Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα σπέρματος και λευκό χρώμα άνθους. 113 άτομα με πράσινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 112 άτομα με πράσινο χρώμα σπέρματος και λευκό χρώμα άνθους. Ποιος είναι ο γονότυπος των γονέων τους; Κίτρινα : πράσινα 1 : 1, έστω Κ= και κ=πράσινο, όπου Κ>κ Ιώδες : λευκό 1 : 1, έστω Ι=ιώδες και ι=λευκό, όπου Ι>ι Οπότε: 2 περιπτώσεις: 1 η P: ΚκΙι Χ κκιι 2 η P: Κκιι Χ κκιι 2. Στα καρπούζια η πικρή γεύση οφείλεται σε επικρατές γονίδιο και η γλυκιά γεύση σε υπολειπόμενο, ενώ οι κίτρινες κηλίδες στην επιφάνεια του φρούτου επικρατούν έναντι της απουσίας κηλίδων. Από την διασταύρωση αμιγών ατόμων με πικρή γεύση και κίτρινες κηλίδες με αμιγή άτομα με γλυκιά γεύση και απουσία κηλίδων να βρεθεί: α. Η γονοτυπική και φαινοτυπική αναλογία της F 2 γενιάς. β. Αν προκύψουν 308 άτομα πόσα από αυτά θα έχουν γλυκιά γεύση και πόσα θα έχουν κίτρινες κηλίδες; γ. Πώς είναι δυνατή η απομόνωση αμιγών ατόμων με πικρή γεύση και απουσία κηλίδων; Π=πικρή, π=γλυκιά, όπου Π>π και Κ=κηλίδες, κ=απουσία κηλίδων, όπου Κ>κ α. Φ.Α: 9 πικρή και κίτρινες κηλίδες : 3 πικρή και απουσία κηλίδων : 3 γλυκιά και κίτρινες κηλίδες : 1 γλυκιά και απουσία κηλίδων Γ.Α: 4 ΠπΚκ, 2ΠπΚΚ, 2Ππκκ, 2ΠΠΚκ, 2ππΚκ, 1ΠΠΚΚ, 1ππκκ, 1ΠΠκκ, 1ππΚΚ β /16=77 με γλυκιά γεύση /16=231 με κίτρινες κηλίδες γ. Τα άτομα αυτά έχουν γονότυπους ΠΠκκ ή Ππκκ. Γίνεται διασταύρωση ελέγχου με άτομο ππκκ 1 η περίπτωση: ΠΠκκ Χ ππκκ γαμέτες Πκ πκ F 1 Ππκκ όλα τα άτομα με πικρή γεύση και απουσία κηλίδων 2 η περίπτωση: Ππκκ Χ ππκκ γαμέτες Πκ, πκ πκ F 1 Ππκκ ππκκ 50% άτομα με 50% άτομα με γλυκιά γεύση πικρή γεύση και απουσία κηλίδων και απουσία κηλίδων 3. Ποιοι είναι οι πιθανοί απόγονοι και με ποια πιθανότητα θα προκύψουν από τη διασταύρωση μιας κανονικής Drosophila με μια άλλη που έχει «υποπλασμένα φτερά» και «άτριχο σώμα». Οι χαρακτήρες «υποπλασμένα φτερά» και «άτριχο σώμα» είναι υπολειπόμενοι και βρίσκονται σε διαφορετικά χρωμοσώματα. Έστω Α=σώμα με τρίχες, α=άτριχο σώμα, όπου Α>α και Κ=κανονικά φτερά, κ=υποπλασμένα φτερά, όπου Κ>κ Οι πιθανοί γονότυποι για την κανονική Drosophila είναι: ΑΑΚΚ, ΑαΚΚ, ΑΑΚκ, ΑαΚκ (κάθε γονότυπος έχει πιθανότητα 1/4) Οι πιθανοί γονότυποι για την άλλη Drosophila είναι: αακκ Άρα υπάρχουν 4 περιπτώσεις. Κωστανίκος Δημήτρης 1 Βιολόγος

2 1 η περίπτωση: ΑΑΚΚ Χ αακκ F 1 ΑαΚκ 100% άτομα με τρίχες και κανονικά φτερά P 1 =1/4 1=1/4 2 η περίπτωση: ΑαΚΚ Χ αακκ F 1 ΑαΚκ, αακκ 50% άτομα με τρίχες και κανονικά φτερά (P 2 =1/4 1/2=1/8) 50% άτομα άτριχα και κανονικά φτερά (P 2 =1/4 1/2=1/8) 3 η περίπτωση: ΑΑΚκ Χ αακκ F 1 ΑαΚκ, Αακκ 50% άτομα με τρίχες και κανονικά φτερά (P 3 =1/4 1/2=1/8) 50% άτομα με τρίχες και υποπλασμένα φτερά (P 3 =1/4 1/2=1/8) 4 η περίπτωση: ΑαΚκ Χ αακκ F 1 ΑαΚκ, Αακκ, αακκ, αακκ 25% άτομα με τρίχες και κανονικά φτερά (P 4 =1/4 1/4=1/16) 25% άτομα με τρίχες και υποπλασμένα φτερά (P 4 =1/4 1/4=1/16) 25% άτομα άτριχα και κανονικά φτερά (P 4 =1/4 1/4=1/16) 25% άτομα άτριχα και υποπλασμένα φτερά (P 4 =1/4 1/4=1/16) Άρα συνολικά, - Άτομα με τρίχες και κανονικά φτερά: Pολ=P 1 +P 2 +P 3 +P 4 =9/16 - Άτομα άτριχα και κανονικά φτερά: Pολ=0+ P P 4 =3/16 - Άτομα με τρίχες και υποπλασμένα φτερά: Pολ=0+0+ P 3 + P 4 =3/16 - Άτομα άτριχα και υποπλασμένα φτερά: Pολ= P 4 =1/16 4. Από την διασταύρωση χοίρων με οπλές που μοιάζουν σαν του μουλαριού και άσπρο χρώμα γεννιούνται απόγονοι από τους οποίους οι 8 έχουν μαύρο χρώμα και φυσιολογική σχισμή. Αν τα γονίδια βρίσκονται σε διαφορετικά χρωμοσώματα, να βρείτε τον πιθανό αριθμό των υπόλοιπων ατόμων που θα έχουν νέους φαινοτύπους. Αφού προκύπτουν νέες ιδιότητες αυτό σημαίνει ότι τα γονίδια που ελέγχουν αυτές τις ιδιότητες είναι υπολειπόμενα. Έστω Α=άσπρο, α=μαύρο, όπου Α>α και Φ=σχισμή μουλαριού, φ=φυσιολογικό άτομο, όπου Φ>φ. Οι αρχικοί γονείς θα είναι ετερόζυγοι, δηλαδή ΑαΦφ και ΑαΦφ Από τη διασταύρωση αυτή προκύπτουν 9 άτομα άσπρα με σχισμή μουλαριού 3 άτομα άσπρα με φυσιολογική σχισμή: 8 Χ 3=24 άτομα 3 άτομα μαύρα με σχισμή μουλαριού: 8 Χ 3=24 άτομα 1 άτομο μαύρο με φυσιολογική σχισμή: 8 άτομα 5. Σε ένα είδος κολοκυθιού το λευκό χρώμα του καρπού οφείλεται σε επικρατές γονίδιο και το χρώμα σε υπολειπόμενο γονίδιο. Το δισκοειδές σχήμα του καρπού οφείλεται σε επικρατές γονίδιο και το σφαιρικό σχήμα σε υπολειπόμενο. Από τη διασταύρωση ατόμου με λευκό και σφαιρικό καρπό με άτομο με και δισκοειδές καρπό προκύπτουν στην επόμενη γενιά τα εξής άτομα: 180 άτομα με λευκό χρώμα καρπού και δισκοειδές σχήμα καρπού. 185 άτομα με λευκό χρώμα καρπού και σφαιρικό σχήμα καρπού. 178 άτομα με χρώμα καρπού και δισκοειδές σχήμα καρπού. 183 άτομα με χρώμα καρπού και σφαιρικό σχήμα καρπού. Ποιος είναι ο γονότυπος των γονέων τους; Λ=λευκό, λ=, όπου Λ>λ και Δ=δισκοειδές, δ=σφαιρικό, όπου Δ>δ Λευκό : 1 : 1, άρα τα άτομα έχουν γονότυπο Λλ και λλ Δισκοειδές : σφαιρικό 1 : 1, άρα τα άτομα έχουν γονότυπο Δδ και δδ Οπότε οι πιθανές διασταυρώσεις είναι: 1 η περίπτωση: ΛλΔδ Χ λλδδ απορρίπτεται 2 η περίπτωση: Λλδδ Χ λλδδ 6. Το Rh - (ρέζους αρνητικό-παράγοντας αίματος) οφείλεται σε υπολειπόμενο αυτοσωμικό γονίδιο ενώ το Rh + σε επικρατές. Κάποιος ισχυρίζεται ότι κάποιο από τα 6 παιδιά του δεν είναι δικό του. Η ανάλυση αίματος έδειξε τα εξής: Πατέρας: Ο+ Μητέρα:Α+ 1 ο παιδί: Α+ Κωστανίκος Δημήτρης 2 Βιολόγος

3 2 ο παιδί:ο- 3 ο παιδί:α- 4 ο παιδί:ο+ 5 ο παιδί:αβ+ 6 ο παιδί:β- Έχει δίκιο; Τα 4 πρώτα μπορεί να είναι δικά του, τα 2 τελευταία (5 ο και 6 ο ) όχι. 7. Άνδρας ομάδας αίματος Α και Rh - (ρέζους αρνητικό-παράγοντας αίματος), του οποίου ο πατέρας είναι ομάδα αίματος ΑΒ και Rh + (ρέζους θετικό) και η μητέρα είναι Β και Rh + (ρέζους θετικό), παντρεύεται γυναίκα ομάδα αίματος Ο και Rh +, της οποία ο αδελφός είναι ΑΒ Rh -, ο πατέρας Α Rh + και η μητέρα Β Rh +. Το 1 ο τους παιδί είναι Α και Rh -. α. Να γράψετε τους γονότυπους όλων των ατόμων. β. Ποια η πιθανότητα να αποκτήσουν παιδί ομάδας αίματος Ο και Rh - ; γ. Ποια η πιθανότητα να αποκτήσουν αγόρι ομάδα αίματος Α Rh + ; δ. Ποια η πιθανότητα τα 2 επόμενα παιδιά να είναι το ένα Ο και Rh + και το άλλο Α και Rh - ; α. Άνδρας:I Α irr, πατέρας άνδρα:i Α I Β Rr, μητέρα άνδρα:i B irr Γυναίκα:iiRr, αδελφός γυναίκας:i Α I Β rr, πατέρας γυναίκας:i Α irr, μητέρα γυναίκας:i B irr, 1 ο παιδί: I Α irr β. P= 1/4 γ. P= 1/4 1/2=1/8 δ. Διακρίνουμε δύο περιπτώσεις. 1 η περίπτωση: το 1 ο Ο και Rh + και το 2 ο Α και Rh - P 1 = 1/4 1/4= 1/16 2 η περίπτωση: το 1 ο Α και Rh - και το 2 ο Ο και Rh + P 2 = 1/4 1/4= 1/16 Άρα Pολ=P 1 +P 2 =2/16=1/8 8. Από τη διασταύρωση ινδικών χοιριδίων με κοντό και άσπρο τρίχωμα με ινδικά χοιρίδια με μακρύ και τρίχωμα γεννήθηκαν τα εξής άτομα στην F 2 γενιά: 150 άτομα με κοντό και κρεμ χρώμα. 74 άτομα με κοντό και άσπρο χρώμα. 76 άτομα με κοντό και χρώμα. 51 άτομα με μακρύ και κρεμ χρώμα. 23 άτομα με μακρύ και με άσπρο χρώμα. 26 άτομα με μακρύ και με χρώμα. α. Να εξηγήσετε τα αποτελέσματα και να δείξετε τους γονότυπους των ατόμων της P και F 1 γενιάς. β. Εάν θηλυκό άτομο με μακρύ τρίχωμα και κρεμ χρώμα διασταυρωθεί με τα άτομα της P γενιάς ποια η πιθανότητα να γεννηθούν ινδικά χοιρίδιο με κρεμ χρώμα; Κοντό : μακρύ= 300 : 100 = 3 : 1 Άρα το γονίδιο είναι αυτοσωμικό, με το κοντό να επικρατεί του μακρύ. α. Έστω Κ=κοντό, κ=μακρύ, όπου Κ>κ Επειδή στο χρώμα του τριχώματος προέκυψε και ένας νέος φαινότυπος, ενώ η αναλογία χρώμα : άσπρο χρώμα= 102 : 97 1 : 1 (ακραίοι φαινότυποι) βγαίνει το συμπέρασμα ότι το χρώμα του τριχώματος οφείλεται σε ενδιάμεση κληρονομικότητα. Έστω Μ= χρώμα, Α=άσπρο χρώμα, όπου Μ=Α P: ΚΚΑΑ Χ κκμμ F 1 : ΚκΑΜ Χ ΚκΑΜ β. Διακρίνουμε 2 περιπτώσεις. 1 η περίπτωση: ΚΚΑΑ Χ κκαμ P 1 = 1/2 1/2= 1/4 2 η περίπτωση: κκμμ Χ κκαμ P 2 = 1/2 1/2= 1/4 Άρα Pολ=P 1 +P 2 =1/4+1/4=2/4=1/2 Κωστανίκος Δημήτρης 3 Βιολόγος

4 9. Στα βοοειδή της ράτσας Shorthorn από τη διασταύρωση ταύρου με κόκκινο χρώμα και κέρατα με αγελάδα με λευκό χρώμα χωρίς κέρατα όλοι οι απόγονοι έχουν κόκκινο-λευκό χρώμα και δε φέρουν κέρατα. Να βρεθούν οι γονότυποι των ατόμων της πατρικής (P) γενιάς καθώς και η φαινοτυπική και γονοτυπική αναλογία της F 2 γενιάς. Για το χρώμα εμφανίζονται 3 φαινότυποι, άρα ο τύπος της κληρονομικότητας είναι ενδιάμεσος (συνεπικρατής). Έστω Κ=κόκκινο, Λ=λευκό, όπου Κ=Λ. Επειδή όλα τα άτομα της F 1 γενιάς δεν έχουν κέρατα συμπεραίνουμε ότι η απουσία κεράτων επικρατεί της παρουσίας κεράτων. Έστω Α=απουσία κεράτων, α=παρουσία κεράτων, όπου Α>α. P: αακκ Χ ΑΑΛΛ γαμέτες: ακ ΑΛ F 1 : ΑαΚΛ Χ ΑαΚΛ Φ.Α: 6 λευκό-κόκκινο και απουσία κεράτων 3 λευκά και απουσία κεράτων 3 κόκκινα και απουσία κεράτων 2 λευκό-κόκκινο και παρουσία κεράτων 1 λευκό και παρουσία κεράτων 1 κόκκινο και παρουσία κεράτων Γ.Α: 4ΑαΚΛ, 2ΑαΚΚ, 2ΑαΛΛ, 2ΑΑΚΛ, 2ααΚΛ, 1ΑΑΚΚ, 1ΑΑΛΛ, 1ααΚΚ, 1ααΛΛ 10. Μια γυναίκα φυσιολογική της οποίας ο πατέρας έχει δρεπανοκυτταρική αναιμία και είναι δαλτωνικός παντρεύεται με άνδρα φυσιολογικό. Ποια η πιθανότητα το παιδί που θα γεννηθεί να είναι δαλτωνικό και φορέας της δρεπανοκυτταρικής αναιμίας; Β=φυσιολογική β-αλυσίδα, β s =δρεπανοκυτταρική αναιμία, όπου Β> β s Χ Δ =φυσιολογικός, Χ δ =δαλτωνικός, όπου Χ Δ >Χ δ Οι γονότυποι είναι: Γυναίκα:Ββ s Χ Δ Χ δ, πατέρας γυναίκας:β s β s Χ δ Υ, άνδρας:ββ s Χ Δ Υ ή ΒΒΧ Δ Υ Διακρίνουμε 2 περιπτώσεις. 1 η περίπτωση: Ββ s Χ Δ Χ δ Χ Ββ s Χ Δ Υ P 1 = 1/8 1/2= 1/16 2 η περίπτωση: Ββ s Χ Δ Χ δ Χ ΒΒΧ Δ Υ P 2 = 2/16 1/2=1/16 Άρα Pολ=P 1 +P 2 =2/16=1/8 11. Από την διασταύρωση θηλυκού ατόμου Drosophila με κόκκινα μάτια και κανονικές τρίχες σώματος με αρσενικό άτομο με καφέ μάτια και διχαλωτές τρίχες σώματος στην F 2 γενιά προέκυψαν τα ακόλουθα άτομα: 40 αρσενικά με κόκκινα μάτια και κανονικές τρίχες. 83 θηλυκά με κόκκινα μάτια και κανονικές τρίχες. 42 αρσενικά με κόκκινα μάτια και διχαλωτές τρίχες. 15 αρσενικά με καφέ μάτια και κανονικές τρίχες. 29 θηλυκά με καφέ μάτια και κανονικές τρίχες. 13 αρσενικά με καφέ μάτια και διχαλωτές τρίχες. Να βρεθούν οι γονότυποι των ατόμων και η φαινοτυπική και γονοτυπική αναλογία της F 2 γενιάς. Για το χρώμα των ματιών: Στα αρσενικά, 82 κόκκινα : 28 καφέ 3 : 1 Στα θηλυκά, 83 κόκκινα : 29 καφέ 3 : 1, Άρα κόκκινα>καφέ, έστω Κ=κόκκινο, κ=καφέ, όπου Κ>κ Τα άτομα που διασταυρώνονται είναι ετερόζυγα, δηλαδή Κκ Χ Κκ Για τις τρίχες του σώματος: Στα αρσενικά, 55 κανονικές : 55 διχαλωτές= 1 : 1 Στα θηλυκά: όλες κανονικές, Άρα το γονίδιο είναι φυλοσύνδετο, έστω Χ Δ =κανονικές, Χ δ =διχαλωτές, όπου Χ Δ >Χ δ Τα άτομα που διασταυρώνονται είναι Χ Δ Χ δ Χ Χ Δ Υ, οπότε Κωστανίκος Δημήτρης 4 Βιολόγος

5 P: ΚΚΧ Δ Χ Δ Χ κκχ δ Υ γαμέτες: ΚΧ Δ κχ δ, κυ F 1 : ΚκΧ Δ Χ δ, ΚκΧ Δ Υ γαμέτες: ΚΧ Δ, ΚΧ δ, κχ Δ, κχ δ ΚΧ Δ, ΚΥ, κχ Δ, κυ F 2 : ΚΧ Δ ΚΥ κχ Δ κυ ΚΧ Δ ΚΚΧ Δ Χ Δ ΚΚΧ Δ Υ ΚκΧ Δ Χ Δ ΚκΧ Δ Υ ΚΧ δ ΚΚΧ Δ Χ δ ΚΚΧ δ Υ ΚκΧ Δ Χ δ ΚκΧ δ Υ κχ Δ ΚκΧ Δ Χ Δ ΚκΧ Δ Υ κκχ Δ Χ Δ κκχ Δ Υ κχ δ ΚκΧ Δ Χ δ ΚκΧ δ Υ κκχ Δ Χ δ κκχ δ Υ Γ.Α: 2 ΚκΧ Δ Χ δ : 2 ΚκΧ Δ Χ Δ : 1 ΚΚΧ Δ Χ Δ : 1 ΚΚΧ Δ Χ δ : 1 κκχ Δ Χ Δ : 1 κκχ Δ Χ δ : 2 ΚκΧ Δ Υ : 2 ΚκΧ δ Υ : 1 ΚΚΧ Δ Υ : 1 ΚΚΧ δ Υ : 1 κκχ Δ Υ : 1 κκχ δ Υ Φ.Α: 6 κόκκινα και κανονικά 2 καφέ και κανονικά 3 κόκκινα και κανονικά 3 κόκκινα και διχαλωτά 1 καφέ και 1 καφέ και διχαλωτό 12. Ραπανάκια επιμήκη με κόκκινο χρώμα διασταυρώνονται με ραπανάκια σφαιρικά με λευκό χρώμα και στην F 2 γενιά προκύπτουν τα παρακάτω άτομα: 28 άτομα ωοειδή και μωβ 13 άτομα ωοειδή και κόκκινα 14 άτομα ωοειδή και λευκά 13 άτομα επίμηκες και μωβ 15 άτομα σφαιρικά και μωβ 7 άτομα επίμηκες και κόκκινα 9 άτομα επίμηκες και λευκά 8 άτομα σφαιρικά και κόκκινα 6 άτομα σφαιρικά και λευκά Ποιος ο τρόπος κληρονόμησης των γονιδίων και ποιοι οι γονότυποι των ατόμων της πατρικής (P) και F 1 γενιάς; Από τα δεδομένα της άσκησης προκύπτει ότι: Κόκκινα : μωβ : λευκά 1 : 2 : 1 και Επιμήκες : ωοειδές : σφαιρικά 1 : 2 : 1. Άρα και οι δύο ιδιότητες εξηγούνται με βάση την ενδιάμεση κληρονομικότητα. Έστω Κ=κόκκινο, Λ=λευκό, όπου Κ=Λ και Ε=επιμήκες, Σ=σφαιρικό, όπου Ε=Σ P: ΕΕΚΚ Χ ΣΣΛΛ γαμέτες: ΕΚ ΣΛ F 1 : ΕΣΚΛ Χ ΕΣΚΛ 13. Ένα υπολειπόμενο γονίδιο στον άνθρωπο όταν βρεθεί σε ομόζυγη κατάσταση προκαλεί συγκόλληση των πνευμόνων με αποτέλεσμα το θάνατο των παιδιών μόλις γεννιούνται. Ένας άνδρας με φαινυλκετονουρία και ετερόζυγος ως προς το γονίδιο αυτό των πνευμόνων παντρεύεται γυναίκα ετερόζυγη ως προς το γονίδιο αυτό των πνευμόνων. α. Ποιοι είναι οι γονότυποι των γονέων; β. Ποια η πιθανότητα το 1 ο παιδί να πεθάνει; γ. Ποια η πιθανότητα από τα 3 πρώτα παιδιά που θα γεννηθούν τα 2 να έχουν φαινυλκετονουρία και να είναι ετερόζυγα ως προς το θνησιγόνο γονίδιο και το άλλο να μην εμφανίζει φαινυλκετονουρία και να μην είναι ετερόζυγο ως προς το θνησιγόνο γονίδιο; Έστω Σ=φυσιολογικό, Σ =συγκόλληση πνευμόνων Φ=φυσιολογικό, φ=φαινυλκετονουρία, όπου Φ>φ α. ΣΣ φφ Χ ΣΣ ΦΦ (1/2) ή ΣΣ Φφ (1/2) Κωστανίκος Δημήτρης 5 Βιολόγος

6 1 η περίπτωση: ΣΣ φφ Χ ΣΣ ΦΦ P 1 = 1/2 1/4= 1/8 () P 2 = 0 (φαινυλκετονουρία και ετερόζυγος) P 3 = 1/2 1/3= 1/6 (φυσιολογικός και όχι ετερόζυγος) 2 η περίπτωση: ΣΣ φφ Χ ΣΣ Φφ P 1 = 1/2 1/4= 1/8 () P 2 = 1/2 1/3= 1/6 (φαινυλκετονουρία και ετερόζυγος) P 3 = 1/2 1/6= 1/12 (φυσιολογικός και όχι ετερόζυγος) β. Pολ=P 1 + P 1 =1/8 + 1/8=1/4 γ. Παιδί με φαινυλκετονουρία και ετερόζυγο: P 2 + P 2 =0 + 1/6=1/6 Παιδί φυσιολογικό και δεν είναι ετερόζυγο: P 3 + P 3 =1/6 + 1/12=3/12=1/4 Για τα 3 παιδιά ισχύουν οι παρακάτω συνδυασμοί: 1 ο :Φαινυλκετονουρία, 2 ο :Φαινυλκετονουρία, 3 ο :Φυσιολογικό= 1/6 1/6 1/4=1/144= Pα 1 ο :Φαινυλκετονουρία, 2 ο :Φυσιολογικό, 3 ο :Φαινυλκετονουρία= 1/6 1/4 1/6=1/144= Pβ 1 ο :Φυσιολογικό, 2 ο :Φαινυλκετονουρία, 3 ο :Φαινυλκετονουρία= 1/4 1/6 1/6=1/144= Pγ Άρα Pα+Pβ+Pγ=1/144+1/144+1/144=3/144=1/48 Παρατήρηση Τα ποσοστά P 2, P 3, P 2 και P 3 υπολογίζονται επί των ατόμων που ζουν αφού το ερώτημα αναφέρεται σε παιδιά που επιβιώνουν. 14. Από τη διασταύρωση θηλυκών ποντικών με χρώμα τριχώματος και μέσου μεγέθους πόδια με αρσενικά με χρώμα και κανονικά πόδια γεννήθηκαν: 20 θηλυκά με μαύρο χρώμα και κανονικά πόδια. 22 θηλυκά με μαύρο χρώμα και μέσου μεγέθους πόδια. 42 θηλυκά με χρώμα και κανονικά πόδια. 39 θηλυκά με και μέσου μεγέθους πόδια. 22 αρσενικά με μαύρο τρίχωμα και κανονικά πόδια. 43 αρσενικά με τρίχωμα και κανονικά πόδια. Να προσδιορίσετε τον τύπο κληρονομικότητας για κάθε γονίδιο και να δείξετε τη διασταύρωση. Για το χρώμα τριχώματος: Στα θηλυκά, κίτρινα : μαύρα 2 : 1 Στα αρσενικά, κίτρινα : μαύρα 2 : 1 Άρα υπάρχει 1 θνησιγόνο αυτοσωμικό γονίδιο. Έστω Μ=μαύρο χρώμα, Μ =θνησιγόνο, ΜΜ = χρώμα Για το μέγεθος των ποδιών: Στα θηλυκά, κανονικά : μέσου μεγέθους πόδια 1 : 1 Στα αρσενικά: όλα κανονικά Επίσης : 2 : 1 Άρα υπάρχει ένα θνησιγόνο φυλοσύνδετο γονίδιο. Έστω Χ Κ =, Χ Κ1 =θνησιγόνο P: ΜΜ Χ Κ Χ Κ1 Χ ΜΜ Χ Κ Υ γαμέτες: ΜΧ Κ, ΜΧ Κ1, Μ Χ Κ, Μ Χ Κ1 ΜΧ Κ, ΜΥ, Μ Χ Κ, Μ Υ F1: ΜΧ Κ ΜΥ Μ Χ Κ Μ Υ ΜΧ Κ ΜΧ Κ1 Μ Χ Κ Μ Χ Κ1 ΜΜΧ Κ Χ Κ μαύρο ΜΜΧ Κ Χ Κ1 μαύρο μέσου μεγέθους πόδια ΜΜ Χ Κ Χ Κ ΜΜ Χ Κ Χ Κ1 μέσου μεγέθους πόδια ΜΜΧ Κ Υ μαύρο ΜΜΧ Κ1 Υ ΜΜ Χ Κ Υ ΜΜ Χ Κ1 Υ ΜΜ Χ Κ Χ Κ ΜΜ Χ Κ Χ Κ1 μέσου μεγέθους πόδια Μ Μ Χ Κ Χ Κ Μ Μ Χ Κ Χ Κ1 ΜΜ Χ Κ Υ ΜΜ Χ Κ1 Υ Μ Μ Χ Κ Υ Μ Μ Χ Κ1 Υ Κωστανίκος Δημήτρης 6 Βιολόγος

7 ΟΜΑΔΑ Β 15. Δύο αρσενικοί σκύλοι Α και Β διασταυρώνονται με τα θηλυκά άτομα Γ και Δ. Όλα τα άτομα έχουν μαύρο χρώμα και κοντό τρίχωμα. Από τη διασταύρωση του Α σκύλου με το θηλυκό Γ και το θηλυκό Δ προκύπτουν απόγονοι που έχουν όλοι μαύρο χρώμα και κοντό τρίχωμα. Η διασταύρωση σκύλου Β με το Γ δίνει απογόνους, άλλοι εκ των οποίων έχουν μαύρο χρώμα και άλλοι καστανό, αλλά όλοι κοντό τρίχωμα. Ο ίδιος σκύλος με το θηλυκό Δ δίνει απογόνους, άλλοι εκ των οποίων έχουν κοντό και άλλοι μακρύ τρίχωμα, αλλά όλοι μαύρο. Τα γονίδια για το χρώμα και το τρίχωμα βρίσκονται σε διαφορετικά χρωμοσώματα. α. Να βρείτε τον τύπο κληρονομικότητας των εν λόγω γονιδίων. β. Να βρείτε τους γονότυπους των ατόμων Α, Β, Γ και Δ. α. Και στα δύο ζεύγη γονιδίων τα αλληλόμορφά τους έχουν σχέση επικρατέςυπολειπόμενου Μ=μαύρο, μ=καστανό, όπου Μ>μ, Κ=κοντό, κ=μακρύ, όπου Κ>κ β. Α: ΜΜΚΚ, Β: ΜμΚκ, Γ: ΜμΚΚ, Δ: ΜΜΚκ 16. Το γονίδιο D είναι επικρατές αυτοσωμικό και ελέγχει το σχηματισμό κοχλία στο αυτί (όργανο απαραίτητο για τη λειτουργία της ακοής). Το γονίδιο Ε είναι επικρατές αυτοσωμικό, ανεξάρτητο του D και ελέγχει το σχηματισμό ακουστικού νεύρου. Αν ένα άτομο είναι ομόζυγο υπολειπόμενο για ένα από τα δύο ζεύγη γονιδίων, είναι κουφό. Δύο κουφοί γονείς επισκέφθηκαν γενετιστή, ο οποίος τους διαβεβαίωσε ότι αποκλείεται να αποκτήσουν κουφό παιδί. α. Ποιοι είναι οι γονότυποι των γονέων; β. Αν ένα αγόρι τους παντρευτεί με γυναίκα που έχει ίδιο γονότυπο με αυτό, τι ποσοστό των απογόνων τους θα έχει φυσιολογική ακοή; α. Ο ένας γονέας έχει γονότυπο ddee και ο άλλος DDee β. 9 : 16 φυσιολογική ακοή 17. Μια γυναίκα που ανήκει στην ομάδα αίματος Α και έχει κανονική όραση αποκτά πέντε παιδιά από δύο άνδρες. Ο ένας ανήκει στην ομάδα αίματος ΑΒ και είχε δαλτωνισμό και ο άλλος στην ομάδα Α και είχε κανονική όραση. Τα παιδιά είναι: α) Ένα αγόρι με Α ομάδα αίματος και δαλτωνισμό. β) Ένα αγόρι με Ο ομάδα αίματος και δαλτωνισμό. γ) Ένα κορίτσι με Α ομάδα αίματος και δαλτωνισμό. δ) Ένα κορίτσι με Β ομάδα αίματος και κανονική όραση. ε) Ένα κορίτσι με Α ομάδα αίματος και κανονική όραση. Ποιος από τους δύο άνδρες είναι ο πιο πιθανός πατέρας σε κάθε περίπτωση; Να εξηγηθούν οι απαντήσεις σας. 1 ο παιδί: 2/8 να ανήκει στον ΑΒ και 3/8 να ανήκει στον Α 2 ο παιδί: ανήκει στον Α 3 ο παιδί: ανήκει στον ΑΒ 4 ο παιδί: ανήκει στον ΑΒ 5 ο παιδί: 2/8 να ανήκει στον ΑΒ και 6/8 να ανήκει στον Α 18. Ο κυαμισμός (η έλλειψη του ένζυμου γλυκοζο-6-φωσφορικής αφυδρογονάσης) οφείλεται σε υπολειπόμενο φυλοσύνδετο γονίδιο. Άνδρας κυαμικός με αιμορροφιλία από τον 1 ο του γάμο αποκτάει έναν γιο φυσιολογικό και μια κόρη κυαμική και αιμορροφιλική. Από τον 2 ο του γάμο αποκτάει έναν γιο αιμορροφιλικό και μια κόρη κυαμική. α. Να προσδιοριστούν οι γονότυποι των ατόμων. β. Ποια η πιθανότητα η 2 η κόρη να κάνει γιο που φέρει και τις δύο ιδιότητες; γ. Ποια η πιθανότητα ο 1 ος γιος να αποκτήσει κόρη κυαμική και αιμορροφιλική; δ. Εάν ο 2 ος γιος παντρευτεί γυναίκα με κυαμισμό ποια η πιθανότητα να αποκτήσουν παιδί που φέρει τουλάχιστον την μία από τις δύο ιδιότητες; Έστω Χ Κ =φυσιολογικός, Χ κ =κυαμισμός, όπου Χ Κ >Χ κ και Χ Α =φυσιολογικός, Χ α =αιμορροφιλία, όπου Χ Α >Χ α α. Άνδρας Χ κα Υ, 1 η γυναίκα Χ ΚΑ Χ κα, 1 η κόρη Χ κα Χ κα, 1 ος γιος Χ ΚΑ Υ 2 η γυναίκα Χ Κα Χ κα, 2 η κόρη Χ κα Χ κα, 2 ος γιος Χ Κα Υ Κωστανίκος Δημήτρης 7 Βιολόγος

8 β. P=25% γ. P=0 δ. Η γυναίκα του μπορεί να έχει γονότυπο Χ κα Χ κα ή Χ κα Χ κα (κάθε γονότυπος έχει πιθανότητα 1/2) Διακρίνουμε 2 περιπτώσεις: 1 η περίπτωση: Χ Κα Υ Χ Χ κα Χ κα P 1 = 1/2 1/2 =1/4 2 η περίπτωση: Χ Κα Υ Χ Χ κα Χ κα P 2 = 1/2 3/4 =3/8 Pολ= P 1 +P 2 =1/4+3/8=2/8+3/8=5/8 Κωστανίκος Δημήτρης 8 Βιολόγος


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 2 ΕΠΙΚΡΑΤΗ 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους.

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ 1 Στη δροσόφιλα το κόκκινο χρώμα των ματιών είναι επικρατές. Εάν οι απόγονοι σε δύο διαφορετικές διασταυρώσεις είναι οι ακόλουθοι: ιασταύρωση Α ιασταύρωση Β 24 αρσενικά

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 5.1. Σε ποια στοιχεία οφείλεται η επιτυχία των πειραμάτων του Mendel; 5.2. Τι είναι ο γονότυπος ; Πως μπορούμε να βρούμε το γονότυπο

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα


-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 2001 ΗΜΕΡΗΣΙΟ 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο.

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. Μια γυναίκα της οποίας ο πατέρας έπασχε από γαλακτοζαιμία θέλει να

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις Αλληλεπιδράσεις γονιδίων Ι ασκήσεις 1. Στους σκύλους Labrador ένα θηλυκό άτομο με καστανό χρωματισμό διασταυρώθηκε με αρσενικό που είχε χρυσαφί χρωματισμό. Όλοι οι F1 απόγονοι είχαν μαύρο χρωματισμό. Η

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. Α: 1, 4, 5, 6 Β: 2, 3, 7, 8 Β2. Βλέπε σχολικό εγχειρίδιο σελ. 41-42 «Κατά την έναρξη

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3 ΠΡΟΒΛΗΜΑ 5.1 Στα ποντίκια το σκούρο μάτι απαιτεί την ταυτόχρονη παρουσία των υπερεχόντων αλληλομόρφων γονιδίων R και Q. Ζώα ομοζυγωτικά για ένα από τα δύο ή και τα δύο υποτελή αλληλόμορφα έχουν ανοιχτόχρωμα

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά ΠΡΟΒΛΗΜΑ 4.1 Στο σιτάρι, φυτά με κόκκινους σπόρους διασταυρώθηκαν με φυτά που είχαν λευκούς. Όλοι οι απόγονοι είχαν κόκκινους σπόρους. Μετά από την αυτογονιμοποίηση των φυτών της F 1, πήραμε στην F 2 :

Διαβάστε περισσότερα

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.)

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) Μενδελική κληρονομικότητα κεφάλαιο 5 Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) 5. Μενδελική κληρονομικότητα Το ενδιαφέρον για την κληρονομικότητα είναι πολύ παλιό, σχεδόν όσο και η ύπαρξη του ανθρώπινου

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης.

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης. Ν Ε Β Η Γονίδιο ανθεκτικότητας στο αντιβιοτικό θέση έναρξης της αντιγραφής καθώς και τις θέσεις πάνω σε αυτό που αναγνωρίζουν και κόβουν οι

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα


Κ Η Λ Ρ Η ΟΝ Ο Ο Ν Μ Ο ΙΚ Ι Ο Κ Τ Ο Η Τ Τ Η Α ΚΕΦΑΛΑΙΟ 5ο: Η πρώτη επιστηµονική µελέτη για την κληρονοµικότητα έγινε το 19ο αιώνα ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Από τον Αυστριακό µοναχός Gregor Mendel Θεωρείται ο πατέρας της Γενετικής 1 Ένα σηµαντικό στοιχείο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Μίτωση. ΓΕΝΕΤΙΚΗ Μίτωση http://vodpod.com/watch/631992-untitled http://www.youtube.com/watch?v=vln7k1-9qb0&feature=related Μείωση http://www.youtube.com/watch?v=qwmpd0ob3aq&feature=related Μεντελική Κληρονομικότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA.

1. Κατά τη µεταγραφή του DNA συντίθεται ένα α. δίκλωνο µόριο DNA. β. µονόκλωνο µόριο DNA. γ. δίκλωνο RNA. δ. µονόκλωνο RNA. ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΤΑΞΗ ΘΕΜΑ 1ο ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) Να γράψετε στο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 1 η Ιουνίου 2004 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση που

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα