Microarrays. Γρηγόρης Αµούτζιας

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Microarrays. Γρηγόρης Αµούτζιας"

Transcript

1 Microarrays Γρηγόρης Αµούτζιας

2 Microarrays Chips ή αντικειµενοφόροι πλάκες που µετράνε την γονιδιακή έκφραση (και όχι µόνο). Δεν µετράνε απόλυτες τιµές συγκεντρώσεων µεταγραφηµάτων. Μετράνε σχετικές αλλαγές. Για µια συνθήκη, πόσο πιο αυξηµένη ή µειωµένη είναι η έκφραση ενός γονιδίου, σε σχέση µε µια άλλη συνθήκη. Π.χ. Πόσο πιο αυξηµένη/µειωµένη είναι η έκφραση ενός γονιδίου Α µετά από άσκηση (control: αµέσως πριν την άσκηση). Δεν µπορούµε να συγκρίνουµε το γονίδιο Α µε το γονίδιο Β Στο Chip υπάρχουν για το κάθε µεταγράφηµα: cdnas ολόκληρου του µεταγραφώµατος (spotting) (PCR) ολιγοµερή (τα λεγόµενα oligo-probes), µε µήκος βάσεις. Spotting In situ synthesis

3 Σχετικές διαφορές relative measurement 2 COLORS (Cy5 / Cy3) absolute measurement 1 COLOR ( Cy3 )

4 Σχετικές διαφορές intensity Highly expressed genes, highly differentially expressed Low expressed, genes slightly differentially expressed gene a gene b gene c

5 Όλιγο-Μικροσυστοιχίες (oligo-microarrays) Chip στο οποίο υπάρχουν DNA ολιγοµερή (τα λεγόµενα probes), µε µήκος βάσεις που αντιπροσωπεύουν το γονιδίωµα ενός οργανισµού. Περισσότερα από ένα διαφορετικά probes µπορεί να υπάρχουν για ένα γονίδιο. Πάνω σε αυτά τα probes υβριδίζονται τα συµπληρωµατικά τους cdnas. Το κάθε cdna είναι συνδεδεµένο µε φθορίζουσα χρωστική. Κάθε κηλίδα (spot) στο chip αντιστοιχεί σε ένα συγκεκριµµένο είδος probes. Η ένταση της φθορίζουσας χρωστικής υποδηλώνει την ένταση µε την οποία εκφράζεται το mrna για τον αντίστοιχο probe.

6 Τι µπορούν να ελέγξουν Έκφραση mrna. Έκφραση micro-rna. CGH (comparative genomic hybridization). SNPs. DNA µεθυλίωση. ChIP-on-chip.

7 CGH Comparative genome hybridization. Βλέπει αν µια γενωµική περιοχή σε ένα δείγµα έχει πολλαπλασιαστεί ή χαθεί σε σχέση µε ένα control.

8 Τα βήµατα

9 Μικροσυστοιχίες (microarrays) Με δύο χρώµατα (πράσινο/κόκκινο) Το ένα χρώµα είναι για µια συγκεκριµµένη συνθήκη και το άλλο χρώµα για µια άλλη (συνήθως control). Εξάγεται το ολικό RNA για την κάθε συνθήκη. Ελέγχεται η ποσότητα και ποιότητα του RNA. Γίνεται σήµανση του κάθε δείγµατος RNA µε συγκεκριµµένη χρωστική (π.χ. Cy5:red - Cy3:green). Τα 2 δείγµατα αναµιγνύονται και το µίγµα υπόκειται σε υβριδισµό πάνω στο chip. Μετριέται η ένταση της κάθε µιας από τις 2 χρωστικές, για κάθε κηλίδα. Υπολογίζεται ο λόγος των εντάσεων των 2 χρωστικών, στην κάθε κηλίδα.

10 Μικροσυστοιχίες

11 Μικροσυστοιχίες (microarrays) Αν το γονίδιο εκφράζεται περισσότερο στην Α συνθήκη (κόκκινη χρωστική) από ότι στην control (πράσινη χρωστική), τότε ο λόγος συνθήκη_α/control (κόκκινη/πράσινη) θα είναι λ>1, αλλιώς σε αντίθετη περίπτωση 0<λ<1. Αν το γονίδιο εκφράζεται µε διπλάσια ένταση στην συνθήκη Α, σε σχέση µε την συνθήκη control, τότε ο λόγος θα είναι λ=2. Αν το γονίδιο εκφράζεται µε τη µισή ένταση στην συνθήκη Α, σε σχέση µε την συνθήκη control, τότε ο λόγος θα είναι λ=0.5. Μετατρέποντας τους λόγους σε log 2, έχουµε: λ=2 -> log 2 λ=1 λ=0.5 -> log 2 λ=-1 Με την κανονικοποίηση σε log 2 τα δεδοµένα γίνονται συµµετρικά.

12 Μικροσυστοιχίες (microarrays) Πότε θεωρούµε ότι ένα γονίδιο υπερ/υπό-εκφράζεται σε µια συγκεκριµµένη συνθήκη. Log 2 λ > 1 ή Log 2 λ < -1 (διπλάσια/υποδιπλάσια έκφραση σε σχέση µε τη συνθήκη control). Με στατιστικές µεθόδους (t-test, ANOVA).

13 microarrays Κατανοµή των σηµάτων. Μετατροπή - κανονικοποίηση των σηµάτων.

14 Οµαδοποίηση γονιδίων µε την ίδια συµπεριφορά. Χρειαζόµαστε αρκετά σηµεία (διαφορετικές συνθήκες ή χρονικές στιγµές) Με µεθόδους αποστάσεων, όπου οι µετρήσεις ενός γονιδίου για; διαφορετικές συνθήκες αποτελούν ένα διάνυσµα. Υπολογίζουµε αποστάσεις µεταξύ διαφορετικών διανυσµάτων (γονιδίων). Ευκλείδια απόσταση Συντελεστής συσχέτισης Pearson (Pearson correlation coefficient). Δηµιουργείται πίνακας αποστάσεων µεταξύ των γονιδίων. Το αντίστοιχο µπορεί να γίνει και για να οµαδοποιήσουµε κοινές συνθήκες.

15 Μικροσυστοιχίες

16 Μήκος των probes Affymetrix: 25mer Agilent: 60mer Illumina: 50mer Όσο µεγαλύτερο το probe, τόσο πιο ευαίσθητο (µπορεί να ανιχνεύσει targets σε µικρότερες συγκεντρώσεις). Όµως, µεγαλύτερο probe µπορεί και να ανεχτεί περισσότερους πολυµορφισµούς (ή mismatches).

17 Υβριδισµός των probes

18 Probes & chips

19 Σχεδιασµός των probes Θα πρέπει η ακολουθία τους να είναι µοναδική ώστε να αντικατοπτρίζει την έκφραση για το γονίδιο που σχεδιάστηκαν. Όλοι οι probes θα πρέπει να έχουν παρόµοια Tm (βέλτιστη θερµοκρασία υβριδισµού). Τα probes δεν θα πρέπει να σχηµατίζουν δευτεροταγείς δοµές που τα εµποδίζουν να υβριδιστούν µε τον στόχο.

20 spots

21 Array Spotting Με βελόνες (pins) (απώθεση έτοιµων cdnas ή oligos ). Με inkjet (Agilent: spin-off της Hewlett-Packard) (in situ synthesized oligos)

22 spotting pin quality decline after delivery of 5x105 spots after delivery of 3x105 spots H. Sueltmann DKFZ/MGA

23 Inkjet printing - Agilent

24 Agilent phosphoramidite chemistry

25 Φωτολιθογραφία - Affymetrix Youtube: Affymetrix: nloads/student_manual_activities/activity3/activity3_manufacturing_bac kground.pdf

26 Φωτολιθογραφία

27 Φωτολιθογραφία

28 Φωτολιθογραφία

29 Φωτολιθογραφία

30 Φωτολιθογραφία

31 Feature

32 Agilent chips

33 Agilent chips 244k 1M k 400k 44k 180k 15k 60k LEGACY HD

34 Agilent platform Φούρνος υβριδισµού Laser Scanner

35 Affymetrix Arrays/strips/plates

36 Affymetrix platform

37 Affymetrix platforms

38 Έλεγχος Ποσότητας/Ποιότητας ολικού RNA Nanodrop (φωτόµετρο που χρησιµοποιεί ελάχιστο όγκο δείγµατος - 1λ) για ακριβής ποσοστικοποίηση. A260 nm -> νουκλεοτίδια, RNA, ssdna, dsdna A280 nm -> πρωτεΐνες, φαινόλες κ.α. A230 nm -> EDTA, φαινόλες, υδατάνθρακες. Α260/Α280 nm ~ /230 nm ~ 2-2.2

39 Έλεγχος Ποσότητας/Ποιότητας ολικού RNA Agilent 2100 Bioanalyzer για έλεγχο ποιότητας του RNA (τυχόν αποδόµιση). (~ ) Ηλεκτροφόρηση σε τριχοειδή Λόγος 28S/18S rrna 2:1 RNA integrity number (RIN)

40 Έλεγχος Ποσότητας/Ποιότητας ολικού RNA

41 Χηµικές αντιδράσεις

42 Υβριδισµός Όλα τα probes υβριδίζονται στην ίδια θερµοκρασία. Όµως, όλα τα probes δεν έχουν την ίδια βέλτιστη θερµοκρασία υβριδισµού. Άρα, υπάρχουν προβλήµατα για επιµέρους probes Φούρνος υβριδισµού του Affymetrix GeneAtlas

43 Υβριδισµός

44 Laser scanning Agilent autofocus

45 Μέτρηση σήµατος στα spots

46 Συνένωση των σηµάτων

47 Ποιότητα των spots

48 Ανάλυση προβληµατικών Spots

49 Υπολογισµός & αφαίρεση θορύβου υποβάθρου

50 Παράγοντες που επηρεάζουν τα microarrays Περιβαλλοντικοί Όζον Υγρασία Υπεριώδης ακτινοβολία Στατικός ηλεκτρισµός Μόλυνση της ατµόσφαιρας (οξειδωτικοί παράγοντες). Σκόνη (µπορεί να επηρεάσει τις µετρήσεις του Laser) Πούδρα από τα γάντια. Ενδογενείς Πρόβληµα σε κάποιο βήµα των χηµικών αντιδράσεων. Ο τύπος του ιστού. Dye swap για να αποκλείσουµε παράγοντες που πιθανών επηρεάσαν το πείραµα

51 Microarrays & Ozone Η χρωστική Cy5(red) είναι συνήθως πιο ασταθής σε σχέση µε τη χρωστική Cy3(green). Το όζον µπορεί να προκαλέσει περισσότερη αστάθεια της Cy5. Σε ένα πείραµα που το control χρωµατίστηκε µε Cy5 και το δείγµα µε Cy3, αν υποθέσουµε ότι το όζον προκάλεσε την αποδόµιση του Cy5, τότε περιµένουµε να δούµε (από λάθος) τα γονίδια του δείγµατος να: A) υπερεκφράζονται σε σχέση µε το control? B) υποεκφράζονται σε σχέση µε το control?

52 Microarrays & ozone

53 Microarrays & ozone

54 Ανάλυση δεδοµένων

55 Μετατροπή έντασης σήµατος σε log 2

56 Μετατροπή έντασης σήµατος σε log 2

57 Μετατροπή έντασης σήµατος σε log 2

58 Microarray Quality control

59 Οντολογίες Ελεγχόµενο λεξιλόγιο για την περιγραφή των ιδιοτήτων των γονιδίων και των πρωτεϊνών. Περιγράφουν: Μοριακές λειτουργίες του βιοµορίου (1 ή περισσότερες). Βιολογικές διαδικασίες στις οποίες εµπλέκεται το βιοµόριο (1 ή περισσότερες). Κυτταρικό διαµέρισµα στο οποίο συναντάται το βιοµόριο (1 ή περισσότερα).

60 Οντολογίες: Η δοµή τους Δείχνει τις σχέσεις µεταξύ των διαφορετικών όρων. Ένας όρος µπορεί να αποτελεί πιο εξειδικευµένη περιγραφή ενός άλλου όρου. Είναι κατευθυνόµενα ακυκλικά γραφήµατα (DAG). Παρόµοια µε ιεραρχίες. Η διαφορά είναι ότι ένας κόµβος-απόγονος µπορεί να έχει περισσότερους από έναν προγόνους.

61 Οντολογίες: Η δοµή τους Θεωρούµε ότι αν σε ένα βιοµόριο αντιστοιχεί ένα όρος-οντολογία, τότε σε αυτό το βιοµόριο ανήκουν και όλοι οι πρόγονοι του όρου-οντολογίας.

62 Οντολογίες: στατιστική ανάλυση Παράδειγµα: 1 γονιδίωµα µε γονίδια γονίδια εµπλέκονται στον κυτταρικό κύκλο (GO_term: cell-cycle). (10% του γονιδιώµατος). Αν επιλέξουµε τυχαία έναν αριθµό Χ γονιδίων, θα περιµέναµε (από τύχη) περίπου το 10% (µε κάποιες διακυµάνσεις) να έχουν τον όρο κυτταρικός κύκλος. Η τυχαία διακύµανση εξαρτάται από τον αριθµό των γονιδίων. Έστω ότι µε τα microarrays σε ένα πείραµα βρήκαµε ότι Χ αριθµός γονιδίων υπερεκφράζονται. Σε αυτό τον Χ αριθµό, βρήκαµε ότι 20% των γονιδίων ανήκουν στον κυτταρικό κύκλο. Αυτή η απόκλιση (20% παρατηρούµενο - 10% αναµενόµενο) είναι στα όρια των τυχαίων διακυµάνσεων, ή είναι στατιστικά σηµαντική? Στατιστικά σηµαντική, σηµαίνει ότι τα υπερεκφρασµένα γονίδια είναι εµπλουτισµένα για την κατηγορία κυτταρικός κύκλος. Δηλαδή, ο κυτταρικός κύκλος εµπλέκεται στην διαδικασία που µελετάµε.

63 Οντολογίες: στατιστική ανάλυση Η στατιστική ανάλυση γίνεται µε το υπεργεωµετρικό τεστ. Παίρνουµε ένα p-value. Αν p-value < 0.05, τότε είναι στατιστικά σηµαντικό. Αν στις οντολογίες µας είχαµε 100 όρους, θα επαναλαµβάναµε τα παραπάνω τεστς για τον κάθε όρο. Όµως, όσο περισσότερα τεστ κάνουµε για το πείραµά µας, τόσο αυξάνει ή πιθανότητα να βρούµε κάτι στατιστικά σηµαντικό (p-value < 0.05) καθαρά από λάθος. Άρα, πρέπει να λάβουµε υπόψην µας πόσα τεστ διενεργούµε και να διορθώσουµε τα p-values (multiple testing correction). False discovery rate (Benjamini-Hochberger) Bonferroni correction

64 Micro-RNAs Μικρά RNAs που ρυθµίζουν (κυρίως καταστέλουν) την µεταγραφή των mrnas Αποδόµιση του mrna. Αναστολή της µεταγραφής του mrna. Μέγεθος ~ 22 nt. ~1000 στον άνθρωπο. Ρυθµίζουν πολλά mrnas (30%-100%). Ένα mi-rna -> στοχεύει πολλά mrnas. Πολλά mi-rnas -> στοχεύουν το ίδιο mrna (hunting pack). Έχουν εξειδικευµένο προφίλ έκφρασης για τον κάθε ιστό (και καρκίνο) (συνήθως σχετίζονται µε συγκεκριµένες αναπτυξιακές διαδικασίες). Μπορούν να λειτουργήσουν ως διαγνωστικοί ή προγνωστικοί µοριακοί δείκτες.

65 Toxicology Applications

66 Τοξική δράση acetaminophen Έλεγχος µε microarrays αν τα mi-rna µπορούν να καταδείξουν την ηπατική καταστροφή µετά από χορήγηση φαρµάκου (acetaminophen overdose). Σε κατάσταση υπερχορήγησης, τα µεταβολικά µονοπάτια που καταβολίζουν το φάρµακο είναι σε κορεσµό. Το πλεονάζον φάρµακο υπόκειται σε καταβολισµό από ένζυµα των P450 -> NAPQI (N-acetyl-p-benzoquinone imine) (τοξικό). NAPQI εξουδετερώνεται από ενδοκυτταρική γλουταθιόνη (GSH). Ότι NAPQI περισσεύει, προκαλεί ηπατική καταστροφή. Σε περίπτωση υπερβολικής δόσης acetaminophen (-> υπερβολικό NAPQI), χορηγούµε N-acetylcysteine (NAC) -> ενδοκυτταρικό GSH.

67 Μέτρηση της τοξικής δράσης του acetaminophen Η τοξικότητα δεν εµφανίζεται αµέσως. Χρειάζεται γρήγορη και αξιόπιστη µέτρηση της τοξικότητας µε αιµατολογικό έλεγχο (ορό). Μέτρηση της αµινοτρανσφεράσης του ορού (κλασσική µέθοδος). Βρήκαν mi-rnas που εκφράζονται σηµαντικά στο ήπαρ. Παρακολουθήσαν την έκφρασή τους στο ήπαρ µετά τη χορήγηση acetaminophen και επίσης παρακολούθησαν την ανίχνευσή τους στον ορό (λόγω πιθανής ηπατικής κυτταρικής καταστροφής).

68 Toxicology Applications Selected mirna shows opposite changes between liver and plasma samples based on microarray results. Wang K et al. PNAS 2009;106:

69 Τα mi-rnas αποδείχθηκαν πιο αξιόπιστοι και πιο γρήγοροι δείκτες ηπατικής καταστροφής Wang K et al. PNAS 2009;106:

DNA MICROARRAYS. Σελίδα 1 ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Τ. Θηραίου

DNA MICROARRAYS. Σελίδα 1 ΒΙΟΠΛΗΡΟΦΟΡΙΚΗ. Τ. Θηραίου DNA MICROARRAYS Σελίδα 1 Μελέτη του γονιδιώματος Ποια είναι τα γονίδια και που βρίσκονται; Ποιοι μηχανισμοί ρυθμίζουν την έκφραση κάθε γονιδίου; Σε τι επίπεδα εκφράζονται τα γονίδια υπό διαφορετικές συνθήκες;

Διαβάστε περισσότερα

Λειτουργική γονιδιωµατική ΜΠΣ2. Γρ. Αµούτζιας

Λειτουργική γονιδιωµατική ΜΠΣ2. Γρ. Αµούτζιας Λειτουργική γονιδιωµατική ΜΠΣ2 Γρ. Αµούτζιας Λειτ. Γονιδιωµατική Λειτουργική γονιδιωµατική: Τι είναι Προσπαθεί να κατανοήσει τις λειτουργίες των βιολογικών µορίων, σε επίπεδο ολόκληρου του γονιδιώµατος.

Διαβάστε περισσότερα

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA Microarrays Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA όμως του οργανισμού είναι μια στατική πληροφορία

Διαβάστε περισσότερα

Βιοπληροφορική II. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015

Βιοπληροφορική II. Παντελής Μπάγκος Αναπληρωτής Καθηγητής. Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 Βιοπληροφορική II Παντελής Μπάγκος Αναπληρωτής Καθηγητής Πανεπιστήμιο Θεσσαλίας Λαμία, 2015 Μικροσυστοιχίες Γυάλινο πλακίδιο που αποτελείται από συγκεκριμένες αλληλουχίες οι οποίες είναι ειδικές για συγκεκριμένα

Διαβάστε περισσότερα

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ DNA μικροσυστοιχίες: βήμα προς βήμα Παραγωγή DNA ανιχνευτών Οι επιστήμονες μπορούν να παράγουν «σπιτικές» μικροσυστοιχίες χρησιμοποιώντας την αλυσιδωτή

Διαβάστε περισσότερα

Μέθοδοι Φυλογένεσης. Μέθοδοι που βασίζονται σε αποστάσεις UPGMA Κοντινότερης γειτονίας (Neighbor joining) Fitch-Margoliash Ελάχιστης εξέλιξης

Μέθοδοι Φυλογένεσης. Μέθοδοι που βασίζονται σε αποστάσεις UPGMA Κοντινότερης γειτονίας (Neighbor joining) Fitch-Margoliash Ελάχιστης εξέλιξης Μέθοδοι Φυλογένεσης Μέθοδοι που βασίζονται σε αποστάσεις UPGMA Κοντινότερης γειτονίας (Neighbor joining) Fitch-Margoliash Ελάχιστης εξέλιξης Μέθοδοι που βασίζονται σε χαρακτήρες Μέγιστη φειδωλότητα (Maximum

Διαβάστε περισσότερα

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος δεν υπάρχει σύγκρουση συµφερόντων Ø Ποιό HPV τεστ είναι το

Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

ιπλωµατική Εργασία ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ Αξιολόγηση των µεθόδων επιλογής γονιδίων. ΤΜΗΜΑ Η.Μ.Μ.Υ. ΤΟΜΕΑΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ Χατζηµαρκάκης Εµµανουήλ

ιπλωµατική Εργασία ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ Αξιολόγηση των µεθόδων επιλογής γονιδίων. ΤΜΗΜΑ Η.Μ.Μ.Υ. ΤΟΜΕΑΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ Χατζηµαρκάκης Εµµανουήλ ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ Η.Μ.Μ.Υ. ΤΟΜΕΑΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ ιπλωµατική Εργασία Αξιολόγηση των µεθόδων επιλογής γονιδίων. Χατζηµαρκάκης Εµµανουήλ Εξεταστική Επιτροπή: Καθηγητής Ζερβάκης Μιχαήλ (Επιβλέπων)

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ)

ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ ΓΕΝΕΤΙΚΗ ΤΟΥ ΑΝΘΡΩΠΟΥ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ ΓΕΝΕΤΙΚΗ ΤΟΥ ΑΝΘΡΩΠΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ ΓΕΝΕΤΙΚΗ ΤΟΥ ΑΝΘΡΩΠΟΥ Το Τμήμα Ιατρικής του Πανεπιστημίου Θεσσαλίας ανακοινώνει τη λειτουργία Προγράμματος Μεταπτυχιακών Σπουδών με

Διαβάστε περισσότερα

Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος

Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος Χρήση μικροσυστοιχιών DNA για την ανάλυση του μεταγραφικού προφίλ γενετικά τροποποιημένων εμβρυικών ινοβλαστών ποντικού. Πάτρα

Διαβάστε περισσότερα

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Σ. Κυρτόπουλος Ινστιτούτο Βιολογικών Ερευνών & Βιοτεχνολογίας Εθνικό Ίδρυμα Ερευνών Συμβολή περιβαλλοντικών

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Βιολογία Γενικής Παιδείας Β Λυκείου

Βιολογία Γενικής Παιδείας Β Λυκείου Απρίλιος Μάιος 12 Βιολογία Γενικής Παιδείας Β Λυκείου Βιολογία Γενικής Παιδείας Β Λυκείου (Ερωτήσεις που παρουσιάζουν ενδιαφέρον) 1. Τι είναι τα βιομόρια και ποια είναι τα βασικά χαρακτηριστικά τους; Βιομόρια

Διαβάστε περισσότερα

Γονίδια και καρκινογένεση

Γονίδια και καρκινογένεση Γονίδια και καρκινογένεση Σύνολο 40.000 γονίδια Υπό έλεγχο Φυσιολογική ανάπτυξη Εκτός ελέγχου Καρκινογένεση Αποτελεί μια μη ισοτοπική τεχνική μοριακού υβριδισμού Επιτρέπει τη διατήρηση της ιστικής, κυτταρικής

Διαβάστε περισσότερα

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ

σύγχρονο προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. & Group µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ σύγχρονο Φάσµα & Group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 210 50 51 557 210 50 56 296 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 210 50 20 990 210 50 27 990 25ης Μαρτίου 74 ΠΕΤΡΟΥΠΟΛΗ

Διαβάστε περισσότερα

Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου. Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο

Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου. Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο Ερώτημα Ποια είναι η αντίδραση της καρδιάς μυοκαρδίου στα επιγεννετικά

Διαβάστε περισσότερα

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ

ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 04/09/2016 ΘΕΜΑ Α Α.1. β. Α.2. β. Α.3. γ. Α.4. δ. ΑΠΑΝΤΗΣΕΙΣ Α.5. β. Μονάδες 25 ΘΕΜΑ Β Β. 1. Ιχνηθέτηση. είναι η σήμανση χημικών

Διαβάστε περισσότερα

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ

Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Τρίτη, 27 Μαΐου 2008 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη

Διαβάστε περισσότερα

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη Ατυπία Υπερπλασία- Δυσπλασία Κίττυ Παυλάκη Jeanne Calment Κάπνιζε µέχρι τα 117 Πέθανε στα 122 Η σωστή λειτουργία των οργανισµών απαιτεί τη δυνατότητα προσαρµογής των κυττάρων και κατά συνέπεια και των

Διαβάστε περισσότερα

ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ. Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ

ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ. Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ Πτυχιακή εργασία του σπουδαστή Αθανάσιου Καραφλού Καλαμάτα, Μάιος 2008 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος. Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας

ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος. Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας H.M. Παράγοντες κινδύνου καρκινώματος τραχήλου Ηλικία κατά την πρώτη

Διαβάστε περισσότερα

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων.

Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Αθήνα, 27/05/2016 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Εσπερινών Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA

Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Κ Ε Φ Α Λ Α Ι Ο 25 : Το καταλυτικό RNA Εικόνα 25.1 Το αυτο-µάτισµα του πρώιµου rrna 35S της Tetrahymena thermophila µπορεί να µελετηθεί µε ηλεκτροφόρηση σε πήκτωµα. Το αποδεσµευµένο ιντρόνιο σχηµατίζει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Κεφάλαιο 13. Εισαγωγή στην. Η Ανάλυση ιακύµανσης

Κεφάλαιο 13. Εισαγωγή στην. Η Ανάλυση ιακύµανσης Κεφάλαιο 13 Εισαγωγή στην Ανάλυση ιακύµανσης 1 Η Ανάλυση ιακύµανσης Από τα πιο συχνά χρησιµοποιούµενα στατιστικά κριτήρια στην κοινωνική έρευνα Γιατί; 1. Ενώ αναφέρεται σε διαφορές µέσων όρων, όπως και

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 3 ο ΚΕΦΑΛΑΙΟ «ΜΕΤΑΒΟΛΙΣΜΟΣ» ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ. 1. Να ορίσετε την έννοια της Βιοενεργητικής.

ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 3 ο ΚΕΦΑΛΑΙΟ «ΜΕΤΑΒΟΛΙΣΜΟΣ» ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ. 1. Να ορίσετε την έννοια της Βιοενεργητικής. ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΦΥΛΛΟ ΕΡΓΑΣΙΑΣ ΣΤΟ 3 ο ΚΕΦΑΛΑΙΟ «ΜΕΤΑΒΟΛΙΣΜΟΣ» Α. ΔΡΑΣΤΗΡΙΟΤΗΤΕΣ ΜΕΣΑ ΣΤΗΝ ΤΑΞΗ 1. Να ορίσετε την έννοια της Βιοενεργητικής. 2. Πώς οι αυτότροφοι οργανισμοί εξασφαλίζουν την τροφή

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα

Μελέτη στην ανάλυση οµάδων και εφαρµογή σε δεδοµένα γονιδιακής έκφρασης καρκίνου από µικροσυστοιχίες

Μελέτη στην ανάλυση οµάδων και εφαρµογή σε δεδοµένα γονιδιακής έκφρασης καρκίνου από µικροσυστοιχίες Μελέτη στην ανάλυση οµάδων και εφαρµογή σε δεδοµένα γονιδιακής έκφρασης καρκίνου από µικροσυστοιχίες Ιωάννης Αγ. Μαραζιώτης Εποπτεία: Καθ. Αναστάσιος Μπεζεριάνος Βιοπληροφορική Βιολογικά δεδοµένα + Υπολογιστικές

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

Στοίχιση κατά ζεύγη. Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment)

Στοίχιση κατά ζεύγη. Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) Στοίχιση ακολουθιών κατά ζεύγη (Pairwise alignment) Στοίχιση κατά ζεύγη: Τι είναι Αντιστοίχιση των νουκλεοτιδίων/αµινοξέων δυο ακολουθιών, ώστε να εντοπιστούν οι οµοιότητες και οι διαφορές τους. Χρησιµοποιείται

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΑ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΧΡΗΣΗ ΟΖΟΝΤΟΣ ΣΤΗΝ ΚΑΤΕΡΓΑΣΙΑ ΤΟΥ ΝΕΡΟΥ ΣΕ ΠΥΡΓΟΥΣ ΨΥΞΗΣ

ΤΕΧΝΟΛΟΓΙΑ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΧΡΗΣΗ ΟΖΟΝΤΟΣ ΣΤΗΝ ΚΑΤΕΡΓΑΣΙΑ ΤΟΥ ΝΕΡΟΥ ΣΕ ΠΥΡΓΟΥΣ ΨΥΞΗΣ ΧΡΗΣΗ ΟΖΟΝΤΟΣ ΣΤΗΝ ΚΑΤΕΡΓΑΣΙΑ ΤΟΥ ΝΕΡΟΥ ΣΕ ΠΥΡΓΟΥΣ ΨΥΞΗΣ Η χρήση του όζοντος για την κατεργασία νερού σε πύργους ψύξης αυξάνει σηµαντικά τα τελευταία χρόνια και αρκετές έρευνες και εφαρµογές που έχουν

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο

Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο Σ. Κυρτόπουλος, Εργαστήριο Χηµικής Καρκινογένεσης και Γενετικής Τοξικολογίας, Ινστιτούτο

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

) = a ο αριθµός των µηχανών n ο αριθµός των δειγµάτων που παίρνω από κάθε µηχανή

) = a ο αριθµός των µηχανών n ο αριθµός των δειγµάτων που παίρνω από κάθε µηχανή Ανάλυση Συνδιακύµανσης Alsis of Covrice Η ανάλυση συνδιακύµανσης είναι µία άλλη τεχνική για να βελτιώσουµε την ακρίβεια της προσέγγισης του µοντέλου µας στο πείραµα. Ας υποθέσουµε ότι σ ένα πείραµα εκτός

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Κεφάλαιο 14. Ανάλυση ιακύµανσης Μονής Κατεύθυνσης. Ανάλυση ιακύµανσης Μονής Κατεύθυνσης

Κεφάλαιο 14. Ανάλυση ιακύµανσης Μονής Κατεύθυνσης. Ανάλυση ιακύµανσης Μονής Κατεύθυνσης Κεφάλαιο 14 Ανάλυση ιακύµανσης Μονής Κατεύθυνσης 1 Ανάλυση ιακύµανσης Μονής Κατεύθυνσης Παραµετρικό στατιστικό κριτήριο για τη µελέτη της επίδρασης µιας ανεξάρτητης µεταβλητής στην εξαρτηµένη Λογική παρόµοια

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

Εργασία για το μάθημα της Βιολογίας. Περίληψη πάνω στο κεφάλαιο 3 του σχολικού βιβλίου

Εργασία για το μάθημα της Βιολογίας. Περίληψη πάνω στο κεφάλαιο 3 του σχολικού βιβλίου Εργασία για το μάθημα της Βιολογίας Περίληψη πάνω στο κεφάλαιο 3 του σχολικού βιβλίου Στο 3 ο κεφάλαιο του βιβλίου η συγγραφική ομάδα πραγματεύεται την ενέργεια και την σχέση που έχει αυτή με τους οργανισμούς

Διαβάστε περισσότερα

Ακρότατα υπό συνθήκη και οι πολλαπλασιαστές του Lagrange

Ακρότατα υπό συνθήκη και οι πολλαπλασιαστές του Lagrange 64 Ακρότατα υπό συνθήκη και οι πολλαπλασιαστές του Lagrage Ας υποθέσουµε ότι ένας δεδοµένος χώρος θερµαίνεται και η θερµοκρασία στο σηµείο,, Τ, y, z Ας υποθέσουµε ότι ( y z ) αυτού του χώρου δίδεται από

Διαβάστε περισσότερα

Α. Βιοϊατρικός Κύκλος

Α. Βιοϊατρικός Κύκλος ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΤΗΣ ΓΝΩΣΗΣ ΑΠΟΦΟΙΤΩΝ ΑΝΩΤΕΡΩΝ ΕΚΠΑΙ ΕΥΤΙΚΩΝ Ι ΡΥΜΑΤΩΝ ΣΕ ΣΥΓΧΡΟΝΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΙΣ ΒΙΟΕΠΙΣΤΗΜΕΣ Περιεχόµενο Προγράµµατος (µαθήµατα, ώρες κλπ): Το Πρόγραµµα Σπουδών διαχωρίζεται σε δύο Κύκλους

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 18 ΜΑΙΟΥ 2011 ΘΕΜΑ Α Α1. α Α2. δ Α3. γ Α4. β Α5. β ΘΕΜΑ Β Β1. σελ.13: Το 1928 ο Griffith πως γίνεται αυτό. Β2. σελ.101: Τέλος, βλάβες στους επιδιορθωτικά

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΖΗΤΗΜΑ 1 Ο 1. δ 2. δ 3. δ 4. β 5. δ ΖΗΤΗΜΑ 2 Ο 1. Σχολ. βιβλ. σελ. 41-42 : «Η ρύθµιση της έκφρασης των γονιδίων στα ευκαρυωτικά κύτταρα.µπορεί να υποστεί τροποποιήσεις

Διαβάστε περισσότερα

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016 Ε Λ Λ Η Ν Ι Κ Η ΗΜΟΚΡΑΤΙΑ ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Θ Ρ Α Κ Η Σ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ 6 Ο χλµ AΛΕΞ/ΠΟΛΗΣ-ΜΑΚΡΗΣ 68100 ΑΛΕΞΑΝ ΡΟΥΠΟΛΗ Τ Μ Η ΜΑ Ι Α Τ Ρ Ι Κ Η Σ Γ Ρ Α Μ Μ Α Τ Ε Ι Α H E L L E N I C R E P U B L I

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 5 ΙΟΥΝΙΟΥ 2001 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ 1 ο Α. Σωστό το γ ιότι ο φαινότυπος που εµφανίζεται στους απογόνους

Διαβάστε περισσότερα

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες IΣTOΛOΓIA H ιστολογία κλάδος της ιατρικής που µελετά > υφή βιολογικού υλικού και τους τρόπους που τα επιµέρους συστατικά στοιχεία σχετίζονται µεταξύ τους δοµικά & λειτουργικά Tα δείγµατα του βιολογικού

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΣΤΑΤΙΣΤΙΚΗ ΕΠΕΞΕΡΓΑΣΙΑ ΓΙΑ ΤΗΝ ΑΠΟΤΙΜΗΣΗ ΤΩΝ ΑΠΟΤΕΛΕΣΜΑΤΩΝ

ΣΤΑΤΙΣΤΙΚΗ ΕΠΕΞΕΡΓΑΣΙΑ ΓΙΑ ΤΗΝ ΑΠΟΤΙΜΗΣΗ ΤΩΝ ΑΠΟΤΕΛΕΣΜΑΤΩΝ ΣΤΑΤΙΣΤΙΚΗ ΕΠΕΞΕΡΓΑΣΙΑ ΓΙΑ ΤΗΝ ΑΠΟΤΙΜΗΣΗ ΤΩΝ ΑΠΟΤΕΛΕΣΜΑΤΩΝ Στατιστική ανάλυση του γεωχηµικού δείγµατος µας δίνει πληροφορίες για τον γεωχηµικό πληθυσµό που µελετάµε. Συνυπολογισµός σφαλµάτων Πειραµατικά

Διαβάστε περισσότερα

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων ΑΝΑΚΟΙΝΩΣΗ Από το Τμήμα Ιατρικής ανακοινώνεται ότι για το ακαδημαϊκό έτος 2014-2015 στο Τμήμα Ιατρικής κατατάσσονται : Οι πτυχιούχου Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.ΣΠΑΙ.Τ.Ε., της Ελλάδος

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΠΑΡΑΣΚΕΥΗ 27 ΜΑΪΟΥ 2016 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ 2. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ

ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ 2. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΕΝΟΤΗΤΕΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ (One-Way Analyss of Varance) Η ανάλυση

Διαβάστε περισσότερα

Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R

Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R, Επίκουρος Καθηγητής, Τοµέας Μαθηµατικών, Σχολή Εφαρµοσµένων Μαθηµατικών και Φυσικών Επιστηµών, Εθνικό Μετσόβιο Πολυτεχνείο. Περιεχόµενα Εισαγωγή στη

Διαβάστε περισσότερα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα

ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα Εργασία στη Βιολογία ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Περετσή Χριστίνα Πιτσικάλη Παναγιώτα ΜΕΤΑΓΡΑΦΗ ΤΟΥ DNA Η ροή της πληροφορίας για το σχηματισμό των πρωτεϊνών, προϋποθέτει τη μεταφορά της από το DNA στο RNA (ΜΕΤΑΓΡΑΦΗ).

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

Στατιστικό κριτήριο χ 2

Στατιστικό κριτήριο χ 2 18 Μεθοδολογία Επιστηµονικής Έρευνας & Στατιστική Στατιστικό κριτήριο χ 2 Ο υπολογισµός του κριτηρίου χ 2 γίνεται µέσω του µενού [Statistics => Summarize => Crosstabs...]. Κατά τη συγκεκριµένη διαδικασία

Διαβάστε περισσότερα

Ελεύθερες ρίζες και αντιοξειδωτικά

Ελεύθερες ρίζες και αντιοξειδωτικά Ελεύθερες ρίζες και αντιοξειδωτικά Κατά τη διάρκεια των φυσιολογικών ανθρώπινων διεργασιών παραγωγή ενέργειας, αποτοξίνωση από τοξικές ουσίες και ανοσολογική απόκριση, παράγονται από τον οργανισµό ελεύθερες

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΥΨΗΛΗΣ ΑΝΑΛΥΣΗΣ ΟΡΓΑΝΙΣΜΩΝ ΜΟΝΤΕΛΩΝ in vivo Δρ. Γεώργιος Μαρκόπουλος, Ph.D. Βιολόγος, Μεταδιδακτορικός Ερευνητής και Ευάγγελος Κωλέττας,

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία

Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Μέθοδοι Μοριακής Βιολογίας με Εφαρμογή στη Βακτηριολογία Γενετική Βακτηρίων Κατανόηση μηχανισμών λειτουργίας ευκαρυωτικών κυττάρων Ταξινόμηση βακτηρίων Διάγνωση λοιμωδών νοσημάτων Επιδημιολογική μελέτη

Διαβάστε περισσότερα

ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ

ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ ρ. Παναγιώτα Πέτρου Εργαστήριο Ανοσοαναλύσεων/Ανοσοαισθητήρων Ινστιτούτο Ραδιοϊσοτόπων Ραδιοδιαγνωστικών Προϊόντων ΕΚΕΦΕ «ηµόκριτος»

Διαβάστε περισσότερα

ΒΙΟΪΑΤΡΙΚΟΣ ΚΥΚΛΟΣ Πρόγραμμα Σπουδών Κατεύθυνση: Βιοδιαγνωστική

ΒΙΟΪΑΤΡΙΚΟΣ ΚΥΚΛΟΣ Πρόγραμμα Σπουδών Κατεύθυνση: Βιοδιαγνωστική ΒΙΟΪΑΤΡΙΚΟΣ ΚΥΚΛΟΣ Πρόγραμμα Σπουδών Κατεύθυνση: Βιοδιαγνωστική Μαθήματα 1. ΓΕΝΕΤΙΚΑ ΚΑΙ ΜΟΝΟΓΟΝΙΔΙΑΚΑ ΝΟΣΗΜΑΤΑ (50 ώρες 2 Πιστωτικές Μονάδες) Υπεύθυνος Μαθήματος: Καθηγητής Ζ. Σκούρας Διδάσκοντες Μαθήματος:

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΑΝΘΕΚΤΙΚΟΤΗΤΑΣ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ ΣΤΗ ΘΕΡΑΠΕΙΑ

ΜΕΛΕΤΗ ΑΝΘΕΚΤΙΚΟΤΗΤΑΣ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ ΣΤΗ ΘΕΡΑΠΕΙΑ ΕΡΕΥΝΗΤΙΚΗ ΜΟΝΑΔΑ: ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ ΥΠΕΥΘΥΝΟΣ: ΤΣΕΖΟΥ ΑΣΠΑΣΙΑ ΜΕΛΕΤΗ ΑΝΘΕΚΤΙΚΟΤΗΤΑΣ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ ΣΤΗ ΘΕΡΑΠΕΙΑ ΠΑΠΑΝΙΚΟΛΑΟΥ Βασίλης, PhD Λάρισα, 2012 ΚΑΡΚΙΝΟΣ ΜΑΣΤΟΥ Αποτελεί την πιο κοινή μορφή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA

Βιολογία Θετικής Κατεύθυνσης. 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Βιολογία Θετικής Κατεύθυνσης 4 ο Κεφάλαιο - Τεχνολογία του ανασυνδυασμένου DNA Τεχνολογία ανασυνδυασμένου DNA Αναπτύχθηκε λόγω της ανακάλυψης: i. Περιοριστικών ενδονουκλεασών ii. Ειδικών φορέων DNA Έδωσε

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

ΣΥΣΧΕΤΙΣΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΣΤΟ ΓΟΝΙ Ι0 MYD88 ΜΕ ΤΗΝ ΑΝΑΠΤΥΞΗ ΦΥΜΑΤΙΩΣΗΣ

ΣΥΣΧΕΤΙΣΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΣΤΟ ΓΟΝΙ Ι0 MYD88 ΜΕ ΤΗΝ ΑΝΑΠΤΥΞΗ ΦΥΜΑΤΙΩΣΗΣ ΣΥΣΧΕΤΙΣΗ ΓΕΝΕΤΙΚΩΝ ΠΟΛΥΜΟΡΦΙΣΜΩΝ ΣΤΟ ΓΟΝΙ Ι MYD88 ΜΕ ΤΗΝ ΑΝΑΠΤΥΞΗ ΦΥΜΑΤΙΩΣΗΣ Φωτεινή Μάλλη 1, Ειρήνη Γερογιάννη 1 Καλλιόπη Αγγέλου 1, Βίκυ Μολλάκη 2, Φωτεινή Μπαρδάκα 1, Κωνσταντίνος Ι. Γουργουλιάνης

Διαβάστε περισσότερα

3. ΕΠΙΛΥΣΗ ΓΡΑΜΜΙΚΟΥ ΑΝΤΙΣΤΡΟΦΟΥ ΠΡΟΒΛΗΜΑΤΟΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΜΗΚΩΝ

3. ΕΠΙΛΥΣΗ ΓΡΑΜΜΙΚΟΥ ΑΝΤΙΣΤΡΟΦΟΥ ΠΡΟΒΛΗΜΑΤΟΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΜΗΚΩΝ 3. ΕΠΙΛΥΣΗ ΓΡΑΜΜΙΚΟΥ ΑΝΤΙΣΤΡΟΦΟΥ ΠΡΟΒΛΗΜΑΤΟΣ ΜΕ ΤΗ ΜΕΘΟΔΟ ΜΗΚΩΝ 3. Διαφορά μετρήσεων από εκτιμήσεις μετρήσεων. Όταν επιλύοµε ένα αντίστροφο πρόβληµα υπολογίζοµε ένα διάνυσµα παραµέτρων est m το οποίο αντιπροσωπεύει

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2002 Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ BΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2002 Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ BΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ 2002 Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ BΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ Θέµα 1ο Α. 1. γ 2. β Β. 1. Ανοικτό πλαίσιο ανάγνωσης: Η διαδροµή µε βήµα τριπλέτας από το κωδικόνιο έναρξης

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β. Α1. Η α Α2. Η γ Α3. Η α Α4. Η δ Α5. Η γ Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β

ΘΕΜΑ Α ΘΕΜΑ Β. Α1. Η α Α2. Η γ Α3. Η α Α4. Η δ Α5. Η γ Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β ΑΠΑΝΤΗΣΕΙΣ ΣΤΙΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΣΤΟ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΑΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. Η α Α2. Η

Διαβάστε περισσότερα

Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών

Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών ΙΠΤ-Α ΕΡΓΑΣΤΗΡΙΟ ΥΓΕΙΟΦΥΣΙΚΗΣ & ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΥΓΕΙΑΣ ΕΠΙΠΤΩΣΕΙΣ ΓΟΝΟΤΟΞΙΚΩΝ ΕΚΘΕΣΕΩΝ ΣΤΗΝ ΥΓΕΙΑ Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών ρ Κωνσταντίνα Σαμπάνη Ερευνήτρια Α 1 ΒΙΟΛΟΓΙΚΕΣ

Διαβάστε περισσότερα

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015 Ορισμοί-Κατάταξη-Ιστολογία Δ Ροντογιάννη Νευροενδοκρινή νεοπλάσματα Ταξινόμηση Βιολογικοί δείκτες Μοριακή Παθολογία Νευροενδοκρινή νεοπλάσματα Ταξινόμηση

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4 ΑΡΙΘΜΗΤΙΚΕΣ ΜΕΘΟ ΟΙ ΕΥΡΕΣΗΣ ΠΡΑΓΜΑΤΙΚΩΝ Ι ΙΟΤΙΜΩΝ. 4.1 Γραµµικοί µετασχηµατισµοί-ιδιοτιµές-ιδιοδιανύσµατα

ΚΕΦΑΛΑΙΟ 4 ΑΡΙΘΜΗΤΙΚΕΣ ΜΕΘΟ ΟΙ ΕΥΡΕΣΗΣ ΠΡΑΓΜΑΤΙΚΩΝ Ι ΙΟΤΙΜΩΝ. 4.1 Γραµµικοί µετασχηµατισµοί-ιδιοτιµές-ιδιοδιανύσµατα ΚΕΦΑΛΑΙΟ 4 ΑΡΙΘΜΗΤΙΚΕΣ ΜΕΘΟ ΟΙ ΕΥΡΕΣΗΣ ΠΡΑΓΜΑΤΙΚΩΝ Ι ΙΟΤΙΜΩΝ 4. Γραµµικοί µετασχηµατισµοί-ιδιοτιµές-ιδιοδιανύσµατα Εστω R είναι ο γνωστός -διάστατος πραγµατικός διανυσµατικός χώρος. Μία απεικόνιση L :

Διαβάστε περισσότερα

Ορισµένοι ερευνητές υποστηρίζουν ότι χρειαζόµαστε µίνιµουµ 30 περιπτώσεις για να προβούµε σε κάποιας µορφής ανάλυσης των δεδοµένων.

Ορισµένοι ερευνητές υποστηρίζουν ότι χρειαζόµαστε µίνιµουµ 30 περιπτώσεις για να προβούµε σε κάποιας µορφής ανάλυσης των δεδοµένων. ειγµατοληψία Καθώς δεν είναι εφικτό να παίρνουµε δεδοµένα από ολόκληρο τον πληθυσµό που µας ενδιαφέρει, διαλέγουµε µια µικρότερη οµάδα που θεωρούµε ότι είναι αντιπροσωπευτική ολόκληρου του πληθυσµού. Τέσσερις

Διαβάστε περισσότερα

ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ

ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ Στα πλαίσια της ΣΤΑΤΙΣΤΙΚΗΣ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑΣ προσπαθούµε να προσεγγίσουµε τα χαρακτηριστικά ενός συνόλου (πληθυσµός) δια της µελέτης των χαρακτηριστικών αυτών επί ενός µικρού

Διαβάστε περισσότερα

3 ο ΚΕΦΑΛΑΙΟ. Μεταβολισμός του κυττάρου

3 ο ΚΕΦΑΛΑΙΟ. Μεταβολισμός του κυττάρου 3 ο ΚΕΦΑΛΑΙΟ Μεταβολισμός του κυττάρου ΤΥΠΟΙ ΧΗΜΙΚΩΝ ΑΝΤΙΔΡΑΣΕΩΝ Α. Εξώθερμη αντίδραση = απελευθέρωση ενέργειας Β. Ενδόθερμη αντίδραση = πρόσληψη ενέργειας 3ο λύκ. Ηλιούπολης επιμέλεια: Αργύρης Γιάννης

Διαβάστε περισσότερα

Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ

Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ Φαρμακογενωμική Κλϊδοσ τησ γενετικόσ Προβλϋπει την ανταπόκριςη του αςθενό ςε φαρμακευτικϋσ αγωγϋσ μελετώντασ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. Ευφροσύνη Φρέσκου (Βιολόγος) ΠΑΝΕΚΦE ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΥΠΕΥΘΥΝΩΝ ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΚΕΝΤΡΩΝ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ

ΒΙΟΛΟΓΙΑ. Ευφροσύνη Φρέσκου (Βιολόγος) ΠΑΝΕΚΦE ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΥΠΕΥΘΥΝΩΝ ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΚΕΝΤΡΩΝ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΠΑΝΕΚΦE ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΥΠΕΥΘΥΝΩΝ ΕΡΓΑΣΤΗΡΙΑΚΩΝ ΚΕΝΤΡΩΝ ΦΥΣΙΚΩΝ ΕΠΙΣΤΗΜΩΝ 14 η Ευρωπαϊκή Ολυμπιάδα Φυσικών Επιστημών EUSO 2016 Τοπικός Διαγωνισμός Πέλλας Διεύθυνση Δευτεροβάθμιας Εκπαίδευσης Πέλλας Εργαστηριακό

Διαβάστε περισσότερα

Για εισαγωγή στο Τμήμα Ιατρικής

Για εισαγωγή στο Τμήμα Ιατρικής Τμήμα Ιατρικής Της Σχολής Επιστημών Υγείας Του Α.Π.Θ. Οδηγός Κατατακτηρίων Εξετάσεων Για εισαγωγή στο Τμήμα Ιατρικής Ακαδημαϊκού έτους 2015-2016 1 Γενικές Οδηγίες Σύμφωνα με το Νόμο 4218/2013 και την Υπουργική

Διαβάστε περισσότερα

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΖΩΟΛΟΓΙΑ Δ. ΜΑΤΘΟΠΟΥΛΟΣ 1 ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΕΞΕΛΙΞΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΔΙΑΔΙΚΑΣΙΑ

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα