή και παράγουν μη λειτουργικά προϊόντα. α. Αν και τα τρία γονίδια είναι απαραίτητα για τη δημιουργία μαύρης χρωστικής, ποια θα είναι η αναλογία μαύρων : άσπρων ατόμων από τη διασταύρωση ετεροζυγωτικών και ως προς τα τρία γονίδια ατόμων; β. Έστω ότι το γονίδιο C παράγει ένα πεπτίδιο που λειτουργεί ως καταστολέας του Β και ότι το βιοχημικό μονοπάτι λειτουργεί ως εξής: Άσπρη πρόδρομη Ένζυμο Α Άσπρη ενδιάμεση Ένζυμο Β Τελική μαύρη χρωστική χρωστική χρωστική 1 Πεπτίδιο C Καταστολέας του γονιδίου Β

12 Ποια θα είναι η αναλογία μαύρων : άσπρων ατόμων σε αυτή την περίπτωση από την ίδια διασταύρωση; ΠΡΟΒΛΗΜΑ 4.26 Τα γονίδια a, b, c, d, e και f απομονώθηκαν σε μια έρευνα απομόνωσης μεταλλάξεων σε ένα πειραματόζωο και προκαλούν όλα έναν συγκεκριμένο μεταλλαγμένο φαινότυπο. Έγιναν όλες οι δυνατές διασταυρώσεις μεταξύ αυτών των στελεχών και τα αποτελέσματα παρουσιάζονται στον πίνακα που ακολουθεί. Το + σημαίνει κανονικός φαινότυπος και το - μεταλλαγμένος. a b c d e f a b c d e - + f - Πόσοι γονιδιακοί τόποι είναι υπεύθυνοι για τη δημιουργία αυτού του μεταλλαγμένου φαινοτύπου; ΠΡΟΒΛΗΜΑ 4.27 Τα γονίδια a, b, c, d, e και f απομονώθηκαν σε μια έρευνα απομόνωσης μεταλλάξεων σε ένα πειραματόζωο και προκαλούν όλα έναν συγκεκριμένο μεταλλαγμένο φαινότυπο. Τα αποτελέσματα των μεταξύ τους διασταυρώσεων παρουσιάζονται στον πίνακα που ακολουθεί. Το + σημαίνει κανονικός φαινότυπος, το - μεταλλαγμένος και το Ο την μη ύπαρξη δεδομένων. Με βάση την υπόθεση ότι οι διασταυρώσεις που λείπουν θα έδιναν αποτελέσματα συμβατά με τα ήδη υπάρχοντα, συμπληρώστε τα κενά με τα αντίστοιχα σύμβολα. a b c d e f a Ο + - Ο + Ο b Ο Ο Ο Ο - c Ο - Ο Ο d Ο Ο Ο e Ο + f Ο

13 ΠΡΟΒΛΗΜΑ 4.28 Μία γυναίκα ομοζυγωτική για κάποια υποτελή μετάλλαξη που προκαλεί κώφωση, παντρεύεται έναν άνδρα επίσης κωφό που είναι επίσης ομοζυγωτικός για κάποιο υποτελές γονίδιο που προκαλεί το ίδιο αποτέλεσμα και αποκτούν ένα παιδί με φυσιολογική ακοή. α. Υπάρχει κάποια υπόθεση που μπορεί να εξηγήσει γενετικά αυτό το φαινόμενο; β. Αν υποθέσουμε ότι η γυναίκα αυτή εγκυμονεί ένα ακόμα παιδί, με βάση την υπόθεσή σας, τι θα προβλέπατε για την ακοή του; ΠΡΟΒΛΗΜΑ 4.29 Σε μία μελέτη γυναικών όπου ήταν γνωστό ότι ήταν φορείς του φυλοσύνδετου, υποτελούς γονιδίου της αιμοφιλίας, μετρήθηκε ο χρόνος πήξης του αίματος. Οι τιμές που μετρήθηκαν έδειξαν μεγάλη ποικιλότητα και κυμαινόντουσαν από σχεδόν φυσιολογικά όρια έως ακραία που άγγιζαν τα παθολογικά. Ποια είναι η πιθανότερη εξήγηση για τα ευρήματα αυτά;

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο.

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. Μια γυναίκα της οποίας ο πατέρας έπασχε από γαλακτοζαιμία θέλει να

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3

ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3 ΠΡΟΒΛΗΜΑ 5.1 Στα ποντίκια το σκούρο μάτι απαιτεί την ταυτόχρονη παρουσία των υπερεχόντων αλληλομόρφων γονιδίων R και Q. Ζώα ομοζυγωτικά για ένα από τα δύο ή και τα δύο υποτελή αλληλόμορφα έχουν ανοιχτόχρωμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC

ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις Αλληλεπιδράσεις γονιδίων Ι ασκήσεις 1. Στους σκύλους Labrador ένα θηλυκό άτομο με καστανό χρωματισμό διασταυρώθηκε με αρσενικό που είχε χρυσαφί χρωματισμό. Όλοι οι F1 απόγονοι είχαν μαύρο χρωματισμό. Η

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2

ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ)

ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ) ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ) 1. Στις αλεπούδες το ασηµόµαυρο χρώµα του τριχώµατος καθορίζεται από ένα υπολειπόµενο αλληλόµορφο

Διαβάστε περισσότερα

ΦΥΕ 43: ΓΕΝΕΤΙΚΗ ΟΔΗΓΟΣ ΕΠΙΛΥΣΗΣ ΑΣΚΗΣΕΩΝ ΚΩΣΤΑΣ ΜΠΟΥΡΤΖΗΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ

ΦΥΕ 43: ΓΕΝΕΤΙΚΗ ΟΔΗΓΟΣ ΕΠΙΛΥΣΗΣ ΑΣΚΗΣΕΩΝ ΚΩΣΤΑΣ ΜΠΟΥΡΤΖΗΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΦΥΕ 43: ΓΕΝΕΤΙΚΗ ΟΔΗΓΟΣ ΕΠΙΛΥΣΗΣ ΑΣΚΗΣΕΩΝ ΚΩΣΤΑΣ ΜΠΟΥΡΤΖΗΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ 1 Χρήσιμες οδηγίες για την επίλυση ασκήσεων Γενετικής

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Δασική Γενετική Τα πειράματα του Mendel

Δασική Γενετική Τα πειράματα του Mendel Δασική Γενετική Τα πειράματα του Mendel Χειμερινό εξάμηνο 2014-2015 Παράδοξο... Οι απόγονοι μοιάζουν στους γονείς τους Δεν είναι όμως ακριβώς ίδιοι, ούτε με τους γονείς τους, ούτε μεταξύ τους Κληρονομικότητα

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ

ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 5.1. Σε ποια στοιχεία οφείλεται η επιτυχία των πειραμάτων του Mendel; 5.2. Τι είναι ο γονότυπος ; Πως μπορούμε να βρούμε το γονότυπο

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: 20 / 02 / 2016 ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΕΞΕΤΑΖΟΜΕΝΟΥ:. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 2 ΕΠΙΚΡΑΤΗ 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους.

Διαβάστε περισσότερα

ΠΙΘΑΝΟΤΗΤΕΣ - ΑΣΚΗΣΕΙΣ

ΠΙΘΑΝΟΤΗΤΕΣ - ΑΣΚΗΣΕΙΣ ΠΙΘΑΝΟΤΗΤΕΣ - ΑΣΚΗΣΕΙΣ. Η πιθανότητα να είναι ένα νεογέννητο αγόρι είναι ½. Αν ένα αντρόγυνο κάνει δύο παιδιά, ποια η πιθανότητα να κάνει α πρώτα ένα αγόρι και μετά ένα κορίτσι, β ένα αγόρι και ένα κορίτσι

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

Γενετική. Ενότητα 4η: Προεκτάσεις των νόμων του Mendel. Πηνελόπη Μαυραγάνη-Τσιπίδου Τμήμα Βιολογίας ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ

Γενετική. Ενότητα 4η: Προεκτάσεις των νόμων του Mendel. Πηνελόπη Μαυραγάνη-Τσιπίδου Τμήμα Βιολογίας ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΚΤΑ ΑΚΑΔΗΜΑΪΚΑ ΜΑΘΗΜΑΤΑ Ενότητα 4η: Προεκτάσεις των νόμων του Mendel Πηνελόπη Μαυραγάνη-Τσιπίδου Άδειες Χρήσης Το παρόν εκπαιδευτικό υλικό υπόκειται σε άδειες

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών

-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ

3 ΩΡΕΣ. Σελίδα 1 από 3 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΜΑΘΗΜΑ ΙΑΡΚΕΙΑ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΡΚΕΙΑ 3 ΩΡΕΣ ΘΕΜΑ 1 Ο Στις ερωτήσεις 1-5, να γράψετε τον αριθµό της ερώτησης και δίπλα το γράµµα που αντιστοιχεί στη σωστή απάντηση. 1. Από τη διασταύρωση

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο ΑΠΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΕΝΙΑΙΥ ΛΥΚΕΙΥ ΤΡΙΤΗ 1 ΙΥΝΙΥ 2004 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΒΙΛΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ 1 (δ) µονόκλωνο RNA 2. (β) αντίγραφα των mrna όλων των γονιδίων

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ 1 Στη δροσόφιλα το κόκκινο χρώμα των ματιών είναι επικρατές. Εάν οι απόγονοι σε δύο διαφορετικές διασταυρώσεις είναι οι ακόλουθοι: ιασταύρωση Α ιασταύρωση Β 24 αρσενικά

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Εισηγήτρια: Μαλικλάρι Ελένη

Εισηγήτρια: Μαλικλάρι Ελένη ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ ΤΜΗΜΑ: Γ3 29/12/14 Εργασία Β Τριμήνου στη Βιολογία Θέμα: Οι γενετικές αναλύσεις και η διατύπωση των νόμων του Μέντελ Εισηγήτρια: Μαλικλάρι Ελένη Υπεύθυνος Καθηγητής: κ. Κεραμάρης Κων/νος

Διαβάστε περισσότερα

Μίτωση.

Μίτωση. ΓΕΝΕΤΙΚΗ Μίτωση http://vodpod.com/watch/631992-untitled http://www.youtube.com/watch?v=vln7k1-9qb0&feature=related Μείωση http://www.youtube.com/watch?v=qwmpd0ob3aq&feature=related Μεντελική Κληρονομικότητα

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 2001 ΗΜΕΡΗΣΙΟ 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια

Διαβάστε περισσότερα

Βελτίωση Φυτών. Βελτίωση Σταυρογονιμοποιούμενων φυτών. Είδη ποικιλιών

Βελτίωση Φυτών. Βελτίωση Σταυρογονιμοποιούμενων φυτών. Είδη ποικιλιών Βελτίωση Σταυρογονιμοποιούμενων φυτών Είδη ποικιλιών Πληθυσμοί ελεύθερης επικονίασης (OP) Είναι ετερογενείς και ετεροζύγωτοι πληθυσμοί που παράγονται με ανοιχτή, χωρίς έλεγχο επικονίαση. Η επιλογή τέτοιου

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 7η ΙΑΛΕΞΗ ΜΕΘΟ ΟΙ ΕΠΙΛΟΓΗΣ ΣΤΑΥΡΟΓΟΝΙΜΟΠΟΙΟΥΜΕΝΩΝ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 7η ΙΑΛΕΞΗ ΜΕΘΟ ΟΙ ΕΠΙΛΟΓΗΣ ΣΤΑΥΡΟΓΟΝΙΜΟΠΟΙΟΥΜΕΝΩΝ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 7η ΙΑΛΕΞΗ ΜΕΘΟ ΟΙ ΕΠΙΛΟΓΗΣ ΣΤΑΥΡΟΓΟΝΙΜΟΠΟΙΟΥΜΕΝΩΝ ΦΥΤΩΝ Μαζική Επιλογή Η παλαιότερη µέθοδος Γενετικής Βελτίωσης Κυρίως χρησιµοποιείται για την βελτίωση πληθυσµών σταυρογονιµοποιούµενων

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ

Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ,, 4, 5 και 6 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: 0 / 0 / 06 ΘΕΜΑ Ο -γ -4 3-δ 4-δ 5-β ΘΕΜΑ Ο Α. Παρατηρούμενη Φ.Α

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 12 ΙΟΥΝΙΟΥ 2013 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Eπεκτάσεις της Μενδελιανής Γενετικής. Π. Πάσχου, PhD

Eπεκτάσεις της Μενδελιανής Γενετικής. Π. Πάσχου, PhD Eπεκτάσεις της Μενδελιανής Γενετικής Π. Πάσχου, PhD Επανάληψη: Φαινόµενο κυριαρχίας -Μονουβριδισµός: Σύµφωνα µε τονmendel τα υβρίδια της F1 γενιάς εµφανίζουν τον επικρατή φαινότυπο -Η παρουσίαένοςµόνο

Διαβάστε περισσότερα

Κεφάλαιο 5. Copyright The McGraw-Hill Companies, Inc Utopia Publishing, All rights reserved

Κεφάλαιο 5. Copyright The McGraw-Hill Companies, Inc Utopia Publishing, All rights reserved Κεφάλαιο 5 Copyright The McGraw-Hill Companies, Inc. 2011 Utopia Publishing, All rights reserved Μια ανασκόπηση ΓΕΝΕΤΙΚΗ Cardinalis cardinalis Cardinalis sinuatus 2011 Utopia Publishing, All rights reserved

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

Άσκηση 12: Γενετική Ι: Μεντελισμός Χρωμοσωματική θεωρεία της κληρονομικότητας

Άσκηση 12: Γενετική Ι: Μεντελισμός Χρωμοσωματική θεωρεία της κληρονομικότητας Άσκηση 12: Γενετική Ι: Μεντελισμός Χρωμοσωματική θεωρεία της κληρονομικότητας Σύνοψη Σκοπός της άσκησης είναι η κατανόηση των φαινομένων της κληρονομικότητας και των νόμων που τα διέπουν. Ο φοιτητής θα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΘΕΜΑ Α Ο Ερωτήσεις πολλαπλής επιλογής: Α1 Στην αντιγραφή του DN το σπάσιμο των υδρογονικών δεσμών μεταξύ των δύο συμπληρωματικών αλυσίδων γίνεται με τη βοήθεια

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.)

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) Μενδελική κληρονομικότητα κεφάλαιο 5 Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) 5. Μενδελική κληρονομικότητα Το ενδιαφέρον για την κληρονομικότητα είναι πολύ παλιό, σχεδόν όσο και η ύπαρξη του ανθρώπινου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013 ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΟΛΙΚΗ ΡΟΝΙΑ: 2012-2013 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ-ΦΥΣΙΟΓΝΩΣΤΙΚΑ ΗΜΕΡΟΜΗΝΙΑ: 21/05/2013 ΤΑΞΗ: Α ΣΥΝΟΛΙΚΗ ΔΙΑΡΚΕΙΑ ΓΡΑΠΤΟΥ ΒΙΟΛΟΓΙΑΣ-ΗΜΕΙΑΣ: 2 ΩΡΕΣ

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Σενάριο 12: Μεντελική Κληρονομικότητα Γενετική ποικιλότητα

Σενάριο 12: Μεντελική Κληρονομικότητα Γενετική ποικιλότητα Σενάριο 12: Μεντελική Κληρονομικότητα Γενετική ποικιλότητα Φύλλο Εργασίας Τίτλος: Μεντελική Κληρονομικότητα Γνωστικό Αντικείμενο: Βιολογία Διδακτική Ενότητα: Κληρονομικότητα Γενετική ποικιλότητα Τάξη:

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner

Α1. Με τη μελέτη καρυότυπου είναι δυνατό να διαγνωστεί: Α. Η φαινυλκετονουρία Β. Ο αλφισμός Γ. Η δρεπανοκυτταρική αναιμία Δ. Το σύνδρομο Turner ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 15/04/2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

Άσκηση 13: Γενετική ΙΙ: Φυλοσύνδετη κληρονομικότητα

Άσκηση 13: Γενετική ΙΙ: Φυλοσύνδετη κληρονομικότητα Άσκηση 13: Γενετική ΙΙ: Φυλοσύνδετη κληρονομικότητα Σύνοψη Στην άσκηση αυτή περιγράφεται η φυλοσύνδετη κληρονομικότητα. Αρχικώς γίνεται αναφορά στον τρόπο καθορισμού του φύλου στα διάφορα είδη και στη

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα