ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο"

Transcript

1 ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με κίτρινο χρώμα σπέρματος και λευκό χρώμα άνθους. 113 άτομα με πράσινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 112 άτομα με πράσινο χρώμα σπέρματος και λευκό χρώμα άνθους. Ποιος είναι ο γονότυπος των γονέων τους; 2. Στην ράτσα «cocker spaniel» το μαύρο χρώμα είναι επικρατές έναντι του κόκκινου χρώματος τριχώματος, ενώ ο ομοιόμορφος χρωματισμός οφείλεται σε επικρατές γονίδιο και ο χρωματισμός με στίγματα σε υπολειπόμενο γονίδιο. Κανένα από τα γονίδια δεν είναι θνησιγόνο. Ομοιόμορφο μαύρο αρσενικό διασταυρώνεται με κόκκινο ομοιόμορφο θηλυκό και γεννιούνται 6 κουτάβια: 2 μαύρα ομοιόμορφα, 2 κόκκινα ομοιόμορφα, 1 μαύρο με στίγματα και 1 κόκκινο με στίγματα. α. Ποιος ο γονότυπος των γονέων; β. Ποια θα ήταν η αναμενόμενη φαινοτυπική αναλογία από τη διασταύρωση αυτή; 3. Στις τομάτες το ψηλό φυτό οφείλεται σε επικρατές γονίδιο, ενώ το φυτό νάνος οφείλεται σε υπολειπόμενο γονίδιο. Σε ένα άλλο ζεύγος χρωμοσωμάτων του φυτού υπάρχει η γενετική θέση που καθορίζει την εμφάνιση τριχών ή την έλλειψη τριχών στο στέλεχος. Από τη διασταύρωση δύο φυτών προέκυψαν στην επόμενη γενιά: 118 ψηλά με τρίχες, 112 φυτά νάνοι με τρίχες, 40 ψηλά φυτά χωρίς τρίχες και 37 φυτά νάνοι χωρίς τρίχες. Ποιοι οι γονότυποι των γονέων; 4. Στα καρπούζια η πικρή γεύση οφείλεται σε επικρατές γονίδιο και η γλυκιά γεύση σε υπολειπόμενο, ενώ οι κίτρινες κηλίδες στην επιφάνεια του φρούτου επικρατούν έναντι της απουσίας κηλίδων. Από την διασταύρωση αμιγών ατόμων με πικρή γεύση και κίτρινες κηλίδες με αμιγή άτομα με γλυκιά γεύση και απουσία κηλίδων να βρεθεί: α. Η γονοτυπική και φαινοτυπική αναλογία της F 2 γενιάς. β. Αν προκύψουν 308 άτομα πόσα από αυτά θα έχουν γλυκιά γεύση και πόσα θα έχουν κίτρινες κηλίδες; γ. Πώς είναι δυνατή η απομόνωση αμιγών ατόμων με πικρή γεύση και απουσία κηλίδων; 5. Ποιοι είναι οι πιθανοί απόγονοι και με ποια πιθανότητα θα προκύψουν από τη διασταύρωση μιας κανονικής Drosophila με μια άλλη που έχει «υποπλασμένα φτερά» και «άτριχο σώμα». Οι χαρακτήρες «υποπλασμένα φτερά» και «άτριχο σώμα» είναι υπολειπόμενοι και βρίσκονται σε διαφορετικά χρωμοσώματα. 6. Από την διασταύρωση χοίρων με οπλές που μοιάζουν σαν του μουλαριού και άσπρο χρώμα γεννιούνται απόγονοι από τους οποίους οι 8 έχουν μαύρο χρώμα και φυσιολογική σχισμή. Αν τα γονίδια βρίσκονται σε διαφορετικά χρωμοσώματα, να βρείτε τον πιθανό αριθμό των υπόλοιπων ατόμων που θα έχουν νέους φαινοτύπους. 7. Σε ένα είδος κολοκυθιού το λευκό χρώμα του καρπού οφείλεται σε επικρατές γονίδιο και το κίτρινο χρώμα σε υπολειπόμενο γονίδιο. Το δισκοειδές σχήμα του καρπού οφείλεται σε επικρατές γονίδιο και το σφαιρικό σχήμα σε υπολειπόμενο. Από τη διασταύρωση ατόμου με λευκό και σφαιρικό καρπό με άτομο με κίτρινο και δισκοειδές καρπό προκύπτουν στην επόμενη γενιά τα εξής άτομα: 180 άτομα με λευκό χρώμα καρπού και δισκοειδές σχήμα καρπού. 185 άτομα με λευκό χρώμα καρπού και σφαιρικό σχήμα καρπού. 178 άτομα με κίτρινο χρώμα καρπού και δισκοειδές σχήμα καρπού. 183 άτομα με κίτρινο χρώμα καρπού και σφαιρικό σχήμα καρπού. Ποιος είναι ο γονότυπος των γονέων τους; 8. Το Rh - (ρέζους αρνητικό-παράγοντας αίματος) οφείλεται σε υπολειπόμενο αυτοσωμικό γονίδιο ενώ το Rh + σε επικρατές. Κάποιος ισχυρίζεται ότι κάποιο από τα 6 παιδιά του δεν είναι δικό του. Η ανάλυση αίματος έδειξε τα εξής: Πατέρας: Ο+ Μητέρα:Α+ 1

2 1 ο παιδί: Α+ 2 ο παιδί:ο- 3 ο παιδί:α- 4 ο παιδί:ο+ 5 ο παιδί:αβ+ 6 ο παιδί:β- Έχει δίκιο; 9. Το Rh - (ρέζους αρνητικό-παράγοντας αίματος) οφείλεται σε υπολειπόμενο αυτοσωμικό γονίδιο, ενώ το Rh + σε επικρατές. Ζευγάρι υποστηρίζει ότι στο νοσοκομείο τους έδωσαν λάθος παιδί. Η γυναίκα έχει ομάδα αίματος Ο θετικό, ο άνδρας είναι Β θετικός και το παιδί είναι Ο αρνητικό. α. Έχουν δίκιο; β. Ποια η πιθανότητα το ζευγάρι αυτό να αποκτήσει κορίτσι Ο θετικό; 10. Άνδρας ομάδας αίματος Α και Rh - (ρέζους αρνητικό-παράγοντας αίματος), του οποίου ο πατέρας είναι ομάδα αίματος ΑΒ και Rh + (ρέζους θετικό) και η μητέρα είναι Β και Rh + (ρέζους θετικό), παντρεύεται γυναίκα ομάδα αίματος Ο και Rh +, της οποία ο αδελφός είναι ΑΒ Rh -, ο πατέρας Α Rh + και η μητέρα Β Rh +. Το 1 ο τους παιδί είναι Α και Rh -. α. Να γράψετε τους γονότυπους όλων των ατόμων. β. Ποια η πιθανότητα να αποκτήσουν παιδί ομάδας αίματος Ο και Rh - ; γ. Ποια η πιθανότητα να αποκτήσουν αγόρι ομάδα αίματος Α Rh + ; δ. Ποια η πιθανότητα τα 2 επόμενα παιδιά να είναι το ένα Ο και Rh + και το άλλο Α και Rh - ; 11. Από τη διασταύρωση ινδικών χοιριδίων με κοντό και άσπρο τρίχωμα με ινδικά χοιρίδια με μακρύ και κίτρινο τρίχωμα γεννήθηκαν τα εξής άτομα στην F 2 γενιά: 150 άτομα με κοντό και κρεμ χρώμα. 74 άτομα με κοντό και άσπρο χρώμα. 76 άτομα με κοντό και κίτρινο χρώμα. 51 άτομα με μακρύ και κρεμ χρώμα. 23 άτομα με μακρύ και με άσπρο χρώμα. 26 άτομα με μακρύ και με κίτρινο χρώμα. α. Να εξηγήσετε τα αποτελέσματα και να δείξετε τους γονότυπους των ατόμων της P και F 1 γενιάς. β. Εάν θηλυκό άτομο με μακρύ τρίχωμα και κρεμ χρώμα διασταυρωθεί με τα άτομα της P γενιάς ποια η πιθανότητα να γεννηθούν ινδικά χοιρίδιο με κρεμ χρώμα; 12. Στα βοοειδή της ράτσας Shorthorn από τη διασταύρωση ταύρου με κόκκινο χρώμα και κέρατα με αγελάδα με λευκό χρώμα χωρίς κέρατα όλοι οι απόγονοι έχουν κόκκινο-λευκό χρώμα και δε φέρουν κέρατα. Να βρεθούν οι γονότυποι των ατόμων της πατρικής (P) γενιάς καθώς και η φαινοτυπική και γονοτυπική αναλογία της F 2 γενιάς. 13. Γυναίκα φυσιολογική και άντρας αλφικός απόκτησαν ένα αγόρι αλφικό και δαλτωνικό. α. Ποιοι είναι οι γονότυποι των ατόμων; β. Ποια η πιθανότητα να αποκτήσουν κορίτσι αλφικό και δαλτωνικό; γ. Ποια η πιθανότητα τα 4 επόμενα παιδιά τους να είναι με την σειρά: παιδί φυσιολογικό-αγόρι δαλτωνικό-κορίτσι αλφικό-αγόρι αλφικό και δαλτωνικό; 14. Μια γυναίκα φυσιολογική της οποίας ο πατέρας έχει δρεπανοκυτταρική αναιμία και είναι δαλτωνικός παντρεύεται με άνδρα φυσιολογικό. Ποια η πιθανότητα το παιδί που θα γεννηθεί να είναι δαλτωνικό και φορέας της δρεπανοκυτταρικής αναιμίας; 15. Από την διασταύρωση θηλυκού ατόμου Drosophila με κόκκινα μάτια και κανονικές τρίχες σώματος με αρσενικό άτομο με καφέ μάτια και διχαλωτές τρίχες σώματος στην F 2 γενιά προέκυψαν τα ακόλουθα άτομα: 40 αρσενικά με κόκκινα μάτια και κανονικές τρίχες. 83 θηλυκά με κόκκινα μάτια και κανονικές τρίχες. 42 αρσενικά με κόκκινα μάτια και διχαλωτές τρίχες. 15 αρσενικά με καφέ μάτια και κανονικές τρίχες. 29 θηλυκά με καφέ μάτια και κανονικές τρίχες. 13 αρσενικά με καφέ μάτια και διχαλωτές τρίχες. Να βρεθούν οι γονότυποι των ατόμων και η φαινοτυπική και γονοτυπική αναλογία της F 2 γενιάς. 2

3 16. Ραπανάκια επιμήκη με κόκκινο χρώμα διασταυρώνονται με ραπανάκια σφαιρικά με λευκό χρώμα και στην F 2 γενιά προκύπτουν τα παρακάτω άτομα: 28 άτομα ωοειδή και μωβ 13 άτομα ωοειδή και κόκκινα 14 άτομα ωοειδή και λευκά 13 άτομα επίμηκες και μωβ 15 άτομα σφαιρικά και μωβ 7 άτομα επίμηκες και κόκκινα 9 άτομα επίμηκες και λευκά 8 άτομα σφαιρικά και κόκκινα 6 άτομα σφαιρικά και λευκά Ποιος ο τρόπος κληρονόμησης των γονιδίων και ποιοι οι γονότυποι των ατόμων της πατρικής (P) και F 1 γενιάς; 17. Ένα υπολειπόμενο γονίδιο στον άνθρωπο όταν βρεθεί σε ομόζυγη κατάσταση προκαλεί συγκόλληση των πνευμόνων με αποτέλεσμα το θάνατο των παιδιών μόλις γεννιούνται. Ένας άνδρας με φαινυλκετονουρία και ετερόζυγος ως προς το γονίδιο αυτό των πνευμόνων παντρεύεται γυναίκα ετερόζυγη ως προς το γονίδιο αυτό των πνευμόνων. α. Ποιοι είναι οι γονότυποι των γονέων; β. Ποια η πιθανότητα το 1 ο παιδί να πεθάνει; γ. Ποια η πιθανότητα από τα 3 πρώτα παιδιά που θα γεννηθούν τα 2 να έχουν φαινυλκετονουρία και να είναι ετερόζυγα ως προς το θνησιγόνο γονίδιο και το άλλο να μην εμφανίζει φαινυλκετονουρία και να μην είναι ετερόζυγο ως προς το θνησιγόνο γονίδιο; 18. Στη Drosoplila διασταύρωση ατόμων με πορφυροειδές χρώμα και μικρού πάχους τρίχες δίνει τους παρακάτω απογόνους: 21 άτομα με πορφυροειδή χρώμα και μικρού πάχους τρίχες 9 άτομα με πορφυροειδή χρώμα και κανονικές τρίχες 11 άτομα με κανονικό χρώμα και μικρού πάχους τρίχες 6 άτομα με κανονικό χρώμα και κανονικές τρίχες α. Να εξηγήσετε τα αποτελέσματα και να δείξετε τον γονότυπο των γονέων. β. Ποιος θεωρητικά είναι ο αριθμός των ατόμων που έχουν πεθάνει; 19. Από τη διασταύρωση θηλυκών ποντικών με κίτρινο χρώμα τριχώματος και μέσου μεγέθους πόδια με αρσενικά με κίτρινο χρώμα και κανονικά πόδια γεννήθηκαν: 20 θηλυκά με μαύρο χρώμα και κανονικά πόδια. 22 θηλυκά με μαύρο χρώμα και μέσου μεγέθους πόδια. 42 θηλυκά με κίτρινο χρώμα και κανονικά πόδια. 39 θηλυκά με κίτρινο και μέσου μεγέθους πόδια. 22 αρσενικά με μαύρο τρίχωμα και κανονικά πόδια. 43 αρσενικά με κίτρινο τρίχωμα και κανονικά πόδια. Να προσδιορίσετε τον τύπο κληρονομικότητας για κάθε γονίδιο και να δείξετε τη διασταύρωση. 20. Ο κυαμισμός (η έλλειψη του ένζυμου γλυκοζο-6-φωσφορικής αφυδρογονάσης) οφείλεται σε υπολειπόμενο φυλοσύνδετο γονίδιο. Άνδρας κυαμικός με αιμορροφιλία από τον 1 ο του γάμο αποκτάει έναν γιο φυσιολογικό και μια κόρη κυαμική και αιμορροφιλική. Από τον 2 ο του γάμο αποκτάει έναν γιο αιμορροφιλικό και μια κόρη κυαμική. α. Να προσδιοριστούν οι γονότυποι των ατόμων. β. Ποια η πιθανότητα η 2 η κόρη να κάνει γιο που φέρει και τις δύο ιδιότητες; γ. Ποια η πιθανότητα ο 1 ος γιος να αποκτήσει κόρη κυαμική και αιμορροφιλική; δ. Εάν ο 2 ος γιος παντρευτεί γυναίκα με κυαμισμό ποια η πιθανότητα να αποκτήσουν παιδί που φέρει τουλάχιστον την μία από τις δύο ιδιότητες; ΟΜΑΔΑ Β 21. Δύο αρσενικοί σκύλοι Α και Β διασταυρώνονται με τα θηλυκά άτομα Γ και Δ. Όλα τα άτομα έχουν μαύρο χρώμα και κοντό τρίχωμα. Από τη διασταύρωση του Α σκύλου με το θηλυκό Γ και το θηλυκό Δ προκύπτουν απόγονοι που έχουν όλοι μαύρο χρώμα και κοντό τρίχωμα. Η διασταύρωση σκύλου Β με το Γ δίνει απογόνους, άλλοι εκ των οποίων έχουν μαύρο χρώμα και άλλοι καστανό, αλλά όλοι κοντό τρίχωμα. Ο ίδιος 3

4 σκύλος με το θηλυκό Δ δίνει απογόνους, άλλοι εκ των οποίων έχουν κοντό και άλλοι μακρύ τρίχωμα, αλλά όλοι μαύρο. Τα γονίδια για το χρώμα και το τρίχωμα βρίσκονται σε διαφορετικά χρωμοσώματα. α. Να βρείτε τον τύπο κληρονομικότητας των εν λόγω γονιδίων. β. Να βρείτε τους γονότυπους των ατόμων Α, Β, Γ και Δ. 22. Το γονίδιο D είναι επικρατές αυτοσωμικό και ελέγχει το σχηματισμό κοχλία στο αυτί (όργανο απαραίτητο για τη λειτουργία της ακοής). Το γονίδιο Ε είναι επικρατές αυτοσωμικό, ανεξάρτητο του D και ελέγχει το σχηματισμό ακουστικού νεύρου. Αν ένα άτομο είναι ομόζυγο υπολειπόμενο για ένα από τα δύο ζεύγη γονιδίων, είναι κουφό. Δύο κουφοί γονείς επισκέφθηκαν γενετιστή, ο οποίος τους διαβεβαίωσε ότι αποκλείεται να αποκτήσουν κουφό παιδί. α. Ποιοι είναι οι γονότυποι των γονέων; β. Αν ένα αγόρι τους παντρευτεί με γυναίκα που έχει ίδιο γονότυπο με αυτό, τι ποσοστό των απογόνων τους θα έχει φυσιολογική ακοή; 23. Ένας άντρας και μια γυναίκα έχουν 12,5% πιθανότητα να αποκτήσουν παιδί με μία από τις τέσσερις ομάδες αίματος και οικογενή υπερχοληστερολαιμία ή παιδί με μία από τις τέσσερις ομάδες αίματος το οποίο είναι φυσιολογικό. Από τα δεδομένα αυτά να βρεις τους γονότυπους του άντρα και της γυναίκας. 24. Από τη διασταύρωση δύο εντόμων Drosophilla προέκυψαν οι εξής απόγονοι: 21 θηλυκά με γκρι χρώμα σώματος και με σμήριγγες 20 θηλυκά με μαύρο χρώμα σώματος και με σμήριγγες 10 αρσενικά με γκρι χρώμα σώματος και με σμήριγγες 11 αρσενικά με μαύρο χρώμα σώματος και με σμήριγγες 11 αρσενικά με γκρι χρώμα σώματος και χωρίς σμήριγγες 10 αρσενικά με μαύρο χρώμα σώματος και χωρίς σμήριγγες Ποιοι είναι οι πιθανοί γονότυποι και φαινότυποι των ατόμων της πατρικής γενιάς; 25. Μια γυναίκα που ανήκει στην ομάδα αίματος Α και έχει κανονική όραση αποκτά πέντε παιδιά από δύο άνδρες. Ο ένας ανήκει στην ομάδα αίματος ΑΒ και είχε δαλτωνισμό και ο άλλος στην ομάδα Α και είχε κανονική όραση. Τα παιδιά είναι: α) Ένα αγόρι με Α ομάδα αίματος και δαλτωνισμό. β) Ένα αγόρι με Ο ομάδα αίματος και δαλτωνισμό. γ) Ένα κορίτσι με Α ομάδα αίματος και δαλτωνισμό. δ) Ένα κορίτσι με Β ομάδα αίματος και κανονική όραση. ε) Ένα κορίτσι με Α ομάδα αίματος και κανονική όραση. Ποιος από τους δύο άνδρες είναι ο πιο πιθανός πατέρας σε κάθε περίπτωση; Να εξηγηθούν οι απαντήσεις σας. 26. Σε μια ράτσα προβάτου δίνονται οι παρακάτω διασταυρώσεις ατόμων: Φυσιολογικό τρίχωμα και γκρίζο χρώμα Φυσιολογικό τρίχωμα και γκρίζο χρώμα Φυσιολογικό τρίχωμα και μαύρο χρώμα 25% νεκρά, Φυσιολ. και γκρίζα: Φυσιολ. μαύρα=2:1 Όλα επιβιώνουν και έχουν μειωμένο τρίχωμα με μαύρο χρώμα Όλα επιβιώνουν και έχουν πολύ τρίχωμα και μαύρο χρώμα α. Τι συμπεραίνετε για τα γονίδια; β. Αν από τους απογόνους της διασταύρωσης: άτομα με φυσιολογικό τρίχωμα και γκρίζο χρώμα άτομα με μειωμένο τρίχωμα και γκρίζο χρώμα πεθαίνουν 10 άτομα να βρείτε τους φαινότυπους και τον πιθανό αριθμό των υπόλοιπων ατόμων. 27. Μια κυαμική (κυαμισμός είναι η έλλειψη του ένζυμου γλυκοζο-6-φωσφορικής αφυδρογονάσης και οφείλεται σε υπολειπόμενο φυλοσύνδετο γονίδιο) και ετερόζυγη ως προς τον δαλτωνισμό και την αιμορροφιλία γυναίκα παντρεύεται άνδρα δαλτωνικό. α. Ποια η πιθανότητα το 1 ο παιδί να είναι δαλτωνικό; β. Ποια η πιθανότητα το 1 ο αγόρι, όταν γεννηθεί, να φέρει και τις 3 ιδιότητες; γ. Ποια η πιθανότητα τα 2 πρώτα παιδιά να είναι με τυχαία σειρά ένα κορίτσι φυσιολογικό και ένα αγόρι που φέρει τουλάχιστον τις 2 από τις 3 ιδιότητες; 4

5 28. Από την διασταύρωση, σε ένα είδος εντόμου, αρσενικών ατόμων με ίσες κεραίες και άσπρο χρώμα σώματος με θηλυκά άτομα με ίσες κεραίες και μαύρο χρώμα σώματος γεννήθηκαν: 92 αρσενικά με ίσες κεραίες και ασπρόμαυρο χρώμα σώματος 30 αρσενικά με κυρτές κεραίες και ασπρόμαυρο χρώμα σώματος 91 θηλυκά με ίσες κεραίες και άσπρο χρώμα σώματος 29 θηλυκά με κυρτές κεραίες και άσπρο χρώμα σώματος Να εξηγήσετε τον τρόπο που κληρονομούνται τα γνωρίσματα αυτά και να βρείτε τους γονότυπους των γονέων. 5

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 2 ΕΠΙΚΡΑΤΗ 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους.

Διαβάστε περισσότερα

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο

ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ 5 ου ΚΕΦΑΛΑΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ 5 ου ΚΕΦΑΛΑΙΟΥ ΠΕΙΡΑΜΑΤΙΚΟ ΕΝΙΑΙΟ ΛΥΚΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΜΑΚΕΔΟΝΙΑΣ ZAΡΦΤΖΙΑΝ ΜΑΡΙΛΕΝΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΣΚΗΣΕΙΣ 5 ου ΚΕΦΑΛΑΙΟΥ ΓΑΜΕΤΕΣ 1. Eνας διπλοειδής οργανισμός με 5 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 5 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ)

ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ) ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ ΕΥΡΕΣΗ ΑΠΟΓΟΝΩΝ ΑΠΟ ΓΟΝΕΙΣ ΜΕ ΓΝΩΣΤΟ ΤΡΟΠΟ ΚΛΗΡΟΝΟΜΗΣΗΣ (ΑΥΤΟΣΩΜΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ) 1. Στις αλεπούδες το ασηµόµαυρο χρώµα του τριχώµατος καθορίζεται από ένα υπολειπόµενο αλληλόµορφο

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ. Βιολογία Κατεύθυνσης Γ Λυκείου Ασκήσεις 5 ου Κεφαλαίου

ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ. Βιολογία Κατεύθυνσης Γ Λυκείου Ασκήσεις 5 ου Κεφαλαίου ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ 1) Από την διασταύρωση ταύρου χωρίς κέρατα α) με αγελάδα που έχει κέρατα, γεννήθηκε μοσχάρι χωρίς κέρατα, β) επίσης με αγελάδα που έχει κέρατα, γεννήθηκε μοσχάρι με κέρατα γ) με αγελάδα

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC

ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ

ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 5.1. Σε ποια στοιχεία οφείλεται η επιτυχία των πειραμάτων του Mendel; 5.2. Τι είναι ο γονότυπος ; Πως μπορούμε να βρούμε το γονότυπο

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ

ΠΑΝΕΠΙΣΤΗΜΙΑΚΑ ΦΡΟΝΤΙΣΤΗΡΙΑ ΚΟΛΛΙΝΤΖΑ ΔΕΙΓΜΑ ΑΠΟ ΤΗΝ ΤΡΑΠΕΖΑ ΘΕΜΑΤΩΝ ΤΩΝ ΕΚΑΤΟΝΤΑΔΩΝ ΕΡΩΤΗΣΕΩΝ ΒΙΟΛΟΓΙΑΣ ΠΟΥ ΔΙΑΘΕΤΟΥΜΕ ΚΑΙ ΠΟΥ ΑΝΟΙΓΟΥΝ ΤΟ ΔΡΟΜΟ ΓΙΑ ΤΟΝ ΔΙΟΡΙΣΜΟ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΜΑΣ ΣΤΟ ΔΗΜΟΣΙΟ ΓΕΝΕΤΙΚΗ 1) Γονιδιακές μεταλλάξεις, χρωμοσωμικές

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα Κεφάλαιο 5: Μενδελική Κληρονομικότητα ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Ο Mendel. α. εξέταζε σε κάθε πείραμά του το σύνολο των ιδιοτήτων του μοσχομπίζελου β. χρησιμοποιούσε αμιγή στελέχη στις ιδιότητες που μελετούσε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΗΜΕΡΟΜΗΝΙΑ: ΦΡΟΝΤΙΣΤΗΡΙΟ: ΒΑΚΑΛΗΣ

ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΗΜΕΡΟΜΗΝΙΑ: ΦΡΟΝΤΙΣΤΗΡΙΟ: ΒΑΚΑΛΗΣ ΑΠΑΝΤΗΣΕΙΣ ΚΡΙΤΗΡΙΟΥ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ : ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΗΜΕΡΟΜΗΝΙΑ: ΦΡΟΝΤΙΣΤΗΡΙΟ: ΒΑΚΑΛΗΣ ΘΕΜΑ 1 Ο 1. α 2. γ 3. β 4. β 5. β ΘΕΜΑ 2 Ο Α. Ένας αυτοσωμικός

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο.

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. Μια γυναίκα της οποίας ο πατέρας έπασχε από γαλακτοζαιμία θέλει να

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ 1 Στη δροσόφιλα το κόκκινο χρώμα των ματιών είναι επικρατές. Εάν οι απόγονοι σε δύο διαφορετικές διασταυρώσεις είναι οι ακόλουθοι: ιασταύρωση Α ιασταύρωση Β 24 αρσενικά

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 2001 ΗΜΕΡΗΣΙΟ 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

ΦΥΕ 43: ΓΕΝΕΤΙΚΗ ΟΔΗΓΟΣ ΕΠΙΛΥΣΗΣ ΑΣΚΗΣΕΩΝ ΚΩΣΤΑΣ ΜΠΟΥΡΤΖΗΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ

ΦΥΕ 43: ΓΕΝΕΤΙΚΗ ΟΔΗΓΟΣ ΕΠΙΛΥΣΗΣ ΑΣΚΗΣΕΩΝ ΚΩΣΤΑΣ ΜΠΟΥΡΤΖΗΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΦΥΕ 43: ΓΕΝΕΤΙΚΗ ΟΔΗΓΟΣ ΕΠΙΛΥΣΗΣ ΑΣΚΗΣΕΩΝ ΚΩΣΤΑΣ ΜΠΟΥΡΤΖΗΣ ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΤΜΗΜΑ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΚΑΙ ΦΥΣΙΚΩΝ ΠΟΡΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΙΩΑΝΝΙΝΩΝ 1 Χρήσιμες οδηγίες για την επίλυση ασκήσεων Γενετικής

Διαβάστε περισσότερα

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6

ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: 20 / 02 / 2016 ΟΝΟΜΑΤΕΠΩΝΥΜΟ ΕΞΕΤΑΖΟΜΕΝΟΥ:. ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών

-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3

ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3 ΠΡΟΒΛΗΜΑ 5.1 Στα ποντίκια το σκούρο μάτι απαιτεί την ταυτόχρονη παρουσία των υπερεχόντων αλληλομόρφων γονιδίων R και Q. Ζώα ομοζυγωτικά για ένα από τα δύο ή και τα δύο υποτελή αλληλόμορφα έχουν ανοιχτόχρωμα

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Αλληλεπιδράσεις γονιδίων Ι ασκήσεις Αλληλεπιδράσεις γονιδίων Ι ασκήσεις 1. Στους σκύλους Labrador ένα θηλυκό άτομο με καστανό χρωματισμό διασταυρώθηκε με αρσενικό που είχε χρυσαφί χρωματισμό. Όλοι οι F1 απόγονοι είχαν μαύρο χρωματισμό. Η

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2

ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum).

Μεντελική γενετική. Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Μεντελική γενετική Λείοι σπόροι του μοσχομπίζελου (Pisum sativum). Φαινότυπος και Γονότυπος Η φυσική εκδήλωση (φαινότυπος) της γενετικής σύστασης (γονότυπος) επηρεάζεται από τις αλληλεπιδράσεις με άλλα

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης.

Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης. ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης. Μαθητές: Όλγα Ντριζάη, Κυριακή Πρίφτη 2013 ΕΙΣΑΓΩΓΗ Είναι γνωστό και εύκολα µπορεί να παρατηρηθεί ότι όλα τα άτοµα

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα

Το DNA ως γενετικό υλικό παρουσιάζει κάποιες ιδιότητες:

Το DNA ως γενετικό υλικό παρουσιάζει κάποιες ιδιότητες: 1 ΕΝΟΤΗΤΑ 16: ΓΕΝΕΤΙΚΗ 16.1 ΕΙΣΑΓΩΓΗ Γενετική είναι ο κλάδος της Βιολογίας που ασχολείται με την μελέτη της κληρονομικότητας. Κληρονομικότητα είναι η μεταβίβαση χαρακτήρων από τους προγόνους στους απογόνους.

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά ΠΡΟΒΛΗΜΑ 4.1 Στο σιτάρι, φυτά με κόκκινους σπόρους διασταυρώθηκαν με φυτά που είχαν λευκούς. Όλοι οι απόγονοι είχαν κόκκινους σπόρους. Μετά από την αυτογονιμοποίηση των φυτών της F 1, πήραμε στην F 2 :

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2014 ΤΑΞΗ: Α ΗΜΕΡΟΜΗΝΙΑ: 06/06/2014

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2014 ΤΑΞΗ: Α ΗΜΕΡΟΜΗΝΙΑ: 06/06/2014 ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: 2013-2014 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2014 ΤΑΞΗ: Α ΗΜΕΡΟΜΗΝΙΑ: 06/06/2014 ΜΑΘΗΜΑ:ΦΥΣΙΟΓΝΩΣΤΙΚΑ ΔΙΑΡΚΕΙΑ ΕΞΕΤΑΣΗΣ: 2 ΩΡΕΣ Ονοματεπώνυμο:...Τμήμα:... Αριθμός:...

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α : Α1. δ, Α2. γ, Α3. β, Α4. β, Α5. β Θέμα Β : Β1. Σελ.123 η παράγραφος με τίτλο «Ανοσοδιαγνωστικά» Β2. α-8, β-1, γ-6, δ-5, ε-7, στ-3 Β3. Σελ. 84

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.)

κεφάλαιο Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) Μενδελική κληρονομικότητα κεφάλαιο 5 Τοιχογραφία με χαρακτηριστικά αλόγων (4.000 π.χ.) 5. Μενδελική κληρονομικότητα Το ενδιαφέρον για την κληρονομικότητα είναι πολύ παλιό, σχεδόν όσο και η ύπαρξη του ανθρώπινου

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014

ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα

Εισαγωγή στη Δασική Γενετική Οι νόμοι της κληρονομικότητας

Εισαγωγή στη Δασική Γενετική Οι νόμοι της κληρονομικότητας Εισαγωγή στη Δασική Γενετική Οι νόμοι της κληρονομικότητας Χειμερινό εξάμηνο 2014-2015 Σύνοψη Κάθε Οι Τυχαία Τυχαίος Αναλογία άτομο έχει δύο σειρές αλληλομόρφων σε κάθε γονίδιο γαμέτες έχουν ένα από τα

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. Α: 1, 4, 5, 6 Β: 2, 3, 7, 8 Β2. Βλέπε σχολικό εγχειρίδιο σελ. 41-42 «Κατά την έναρξη

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

Μίτωση.

Μίτωση. ΓΕΝΕΤΙΚΗ Μίτωση http://vodpod.com/watch/631992-untitled http://www.youtube.com/watch?v=vln7k1-9qb0&feature=related Μείωση http://www.youtube.com/watch?v=qwmpd0ob3aq&feature=related Μεντελική Κληρονομικότητα

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα

Κ Η Λ Ρ Η ΟΝ Ο Ο Ν Μ Ο ΙΚ Ι Ο Κ Τ Ο Η Τ Τ Η Α

Κ Η Λ Ρ Η ΟΝ Ο Ο Ν Μ Ο ΙΚ Ι Ο Κ Τ Ο Η Τ Τ Η Α ΚΕΦΑΛΑΙΟ 5ο: Η πρώτη επιστηµονική µελέτη για την κληρονοµικότητα έγινε το 19ο αιώνα ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Από τον Αυστριακό µοναχός Gregor Mendel Θεωρείται ο πατέρας της Γενετικής 1 Ένα σηµαντικό στοιχείο

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙΔΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑΔΑ Β ) ΣΑΒΒΑΤΟ 28 ΝΟΕΜΒΡΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015

Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης.

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης. β. Το πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης. Ν Ε Β Η Γονίδιο ανθεκτικότητας στο αντιβιοτικό θέση έναρξης της αντιγραφής καθώς και τις θέσεις πάνω σε αυτό που αναγνωρίζουν και κόβουν οι

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Παραδόσεις του μαθήματος

Βιολογία Θετικής Κατεύθυνσης. Παραδόσεις του μαθήματος Βιολογία Θετικής Κατεύθυνσης Παραδόσεις του μαθήματος Κεφάλαιο 5ο ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Επιλογή του πειραματικού του υλικού Χρήση του μοσχομπίζελου το οποίο αναπτύσσεται γρήγορα, εμφανίζει ποικιλότητα

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο ΑΠΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΥ ΕΝΙΑΙΥ ΛΥΚΕΙΥ ΤΡΙΤΗ 1 ΙΥΝΙΥ 2004 ΕΞΕΤΑΖΜΕΝ ΜΑΘΗΜΑ: ΒΙΛΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ 1 (δ) µονόκλωνο RNA 2. (β) αντίγραφα των mrna όλων των γονιδίων

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013

ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΧΟΛΙΚΗ ΧΡΟΝΙΑ: ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013 ΛΥΚΕΙΟ ΠΑΡΑΛΙΜΝΙΟΥ ΣΟΛΙΚΗ ΡΟΝΙΑ: 2012-2013 ΓΡΑΠΤΕΣ ΠΡΟΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΜΑΙΟΥ-ΙΟΥΝΙΟΥ 2013 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ-ΦΥΣΙΟΓΝΩΣΤΙΚΑ ΗΜΕΡΟΜΗΝΙΑ: 21/05/2013 ΤΑΞΗ: Α ΣΥΝΟΛΙΚΗ ΔΙΑΡΚΕΙΑ ΓΡΑΠΤΟΥ ΒΙΟΛΟΓΙΑΣ-ΗΜΕΙΑΣ: 2 ΩΡΕΣ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα

ΓΕ.Λ. Νέου Σκοπού Σερρών Ενδεικτικές απαντήσεις στη Βιολογία Θετικής Κατεύθυνσης

ΓΕ.Λ. Νέου Σκοπού Σερρών Ενδεικτικές απαντήσεις στη Βιολογία Θετικής Κατεύθυνσης 1 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ Παρασκευή, 22 Μαΐου 2015 ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ A5. γ ΘΕΜΑ Β Μονάδες 5 * 5 = 25 Β1. 1. Α 2. Β 3.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α)

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2012 (ΟΜΑΔΑ Α) ΘΕΜΑ Α (Μονάδες 25) Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση: Α1. Ένα

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6

ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ 1, 2, 4, 5 και 6 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΚΡΙΤΗΡΙΟ ΑΞΙΟΛΟΓΗΣΗΣ ΣΤΗ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΕΞΕΤΑΣΤΕΑ ΥΛΗ: ΚΕΦΑΛΑΙΑ,, 4, 5 και 6 ΦΡΟΝΤΙΣΤΗΡΙΟ: ΚΟΡΥΦΑΙΟ ΗΜΕΡΟΜΗΝΙΑ: 0 / 0 / 06 ΘΕΜΑ Ο -γ -4 3-δ 4-δ 5-β ΘΕΜΑ Ο Α. Παρατηρούμενη Φ.Α

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα

ΘΕΩΡΗΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ

ΘΕΩΡΗΤΙΚΟ ΦΡΟΝΤΙΣΤΗΡΙΟ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1.

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 α Α2 γ Α3 δ Α4 β Α5 γ ΘΕΜΑ Β Β1. Σελ. 120 σχολ. βιβλίου: «Για την επιλογή οργάνων

Διαβάστε περισσότερα

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης

Κριτήριο Αξιολόγησης Βιολογίας. Γ Λυκείου. Θετικής Κατεύθυνσης Κριτήριο Αξιολόγησης Βιολογίας Γ Λυκείου Θετικής Κατεύθυνσης Απαντήσεις Θέμα Α. Α.1 β Α.2 δ Α.3 β Α.4 γ Α.5 α Θέμα Β Β.1. σελ. 35 σχολ. βιβλίου: «Ο γενετικός κώδικας...συνώνυμα» και σελ. 91 Η αλλαγή μιας

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ κεφ. 5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2

Γ ΛΥΚΕΙΟΥ κεφ. 5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2 Γ ΛΥΚΕΙΟΥ κεφ. 5 ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Μάθημα 1,2 O Mendel στο Brno (Τσεχία) Τον αναγνωρίζετε; Το μοναστήρι σήμερα Οι κήποι σήμερα Το μοσχομπίζελο Η επιτυχία των πειραμάτων του Μέντελ 1. χωριστά η

Διαβάστε περισσότερα

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.»

B.3 Σχολικό βιβλίο, σελίδες : «Θεραπευτικά. χημειοθεραπείας.» 23 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1 γ Α.2 β Α.3 β Α.4 δ Α.5 α ΘΕΜΑ Β B.1 Σχολικό βιβλίο, σελίδα 34: «Η αλληλουχία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

Δασική Γενετική Τα πειράματα του Mendel

Δασική Γενετική Τα πειράματα του Mendel Δασική Γενετική Τα πειράματα του Mendel Χειμερινό εξάμηνο 2014-2015 Παράδοξο... Οι απόγονοι μοιάζουν στους γονείς τους Δεν είναι όμως ακριβώς ίδιοι, ούτε με τους γονείς τους, ούτε μεταξύ τους Κληρονομικότητα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015

Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Απαντήσεις στα θέματα βιολογίας θετικής κατεύθυνσης 2015 Θέμα Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ Θέμα Β Β1. 1. Α 2. Β 3. Β 4. Α 5. Α 6. Α 7. Β 8. Β Β2. Το σύμπλοκο που δημιουργείται μετά την πρόσδεση του

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα