Microarrays. Γρηγόρης Αµούτζιας

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Microarrays. Γρηγόρης Αµούτζιας"

Transcript

1 Microarrays Γρηγόρης Αµούτζιας

2 Microarrays Chips ή αντικειµενοφόροι πλάκες που µετράνε την γονιδιακή έκφραση (και όχι µόνο). Δεν µετράνε απόλυτες τιµές συγκεντρώσεων µεταγραφηµάτων. Μετράνε σχετικές αλλαγές. Για µια συνθήκη, πόσο πιο αυξηµένη ή µειωµένη είναι η έκφραση ενός γονιδίου, σε σχέση µε µια άλλη συνθήκη. Π.χ. Πόσο πιο αυξηµένη/µειωµένη είναι η έκφραση ενός γονιδίου Α µετά από άσκηση (control: αµέσως πριν την άσκηση). Δεν µπορούµε να συγκρίνουµε το γονίδιο Α µε το γονίδιο Β Στο Chip υπάρχουν για το κάθε µεταγράφηµα: cdnas ολόκληρου του µεταγραφώµατος (spotting) (PCR) ολιγοµερή (τα λεγόµενα oligo-probes), µε µήκος βάσεις. Spotting In situ synthesis

3 Σχετικές διαφορές relative measurement 2 COLORS (Cy5 / Cy3) absolute measurement 1 COLOR ( Cy3 )

4 Σχετικές διαφορές intensity Highly expressed genes, highly differentially expressed Low expressed, genes slightly differentially expressed gene a gene b gene c

5 Όλιγο-Μικροσυστοιχίες (oligo-microarrays) Chip στο οποίο υπάρχουν DNA ολιγοµερή (τα λεγόµενα probes), µε µήκος βάσεις που αντιπροσωπεύουν το γονιδίωµα ενός οργανισµού. Περισσότερα από ένα διαφορετικά probes µπορεί να υπάρχουν για ένα γονίδιο. Πάνω σε αυτά τα probes υβριδίζονται τα συµπληρωµατικά τους cdnas. Το κάθε cdna είναι συνδεδεµένο µε φθορίζουσα χρωστική. Κάθε κηλίδα (spot) στο chip αντιστοιχεί σε ένα συγκεκριµµένο είδος probes. Η ένταση της φθορίζουσας χρωστικής υποδηλώνει την ένταση µε την οποία εκφράζεται το mrna για τον αντίστοιχο probe.

6 Τι µπορούν να ελέγξουν Έκφραση mrna. Έκφραση micro-rna. CGH (comparative genomic hybridization). SNPs. DNA µεθυλίωση. ChIP-on-chip.

7 CGH Comparative genome hybridization. Βλέπει αν µια γενωµική περιοχή σε ένα δείγµα έχει πολλαπλασιαστεί ή χαθεί σε σχέση µε ένα control.

8 Τα βήµατα

9 Μικροσυστοιχίες (microarrays) Με δύο χρώµατα (πράσινο/κόκκινο) Το ένα χρώµα είναι για µια συγκεκριµµένη συνθήκη και το άλλο χρώµα για µια άλλη (συνήθως control). Εξάγεται το ολικό RNA για την κάθε συνθήκη. Ελέγχεται η ποσότητα και ποιότητα του RNA. Γίνεται σήµανση του κάθε δείγµατος RNA µε συγκεκριµµένη χρωστική (π.χ. Cy5:red - Cy3:green). Τα 2 δείγµατα αναµιγνύονται και το µίγµα υπόκειται σε υβριδισµό πάνω στο chip. Μετριέται η ένταση της κάθε µιας από τις 2 χρωστικές, για κάθε κηλίδα. Υπολογίζεται ο λόγος των εντάσεων των 2 χρωστικών, στην κάθε κηλίδα.

10 Μικροσυστοιχίες

11 Μικροσυστοιχίες (microarrays) Αν το γονίδιο εκφράζεται περισσότερο στην Α συνθήκη (κόκκινη χρωστική) από ότι στην control (πράσινη χρωστική), τότε ο λόγος συνθήκη_α/control (κόκκινη/πράσινη) θα είναι λ>1, αλλιώς σε αντίθετη περίπτωση 0<λ<1. Αν το γονίδιο εκφράζεται µε διπλάσια ένταση στην συνθήκη Α, σε σχέση µε την συνθήκη control, τότε ο λόγος θα είναι λ=2. Αν το γονίδιο εκφράζεται µε τη µισή ένταση στην συνθήκη Α, σε σχέση µε την συνθήκη control, τότε ο λόγος θα είναι λ=0.5. Μετατρέποντας τους λόγους σε log 2, έχουµε: λ=2 -> log 2 λ=1 λ=0.5 -> log 2 λ=-1 Με την κανονικοποίηση σε log 2 τα δεδοµένα γίνονται συµµετρικά.

12 Μικροσυστοιχίες (microarrays) Πότε θεωρούµε ότι ένα γονίδιο υπερ/υπό-εκφράζεται σε µια συγκεκριµµένη συνθήκη. Log 2 λ > 1 ή Log 2 λ < -1 (διπλάσια/υποδιπλάσια έκφραση σε σχέση µε τη συνθήκη control). Με στατιστικές µεθόδους (t-test, ANOVA).

13 microarrays Κατανοµή των σηµάτων. Μετατροπή - κανονικοποίηση των σηµάτων.

14 Οµαδοποίηση γονιδίων µε την ίδια συµπεριφορά. Χρειαζόµαστε αρκετά σηµεία (διαφορετικές συνθήκες ή χρονικές στιγµές) Με µεθόδους αποστάσεων, όπου οι µετρήσεις ενός γονιδίου για; διαφορετικές συνθήκες αποτελούν ένα διάνυσµα. Υπολογίζουµε αποστάσεις µεταξύ διαφορετικών διανυσµάτων (γονιδίων). Ευκλείδια απόσταση Συντελεστής συσχέτισης Pearson (Pearson correlation coefficient). Δηµιουργείται πίνακας αποστάσεων µεταξύ των γονιδίων. Το αντίστοιχο µπορεί να γίνει και για να οµαδοποιήσουµε κοινές συνθήκες.

15 Μικροσυστοιχίες

16 Μήκος των probes Affymetrix: 25mer Agilent: 60mer Illumina: 50mer Όσο µεγαλύτερο το probe, τόσο πιο ευαίσθητο (µπορεί να ανιχνεύσει targets σε µικρότερες συγκεντρώσεις). Όµως, µεγαλύτερο probe µπορεί και να ανεχτεί περισσότερους πολυµορφισµούς (ή mismatches).

17 Υβριδισµός των probes

18 Probes & chips

19 Σχεδιασµός των probes Θα πρέπει η ακολουθία τους να είναι µοναδική ώστε να αντικατοπτρίζει την έκφραση για το γονίδιο που σχεδιάστηκαν. Όλοι οι probes θα πρέπει να έχουν παρόµοια Tm (βέλτιστη θερµοκρασία υβριδισµού). Τα probes δεν θα πρέπει να σχηµατίζουν δευτεροταγείς δοµές που τα εµποδίζουν να υβριδιστούν µε τον στόχο.

20 spots

21 Array Spotting Με βελόνες (pins) (απώθεση έτοιµων cdnas ή oligos ). Με inkjet (Agilent: spin-off της Hewlett-Packard) (in situ synthesized oligos)

22 spotting pin quality decline after delivery of 5x105 spots after delivery of 3x105 spots H. Sueltmann DKFZ/MGA

23 Inkjet printing - Agilent

24 Agilent phosphoramidite chemistry

25 Φωτολιθογραφία - Affymetrix Youtube: Affymetrix: nloads/student_manual_activities/activity3/activity3_manufacturing_bac kground.pdf

26 Φωτολιθογραφία

27 Φωτολιθογραφία

28 Φωτολιθογραφία

29 Φωτολιθογραφία

30 Φωτολιθογραφία

31 Feature

32 Agilent chips

33 Agilent chips 244k 1M k 400k 44k 180k 15k 60k LEGACY HD

34 Agilent platform Φούρνος υβριδισµού Laser Scanner

35 Affymetrix Arrays/strips/plates

36 Affymetrix platform

37 Affymetrix platforms

38 Έλεγχος Ποσότητας/Ποιότητας ολικού RNA Nanodrop (φωτόµετρο που χρησιµοποιεί ελάχιστο όγκο δείγµατος - 1λ) για ακριβής ποσοστικοποίηση. A260 nm -> νουκλεοτίδια, RNA, ssdna, dsdna A280 nm -> πρωτεΐνες, φαινόλες κ.α. A230 nm -> EDTA, φαινόλες, υδατάνθρακες. Α260/Α280 nm ~ /230 nm ~ 2-2.2

39 Έλεγχος Ποσότητας/Ποιότητας ολικού RNA Agilent 2100 Bioanalyzer για έλεγχο ποιότητας του RNA (τυχόν αποδόµιση). (~ ) Ηλεκτροφόρηση σε τριχοειδή Λόγος 28S/18S rrna 2:1 RNA integrity number (RIN)

40 Έλεγχος Ποσότητας/Ποιότητας ολικού RNA

41 Χηµικές αντιδράσεις

42 Υβριδισµός Όλα τα probes υβριδίζονται στην ίδια θερµοκρασία. Όµως, όλα τα probes δεν έχουν την ίδια βέλτιστη θερµοκρασία υβριδισµού. Άρα, υπάρχουν προβλήµατα για επιµέρους probes Φούρνος υβριδισµού του Affymetrix GeneAtlas

43 Υβριδισµός

44 Laser scanning Agilent autofocus

45 Μέτρηση σήµατος στα spots

46 Συνένωση των σηµάτων

47 Ποιότητα των spots

48 Ανάλυση προβληµατικών Spots

49 Υπολογισµός & αφαίρεση θορύβου υποβάθρου

50 Παράγοντες που επηρεάζουν τα microarrays Περιβαλλοντικοί Όζον Υγρασία Υπεριώδης ακτινοβολία Στατικός ηλεκτρισµός Μόλυνση της ατµόσφαιρας (οξειδωτικοί παράγοντες). Σκόνη (µπορεί να επηρεάσει τις µετρήσεις του Laser) Πούδρα από τα γάντια. Ενδογενείς Πρόβληµα σε κάποιο βήµα των χηµικών αντιδράσεων. Ο τύπος του ιστού. Dye swap για να αποκλείσουµε παράγοντες που πιθανών επηρεάσαν το πείραµα

51 Microarrays & Ozone Η χρωστική Cy5(red) είναι συνήθως πιο ασταθής σε σχέση µε τη χρωστική Cy3(green). Το όζον µπορεί να προκαλέσει περισσότερη αστάθεια της Cy5. Σε ένα πείραµα που το control χρωµατίστηκε µε Cy5 και το δείγµα µε Cy3, αν υποθέσουµε ότι το όζον προκάλεσε την αποδόµιση του Cy5, τότε περιµένουµε να δούµε (από λάθος) τα γονίδια του δείγµατος να: A) υπερεκφράζονται σε σχέση µε το control? B) υποεκφράζονται σε σχέση µε το control?

52 Microarrays & ozone

53 Microarrays & ozone

54 Ανάλυση δεδοµένων

55 Μετατροπή έντασης σήµατος σε log 2

56 Μετατροπή έντασης σήµατος σε log 2

57 Μετατροπή έντασης σήµατος σε log 2

58 Microarray Quality control

59 Οντολογίες Ελεγχόµενο λεξιλόγιο για την περιγραφή των ιδιοτήτων των γονιδίων και των πρωτεϊνών. Περιγράφουν: Μοριακές λειτουργίες του βιοµορίου (1 ή περισσότερες). Βιολογικές διαδικασίες στις οποίες εµπλέκεται το βιοµόριο (1 ή περισσότερες). Κυτταρικό διαµέρισµα στο οποίο συναντάται το βιοµόριο (1 ή περισσότερα).

60 Οντολογίες: Η δοµή τους Δείχνει τις σχέσεις µεταξύ των διαφορετικών όρων. Ένας όρος µπορεί να αποτελεί πιο εξειδικευµένη περιγραφή ενός άλλου όρου. Είναι κατευθυνόµενα ακυκλικά γραφήµατα (DAG). Παρόµοια µε ιεραρχίες. Η διαφορά είναι ότι ένας κόµβος-απόγονος µπορεί να έχει περισσότερους από έναν προγόνους.

61 Οντολογίες: Η δοµή τους Θεωρούµε ότι αν σε ένα βιοµόριο αντιστοιχεί ένα όρος-οντολογία, τότε σε αυτό το βιοµόριο ανήκουν και όλοι οι πρόγονοι του όρου-οντολογίας.

62 Οντολογίες: στατιστική ανάλυση Παράδειγµα: 1 γονιδίωµα µε γονίδια γονίδια εµπλέκονται στον κυτταρικό κύκλο (GO_term: cell-cycle). (10% του γονιδιώµατος). Αν επιλέξουµε τυχαία έναν αριθµό Χ γονιδίων, θα περιµέναµε (από τύχη) περίπου το 10% (µε κάποιες διακυµάνσεις) να έχουν τον όρο κυτταρικός κύκλος. Η τυχαία διακύµανση εξαρτάται από τον αριθµό των γονιδίων. Έστω ότι µε τα microarrays σε ένα πείραµα βρήκαµε ότι Χ αριθµός γονιδίων υπερεκφράζονται. Σε αυτό τον Χ αριθµό, βρήκαµε ότι 20% των γονιδίων ανήκουν στον κυτταρικό κύκλο. Αυτή η απόκλιση (20% παρατηρούµενο - 10% αναµενόµενο) είναι στα όρια των τυχαίων διακυµάνσεων, ή είναι στατιστικά σηµαντική? Στατιστικά σηµαντική, σηµαίνει ότι τα υπερεκφρασµένα γονίδια είναι εµπλουτισµένα για την κατηγορία κυτταρικός κύκλος. Δηλαδή, ο κυτταρικός κύκλος εµπλέκεται στην διαδικασία που µελετάµε.

63 Οντολογίες: στατιστική ανάλυση Η στατιστική ανάλυση γίνεται µε το υπεργεωµετρικό τεστ. Παίρνουµε ένα p-value. Αν p-value < 0.05, τότε είναι στατιστικά σηµαντικό. Αν στις οντολογίες µας είχαµε 100 όρους, θα επαναλαµβάναµε τα παραπάνω τεστς για τον κάθε όρο. Όµως, όσο περισσότερα τεστ κάνουµε για το πείραµά µας, τόσο αυξάνει ή πιθανότητα να βρούµε κάτι στατιστικά σηµαντικό (p-value < 0.05) καθαρά από λάθος. Άρα, πρέπει να λάβουµε υπόψην µας πόσα τεστ διενεργούµε και να διορθώσουµε τα p-values (multiple testing correction). False discovery rate (Benjamini-Hochberger) Bonferroni correction

64 Micro-RNAs Μικρά RNAs που ρυθµίζουν (κυρίως καταστέλουν) την µεταγραφή των mrnas Αποδόµιση του mrna. Αναστολή της µεταγραφής του mrna. Μέγεθος ~ 22 nt. ~1000 στον άνθρωπο. Ρυθµίζουν πολλά mrnas (30%-100%). Ένα mi-rna -> στοχεύει πολλά mrnas. Πολλά mi-rnas -> στοχεύουν το ίδιο mrna (hunting pack). Έχουν εξειδικευµένο προφίλ έκφρασης για τον κάθε ιστό (και καρκίνο) (συνήθως σχετίζονται µε συγκεκριµένες αναπτυξιακές διαδικασίες). Μπορούν να λειτουργήσουν ως διαγνωστικοί ή προγνωστικοί µοριακοί δείκτες.

65 Toxicology Applications

66 Τοξική δράση acetaminophen Έλεγχος µε microarrays αν τα mi-rna µπορούν να καταδείξουν την ηπατική καταστροφή µετά από χορήγηση φαρµάκου (acetaminophen overdose). Σε κατάσταση υπερχορήγησης, τα µεταβολικά µονοπάτια που καταβολίζουν το φάρµακο είναι σε κορεσµό. Το πλεονάζον φάρµακο υπόκειται σε καταβολισµό από ένζυµα των P450 -> NAPQI (N-acetyl-p-benzoquinone imine) (τοξικό). NAPQI εξουδετερώνεται από ενδοκυτταρική γλουταθιόνη (GSH). Ότι NAPQI περισσεύει, προκαλεί ηπατική καταστροφή. Σε περίπτωση υπερβολικής δόσης acetaminophen (-> υπερβολικό NAPQI), χορηγούµε N-acetylcysteine (NAC) -> ενδοκυτταρικό GSH.

67 Μέτρηση της τοξικής δράσης του acetaminophen Η τοξικότητα δεν εµφανίζεται αµέσως. Χρειάζεται γρήγορη και αξιόπιστη µέτρηση της τοξικότητας µε αιµατολογικό έλεγχο (ορό). Μέτρηση της αµινοτρανσφεράσης του ορού (κλασσική µέθοδος). Βρήκαν mi-rnas που εκφράζονται σηµαντικά στο ήπαρ. Παρακολουθήσαν την έκφρασή τους στο ήπαρ µετά τη χορήγηση acetaminophen και επίσης παρακολούθησαν την ανίχνευσή τους στον ορό (λόγω πιθανής ηπατικής κυτταρικής καταστροφής).

68 Toxicology Applications Selected mirna shows opposite changes between liver and plasma samples based on microarray results. Wang K et al. PNAS 2009;106:

69 Τα mi-rnas αποδείχθηκαν πιο αξιόπιστοι και πιο γρήγοροι δείκτες ηπατικής καταστροφής Wang K et al. PNAS 2009;106:

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA

Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA Microarrays Με τα sequence projects φτάσαμε στην εποχή που η ελάχιστη πληροφορία για να ξεκινήσει ένα πείραμα είναι ολόκληρη ακολουθία DNA του οργανισμού Το DNA όμως του οργανισμού είναι μια στατική πληροφορία

Διαβάστε περισσότερα

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ

Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ Η ΑΛΗΘΙΝΗ ΚΑΙ Η ΕΙΚΟΝΙΚΗ ΜΙΚΡΟΣΥΣΤΟΙΧΙΑ ΒΗΜΑ ΠΡΟΣ ΒΗΜΑ DNA μικροσυστοιχίες: βήμα προς βήμα Παραγωγή DNA ανιχνευτών Οι επιστήμονες μπορούν να παράγουν «σπιτικές» μικροσυστοιχίες χρησιμοποιώντας την αλυσιδωτή

Διαβάστε περισσότερα

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος

HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος HPV DNA, E6, E7, L1, L2, E2, p16, prb, κυκλίνες, κινάσες, Ki67. Τι από όλα αυτά πρέπει να γνωρίζει ο κλινικός γιατρός; Αλέξανδρος Λαµπρόπουλος δεν υπάρχει σύγκρουση συµφερόντων Ø Ποιό HPV τεστ είναι το

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό

Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών Διαχείριση ορμονικών μορίων Τα ορμονικά μόρια και η διαχείριση τους μέσα στο φυτό Φυσιολογία Φυτών 3 ου Εξαμήνου Δ. Μπουράνης, Σ. Χωριανοπούλου 1 Φυσιολογία Φυτών Διαχείριση ορμονικών

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης

Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Περιβάλλον και υγεία: Ορόλοςτηςβιολογικήςέρευνας στη διαμόρφωση πολιτικών προστασίας και πρόληψης Σ. Κυρτόπουλος Ινστιτούτο Βιολογικών Ερευνών & Βιοτεχνολογίας Εθνικό Ίδρυμα Ερευνών Συμβολή περιβαλλοντικών

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Δ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΔΕΥΤΕΡΑ 23 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. γ Α4. δ Α5. α ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σχολικό

Διαβάστε περισσότερα

Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος

Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος Πανεπιστήμιο Πατρών Πληροφορική Επιστημών Ζωής Σπύρος Βερναρδής 1270 Βιολόγος Χρήση μικροσυστοιχιών DNA για την ανάλυση του μεταγραφικού προφίλ γενετικά τροποποιημένων εμβρυικών ινοβλαστών ποντικού. Πάτρα

Διαβάστε περισσότερα

ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ. Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ

ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ. Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ Πτυχιακή εργασία του σπουδαστή Αθανάσιου Καραφλού Καλαμάτα, Μάιος 2008 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου. Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο

Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου. Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο Επιγενετικές Μεταβολές στην ιαμόρφωση και Λειτουργία του Μυοκαρδίου Ιωάννης Ρίζος Β Πανεπιστημιακή Καρδιολογική Κλινική, Αττικό Νοσοκομείο Ερώτημα Ποια είναι η αντίδραση της καρδιάς μυοκαρδίου στα επιγεννετικά

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος. Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας

ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος. Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας ΗPV και ενδοεπιθηλιακές αλλοιώσεις κατωτέρου γεννητικού συστήματος Ε.Κωστοπούλου Λέκτορας Παθολογικής Ανατομικής Πανεπιστήμιο Θεσσαλίας H.M. Παράγοντες κινδύνου καρκινώματος τραχήλου Ηλικία κατά την πρώτη

Διαβάστε περισσότερα

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ

ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ ΕΡΓΑΣΙΑ ΒΙΟΛΟΓΙΑΣ 3.1 ΕΝΕΡΓΕΙΑ ΚΑΙ ΟΡΓΑΝΙΣΜΟΙ Οι οργανισμοί εξασφαλίζουν ενέργεια, για τις διάφορες λειτουργίες τους, διασπώντας θρεπτικές ουσίες που περιέχονται στην τροφή τους. Όμως οι φωτοσυνθετικοί

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη

Ατυπία Υπερπλασία- Δυσπλασία. Κίττυ Παυλάκη Ατυπία Υπερπλασία- Δυσπλασία Κίττυ Παυλάκη Jeanne Calment Κάπνιζε µέχρι τα 117 Πέθανε στα 122 Η σωστή λειτουργία των οργανισµών απαιτεί τη δυνατότητα προσαρµογής των κυττάρων και κατά συνέπεια και των

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΑ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΧΡΗΣΗ ΟΖΟΝΤΟΣ ΣΤΗΝ ΚΑΤΕΡΓΑΣΙΑ ΤΟΥ ΝΕΡΟΥ ΣΕ ΠΥΡΓΟΥΣ ΨΥΞΗΣ

ΤΕΧΝΟΛΟΓΙΑ ΠΕΡΙΒΑΛΛΟΝΤΟΣ ΧΡΗΣΗ ΟΖΟΝΤΟΣ ΣΤΗΝ ΚΑΤΕΡΓΑΣΙΑ ΤΟΥ ΝΕΡΟΥ ΣΕ ΠΥΡΓΟΥΣ ΨΥΞΗΣ ΧΡΗΣΗ ΟΖΟΝΤΟΣ ΣΤΗΝ ΚΑΤΕΡΓΑΣΙΑ ΤΟΥ ΝΕΡΟΥ ΣΕ ΠΥΡΓΟΥΣ ΨΥΞΗΣ Η χρήση του όζοντος για την κατεργασία νερού σε πύργους ψύξης αυξάνει σηµαντικά τα τελευταία χρόνια και αρκετές έρευνες και εφαρµογές που έχουν

Διαβάστε περισσότερα

Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R

Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R Ανάλυση Δεδοµένων µε χρήση του Στατιστικού Πακέτου R, Επίκουρος Καθηγητής, Τοµέας Μαθηµατικών, Σχολή Εφαρµοσµένων Μαθηµατικών και Φυσικών Επιστηµών, Εθνικό Μετσόβιο Πολυτεχνείο. Περιεχόµενα Εισαγωγή στη

Διαβάστε περισσότερα

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών

Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Μελέτη βιολογικής δράσης σε ουσίες που περιέχονται σε εκχυλίσµατα από ελληνικές ποικιλίες σταφυλιών Αντιµεταλλαξιγόνο δράση ανίχνευση ουσιών που προστατεύουν το DNA από µεταλλαξιγόνα που προκαλούν µεταλλάξεις

Διαβάστε περισσότερα

Μελέτη στην ανάλυση οµάδων και εφαρµογή σε δεδοµένα γονιδιακής έκφρασης καρκίνου από µικροσυστοιχίες

Μελέτη στην ανάλυση οµάδων και εφαρµογή σε δεδοµένα γονιδιακής έκφρασης καρκίνου από µικροσυστοιχίες Μελέτη στην ανάλυση οµάδων και εφαρµογή σε δεδοµένα γονιδιακής έκφρασης καρκίνου από µικροσυστοιχίες Ιωάννης Αγ. Μαραζιώτης Εποπτεία: Καθ. Αναστάσιος Μπεζεριάνος Βιοπληροφορική Βιολογικά δεδοµένα + Υπολογιστικές

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ 2. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ

ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ 2. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ ΚΕΦΑΛΑΙΟ II ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΕΝΟΤΗΤΕΣ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΔΥΟ ΚΡΙΤΗΡΙΑ 1. ΑΝΑΛΥΣΗ ΔΙΑΚΥΜΑΝΣΗΣ ΚΑΤΑ ΕΝΑ ΚΡΙΤΗΡΙΟ (One-Way Analyss of Varance) Η ανάλυση

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΥΨΗΛΗΣ ΑΝΑΛΥΣΗΣ ΟΡΓΑΝΙΣΜΩΝ ΜΟΝΤΕΛΩΝ in vivo Δρ. Γεώργιος Μαρκόπουλος, Ph.D. Βιολόγος, Μεταδιδακτορικός Ερευνητής και Ευάγγελος Κωλέττας,

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ

ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ. 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ 11η ΙΑΛΕΞΗ ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΜΕ ΜΕΤΑΛΛΑΓΕΣ Μεταλλαγή ή Μετάλλαξη Οποιαδήποτε αλλαγή του γενετικού υλικού που δεν οφείλεται σε ανασυνδυασµό ή σε διάσχιση των γονιδίων και η οποία

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Στατιστικό κριτήριο χ 2

Στατιστικό κριτήριο χ 2 18 Μεθοδολογία Επιστηµονικής Έρευνας & Στατιστική Στατιστικό κριτήριο χ 2 Ο υπολογισµός του κριτηρίου χ 2 γίνεται µέσω του µενού [Statistics => Summarize => Crosstabs...]. Κατά τη συγκεκριµένη διαδικασία

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

Α. Βιοϊατρικός Κύκλος

Α. Βιοϊατρικός Κύκλος ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΤΗΣ ΓΝΩΣΗΣ ΑΠΟΦΟΙΤΩΝ ΑΝΩΤΕΡΩΝ ΕΚΠΑΙ ΕΥΤΙΚΩΝ Ι ΡΥΜΑΤΩΝ ΣΕ ΣΥΓΧΡΟΝΕΣ ΕΦΑΡΜΟΓΕΣ ΣΤΙΣ ΒΙΟΕΠΙΣΤΗΜΕΣ Περιεχόµενο Προγράµµατος (µαθήµατα, ώρες κλπ): Το Πρόγραµµα Σπουδών διαχωρίζεται σε δύο Κύκλους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

Ελεύθερες ρίζες και αντιοξειδωτικά

Ελεύθερες ρίζες και αντιοξειδωτικά Ελεύθερες ρίζες και αντιοξειδωτικά Κατά τη διάρκεια των φυσιολογικών ανθρώπινων διεργασιών παραγωγή ενέργειας, αποτοξίνωση από τοξικές ουσίες και ανοσολογική απόκριση, παράγονται από τον οργανισµό ελεύθερες

Διαβάστε περισσότερα

ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ

ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ ΣΥΣΤΟΙΧΙΕΣ ΜΙΚΡΟΚΗΛΙ ΩΝ ΟΛΙΓΟΝΟΥΚΛΕΟΤΙ ΙΩΝ ΓΙΑ ΤΗΝ ΑΝΙΧΝΕΥΣΗ ΜΕΤΑΛΛΑΞΕΩΝ ρ. Παναγιώτα Πέτρου Εργαστήριο Ανοσοαναλύσεων/Ανοσοαισθητήρων Ινστιτούτο Ραδιοϊσοτόπων Ραδιοδιαγνωστικών Προϊόντων ΕΚΕΦΕ «ηµόκριτος»

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο. 3. Το DNA των μιτοχονδρίων έχει μεγαλύτερο μήκος από αυτό των χλωροπλαστών. ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία

Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Βιοπληροψορική, συσιημική βιολογία και εξατομικευμένη θεραπεία Φραγκίσκος Κολίσης Καθηγητής Βιοτεχνολογίας, Σχολή Χημικών Μηχανικών ΕΜΠ, Διευθυντής Ινστιτούτου Βιολογικών Ερευνών και Βιοτεχνολογίας, EIE

Διαβάστε περισσότερα

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016

ΘΕΜΑ: Ορισµός εξεταζοµένων µαθηµάτων στις κατατακτήριες εξετάσεις 2015-2016 Ε Λ Λ Η Ν Ι Κ Η ΗΜΟΚΡΑΤΙΑ ΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Θ Ρ Α Κ Η Σ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΟΛΗ 6 Ο χλµ AΛΕΞ/ΠΟΛΗΣ-ΜΑΚΡΗΣ 68100 ΑΛΕΞΑΝ ΡΟΥΠΟΛΗ Τ Μ Η ΜΑ Ι Α Τ Ρ Ι Κ Η Σ Γ Ρ Α Μ Μ Α Τ Ε Ι Α H E L L E N I C R E P U B L I

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες

IΣTOΛOΓIA. Tα δείγµατα του βιολογικού υλικού λαµβάνονται µε > βελόνες ενδοσκοπικούς σωλήνες εύκαµπτους καθετήρες IΣTOΛOΓIA H ιστολογία κλάδος της ιατρικής που µελετά > υφή βιολογικού υλικού και τους τρόπους που τα επιµέρους συστατικά στοιχεία σχετίζονται µεταξύ τους δοµικά & λειτουργικά Tα δείγµατα του βιολογικού

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ & ΠΑΡΑΓΩΓΗΣ) 2009 ΕΚΦΩΝΗΣΕΙΣ Για τις ερωτήσεις 1.1 και 1.2 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα το γράµµα

Διαβάστε περισσότερα

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ

ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΕΞΕΛΙΞΗ ΣΕΙΡΑ ΜΕΤΑΒΟΛΩΝ ΠΡΟΣ ΟΛΕΣ ΤΙΣ ΣΥΝΙΣΤΩΣΕΣ ΠΟΥ ΠΑΙΡΝΟΥΝ ΜΕΡΟΣ ΣΕ ΕΝΑΝ ΠΛΗΘΥΣΜΟ ΜΕ ΤΗΝ ΠΑΡΟΔΟ ΤΟΥ ΧΡΟΝΟΥ ΖΩΟΛΟΓΙΑ Δ. ΜΑΤΘΟΠΟΥΛΟΣ 1 ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗΝ ΕΞΕΛΙΞΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΔΙΑΔΙΚΑΣΙΑ

Διαβάστε περισσότερα

1. Εισαγωγή Ο έλεγχος υποθέσεων αναφέρεται στις ιδιότητες µιας άγνωστης παραµέτρους του πληθυσµού: Ο κατηγορούµενος είναι αθώος

1. Εισαγωγή Ο έλεγχος υποθέσεων αναφέρεται στις ιδιότητες µιας άγνωστης παραµέτρους του πληθυσµού: Ο κατηγορούµενος είναι αθώος Έλεγχοι Υποθέσεων 1. Εισαγωγή Ο έλεγχος υποθέσεων αναφέρεται στις ιδιότητες µιας άγνωστης παραµέτρους του πληθυσµού: Ο κατηγορούµενος είναι αθώος µ = 100 Κάθε υπόθεση συνοδεύεται από µια εναλλακτική: Ο

Διαβάστε περισσότερα

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων

ΑΝΑΚΟΙΝΩΣΗ. Η κατάταξη γίνεται με εξετάσεις στα παρακάτω μαθήματα: Οι επιτυχόντες κατατάσσονται στα παρακάτω εξάμηνα ανά Κατηγορία πτυχιούχων ΑΝΑΚΟΙΝΩΣΗ Από το Τμήμα Ιατρικής ανακοινώνεται ότι για το ακαδημαϊκό έτος 2014-2015 στο Τμήμα Ιατρικής κατατάσσονται : Οι πτυχιούχου Πανεπιστημίου, Τ.Ε.Ι. ή ισοτίμων προς αυτά, Α.ΣΠΑΙ.Τ.Ε., της Ελλάδος

Διαβάστε περισσότερα

Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο

Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο Παρακολούθηση και εκτίµηση της έκθεσης σε καρκινογόνες χηµικές ουσίες, και των αντιστοίχων κινδύνων, στον εργασιακό χώρο Σ. Κυρτόπουλος, Εργαστήριο Χηµικής Καρκινογένεσης και Γενετικής Τοξικολογίας, Ινστιτούτο

Διαβάστε περισσότερα

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2

ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΚΕΦΑΛΑΙΑ 1 ΚΑΙ 2 ΘΕΜΑ 1 ο Α. Στις ερωτήσεις 1-5 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και δίπλα του το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

ΒΙΟΪΑΤΡΙΚΟΣ ΚΥΚΛΟΣ Πρόγραμμα Σπουδών Κατεύθυνση: Βιοδιαγνωστική

ΒΙΟΪΑΤΡΙΚΟΣ ΚΥΚΛΟΣ Πρόγραμμα Σπουδών Κατεύθυνση: Βιοδιαγνωστική ΒΙΟΪΑΤΡΙΚΟΣ ΚΥΚΛΟΣ Πρόγραμμα Σπουδών Κατεύθυνση: Βιοδιαγνωστική Μαθήματα 1. ΓΕΝΕΤΙΚΑ ΚΑΙ ΜΟΝΟΓΟΝΙΔΙΑΚΑ ΝΟΣΗΜΑΤΑ (50 ώρες 2 Πιστωτικές Μονάδες) Υπεύθυνος Μαθήματος: Καθηγητής Ζ. Σκούρας Διδάσκοντες Μαθήματος:

Διαβάστε περισσότερα

IMAGE-PRO Ποσοτική ανάλυση συνεντοπισµού φθοριοχρωµάτων Quantitative colocalization analysis

IMAGE-PRO Ποσοτική ανάλυση συνεντοπισµού φθοριοχρωµάτων Quantitative colocalization analysis IMAGE-PRO Ποσοτική ανάλυση συνεντοπισµού φθοριοχρωµάτων Quantitative colocalization analysis Η ανάλυση συνεντοπισµού σε πολυχρωµατικές εικόνες µικροσκοπίας φθορισµού βασίζεται στην µελέτη παρουσίας σήµατος

Διαβάστε περισσότερα

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA.

Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους. Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 1 -Ρυθμιζόμενα, ιδιοστατικά γονίδια και γονίδια κυτταρικής οικονομίας:

Διαβάστε περισσότερα

ΜΕΛΕΤΗ ΑΝΘΕΚΤΙΚΟΤΗΤΑΣ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ ΣΤΗ ΘΕΡΑΠΕΙΑ

ΜΕΛΕΤΗ ΑΝΘΕΚΤΙΚΟΤΗΤΑΣ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ ΣΤΗ ΘΕΡΑΠΕΙΑ ΕΡΕΥΝΗΤΙΚΗ ΜΟΝΑΔΑ: ΜΟΡΙΑΚΗ ΒΙΟΛΟΓΙΑ ΥΠΕΥΘΥΝΟΣ: ΤΣΕΖΟΥ ΑΣΠΑΣΙΑ ΜΕΛΕΤΗ ΑΝΘΕΚΤΙΚΟΤΗΤΑΣ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΜΑΣΤΟΥ ΣΤΗ ΘΕΡΑΠΕΙΑ ΠΑΠΑΝΙΚΟΛΑΟΥ Βασίλης, PhD Λάρισα, 2012 ΚΑΡΚΙΝΟΣ ΜΑΣΤΟΥ Αποτελεί την πιο κοινή μορφή

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β )

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ 2015 ΗΜΕΡΗΣΙΑ ΓΕΝΙΚΑ ΛΥΚΕΙΑ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 β Α2 γ Α3 α Α4 δ Α5 γ ΘΕΜΑ Β Β1: 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2:

Διαβάστε περισσότερα

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 18 ΜΑΪΟΥ 2011 ΕΚΦΩΝΗΣΕΙΣ

ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 18 ΜΑΪΟΥ 2011 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ A ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ) 18 ΜΑΪΟΥ 2011 ΕΚΦΩΝΗΣΕΙΣ Για τις ηµιτελείς προτάσεις Α1 και Α2 να γράψετε στο τετράδιό σας τον αριθµό της πρότασης

Διαβάστε περισσότερα

Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών

Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών ΙΠΤ-Α ΕΡΓΑΣΤΗΡΙΟ ΥΓΕΙΟΦΥΣΙΚΗΣ & ΠΕΡΙΒΑΛΛΟΝΤΙΚΗΣ ΥΓΕΙΑΣ ΕΠΙΠΤΩΣΕΙΣ ΓΟΝΟΤΟΞΙΚΩΝ ΕΚΘΕΣΕΩΝ ΣΤΗΝ ΥΓΕΙΑ Κυτταρογενετική και μοριακή γενετική επίκτητων διαταραχών ρ Κωνσταντίνα Σαμπάνη Ερευνήτρια Α 1 ΒΙΟΛΟΓΙΚΕΣ

Διαβάστε περισσότερα

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015 Ορισμοί-Κατάταξη-Ιστολογία Δ Ροντογιάννη Νευροενδοκρινή νεοπλάσματα Ταξινόμηση Βιολογικοί δείκτες Μοριακή Παθολογία Νευροενδοκρινή νεοπλάσματα Ταξινόμηση

Διαβάστε περισσότερα

Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ

Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ Φαρμακογενωμική Κλϊδοσ τησ γενετικόσ Προβλϋπει την ανταπόκριςη του αςθενό ςε φαρμακευτικϋσ αγωγϋσ μελετώντασ

Διαβάστε περισσότερα

ΣΗΜΕΙΩΣΕΙΣ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΣΤΑΤΙΣΤΙΚΗ ΓΙΑ ΠΟΛΙΤΙΚΟΥΣ ΜΗΧΑΝΙΚΟΥΣ ΜΕΡΟΣ Β

ΣΗΜΕΙΩΣΕΙΣ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΣΤΑΤΙΣΤΙΚΗ ΓΙΑ ΠΟΛΙΤΙΚΟΥΣ ΜΗΧΑΝΙΚΟΥΣ ΜΕΡΟΣ Β ΣΗΜΕΙΩΣΕΙΣ ΓΙΑ ΤΟ ΜΑΘΗΜΑ ΣΤΑΤΙΣΤΙΚΗ ΓΙΑ ΠΟΛΙΤΙΚΟΥΣ ΜΗΧΑΝΙΚΟΥΣ ΜΕΡΟΣ Β ηµήτρης Κουγιουµτζής http://users.auth.gr/dkugiu/teach/civilengineer E mail: dkugiu@gen.auth.gr 1/11/2009 2 Περιεχόµενα 1 ΠΕΡΙΓΡΑΦΙΚΗ

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Ορισµένοι ερευνητές υποστηρίζουν ότι χρειαζόµαστε µίνιµουµ 30 περιπτώσεις για να προβούµε σε κάποιας µορφής ανάλυσης των δεδοµένων.

Ορισµένοι ερευνητές υποστηρίζουν ότι χρειαζόµαστε µίνιµουµ 30 περιπτώσεις για να προβούµε σε κάποιας µορφής ανάλυσης των δεδοµένων. ειγµατοληψία Καθώς δεν είναι εφικτό να παίρνουµε δεδοµένα από ολόκληρο τον πληθυσµό που µας ενδιαφέρει, διαλέγουµε µια µικρότερη οµάδα που θεωρούµε ότι είναι αντιπροσωπευτική ολόκληρου του πληθυσµού. Τέσσερις

Διαβάστε περισσότερα

ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ

ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ ΣΤΑΤΙΣΤΙΚΗ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑ Στα πλαίσια της ΣΤΑΤΙΣΤΙΚΗΣ ΣΥΜΠΕΡΑΣΜΑΤΟΛΟΓΙΑΣ προσπαθούµε να προσεγγίσουµε τα χαρακτηριστικά ενός συνόλου (πληθυσµός) δια της µελέτης των χαρακτηριστικών αυτών επί ενός µικρού

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Για εισαγωγή στο Τμήμα Ιατρικής

Για εισαγωγή στο Τμήμα Ιατρικής Τμήμα Ιατρικής Της Σχολής Επιστημών Υγείας Του Α.Π.Θ. Οδηγός Κατατακτηρίων Εξετάσεων Για εισαγωγή στο Τμήμα Ιατρικής Ακαδημαϊκού έτους 2015-2016 1 Γενικές Οδηγίες Σύμφωνα με το Νόμο 4218/2013 και την Υπουργική

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

Στόχος µαθήµατος: ΒΙΟΣΤΑΤΙΣΤΙΚΗ ΙΙ. 1. Απλή γραµµική παλινδρόµηση. 1.2 Παράδειγµα 6 (συνέχεια)

Στόχος µαθήµατος: ΒΙΟΣΤΑΤΙΣΤΙΚΗ ΙΙ. 1. Απλή γραµµική παλινδρόµηση. 1.2 Παράδειγµα 6 (συνέχεια) ΠΜΣ ΕΠΑΓΓΕΛΜΑΤΙΚΗ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΥΓΕΙΑ, ΙΑΧΕΙΡΙΣΗ ΚΑΙ ΟΙΚΟΝΟΜΙΚΗ ΑΠΟΤΙΜΗΣΗ ΑΚ. ΕΤΟΣ 2006-2007, 3ο εξάµηνο ΒΙΟΣΤΑΤΙΣΤΙΚΗ ΙΙ. Απλή γραµµική παλινδρόµηση Παράδειγµα 6: Χρόνος παράδοσης φορτίου ΜΑΘΗΜΑ

Διαβάστε περισσότερα

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΛΥΣΗ ΑΣΚΗΣΗΣ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ α) Αφού τα σωµατικά κύτταρα της γάτας έχουν 19 ζεύγη οµολόγων χρωµοσωµάτων, άρα περιέχουν 38 απλοειδή χρωµοσώµατα στην αρχή της Μεσόφασης (G 1 -φάση), πριν

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ www.romvos.edu.gr ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α 1.Β 2.Γ 3.Α 4.Δ 5.Γ ΘΕΜΑ Β Β1) 1.Α 2.Β 3.Β 4.Α 5.Α 6.Α 7.Β 8.Β Β2) Σελ. 40 σχολικού βιβλίου : Κατά την έναρξη

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ

ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ ΑΠΟ ΤΟ ΒΙΒΛΙΟ ΜΟΥ (YΠΟ ΕΚ ΟΣΗ): ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ Β ΛΥΚΕΙΟΥ (Περιέχει 67 ερωτήσεις θεωρίας µε απαντήσεις, 116 ασκήσεις ανοικτού- κλειστού τύπου µε µ

Διαβάστε περισσότερα

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΔΟΜΗ ΚΑΙ ΒΛΑΣΤΗΣΗ ΤΩΝ ΣΠΕΡΜΑΤΩΝ

ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΔΟΜΗ ΚΑΙ ΒΛΑΣΤΗΣΗ ΤΩΝ ΣΠΕΡΜΑΤΩΝ ΔΠΘ - Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων ΦΥΣΙΟΛΟΓΙΑ ΦΥΤΩΝ ΔΟΜΗ ΚΑΙ ΒΛΑΣΤΗΣΗ ΤΩΝ ΣΠΕΡΜΑΤΩΝ Θερινό εξάμηνο 2011 ΣΠΕΡΜΑΤΟΦΥΤΑ Τα πιο διαδεδομένα είδη της γήινης βλάστησης βάση διατροφής

Διαβάστε περισσότερα

igenetics Mια Μεντελική προσέγγιση

igenetics Mια Μεντελική προσέγγιση igenetics Mια Μεντελική προσέγγιση Κεφάλαιο 19 Ρύθμιση της γονιδιακής έκφρασης σε βακτήρια και βακτηριοφάγους Ο καταστολέας του οπερονίου lac προσδεδεμένος στο DNA. 2 Ιδιοστατικά γονίδια Ρυθμιζόμενα γονίδια

Διαβάστε περισσότερα

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου

BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Tάσος Οικονόµου BIO408/BIO506 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Tάσος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2003

ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2003 ΜΑΘΗΜΑΤΙΚΑ ΚΑΙ ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ Γ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 00 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ ο Α Να αποδείξετε ότι η παράγωγος της συνάρτησης f(x) x είναι f (x) Β Πότε µια συνάρτηση f σε ένα διάστηµα

Διαβάστε περισσότερα

University of Cyprus Biomedical Imaging and Applied Optics. ΗΜΥ 370 Εισαγωγή στη Βιοϊατρική Μηχανική. Υπολογιστική Βιολογία και Βιοπληροφορική

University of Cyprus Biomedical Imaging and Applied Optics. ΗΜΥ 370 Εισαγωγή στη Βιοϊατρική Μηχανική. Υπολογιστική Βιολογία και Βιοπληροφορική University of Cyprus Biomedical Imaging and Applied Optics ΗΜΥ 370 Εισαγωγή στη Βιοϊατρική Μηχανική Υπολογιστική Βιολογία και Βιοπληροφορική Ορισμοί Ορισμοί του National Institutes of Health (NIH), USA

Διαβάστε περισσότερα

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ]

β. [Η 3 Ο + ] > 10-7 Μ γ. [ΟΗ _ ] < [Η 3 Ο + ] ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΑΞΗΣ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ): ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΣΥΝΟΛΟ

Διαβάστε περισσότερα

1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου

1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες. Τασος Οικονόµου 1 Απο την πρωτεΐνη στο πρωτεινωµα στις µοριακες µηχανες Τασος Οικονόµου Τι θα πούµε 1. Βασική πρωτεινική Βιοχηµεία 2. Πρωτεινες στο κυτταρικό περιβάλλον 3. Απο τις µεµονωµένες πρωτείνες στο πρωτεινωµικό

Διαβάστε περισσότερα

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί

Κεφαλαίο 3 ο. Μεταβολισμός. Ενέργεια και οργανισμοί Κεφαλαίο 3 ο Μεταβολισμός Ενέργεια και οργανισμοί Η ενέργεια είναι απαρέτητη σε όλους τους οργανισμούς και την εξασφαλίζουν από το περιβάλλον τους.παρόλα αυτά, συνήθως δεν μπορούν να την χρησιμοποιήσουν

Διαβάστε περισσότερα

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι

Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελίδα 123 σχολικού βιβλίου : Η διαδικασία που ακολουθείται... και εισάγεται πάλι σ αυτόν. Β2. Σελίδα 133

Διαβάστε περισσότερα

Στόχος µαθήµατος: ΒΙΟΣΤΑΤΙΣΤΙΚΗ ΙΙ. 1. Πολλαπλή γραµµική παλινδρόµηση. 1.2 Παράδειγµα 7 (συνέχεια)

Στόχος µαθήµατος: ΒΙΟΣΤΑΤΙΣΤΙΚΗ ΙΙ. 1. Πολλαπλή γραµµική παλινδρόµηση. 1.2 Παράδειγµα 7 (συνέχεια) ΠΜΣ ΕΠΑΓΓΕΛΜΑΤΙΚΗ ΚΑΙ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΥΓΕΙΑ, ΙΑΧΕΙΡΙΣΗ ΚΑΙ ΟΙΚΟΝΟΜΙΚΗ ΑΠΟΤΙΜΗΣΗ ΑΚ. ΕΤΟΣ 2006-2007, 3ο εξάµηνο ΒΙΟΣΤΑΤΙΣΤΙΚΗ ΙΙ ΜΑΘΗΜΑ 12β ΕΡΓΑΣΤΗΡΙΟ 4β ΠΟΛΛΑΠΛΗ ΓΡΑΜΜΙΚΗ ΠΑΛΙΝ ΡΟΜΗΣΗ ΜΕ ΤΗΝ ΧΡΗΣΗ SPSS

Διαβάστε περισσότερα

Στον πίνακα επιβίωσης θεωρούµε τον αριθµό ζώντων στην κάθε ηλικία

Στον πίνακα επιβίωσης θεωρούµε τον αριθµό ζώντων στην κάθε ηλικία ΚΕΦΑΛΑΙΟ 4 ΠΙΝΑΚΕΣ ΠΟΛΛΑΠΛΩΝ ΚΙΝ ΥΝΩΝ (MULTIPLE DECREMENT TABLES) Στον πίνακα επιβίωσης θεωρούµε τον αριθµό ζώντων στην κάθε ηλικία αρχίζοντας από µια οµάδα γεννήσεων ζώντων που αποτελεί την ρίζα του πίνακα

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕ ΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΦΑΡΜΟΣΜΕΝΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΝΕΥΡΩΝΙΚΑ ΙΚΤΥΑ

ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕ ΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΦΑΡΜΟΣΜΕΝΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΝΕΥΡΩΝΙΚΑ ΙΚΤΥΑ ΘΕΜΑ 1 ο (2.5 µονάδες) ΠΑΝΕΠΙΣΤΗΜΙΟ ΜΑΚΕ ΟΝΙΑΣ ΟΙΚΟΝΟΜΙΚΩΝ ΚΑΙ ΚΟΙΝΩΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΦΑΡΜΟΣΜΕΝΗΣ ΠΛΗΡΟΦΟΡΙΚΗΣ ΝΕΥΡΩΝΙΚΑ ΙΚΤΥΑ Τελικές εξετάσεις 21 Σεπτεµβρίου 2004 ιάρκεια: 3 ώρες Το παρακάτω σύνολο

Διαβάστε περισσότερα

Ανάλυση Διασποράς Ανάλυση Διασποράς διακύμανση κατά παράγοντες διακύμανση σφάλματος Παράδειγμα 1: Ισομεγέθη δείγματα

Ανάλυση Διασποράς Ανάλυση Διασποράς διακύμανση κατά παράγοντες διακύμανση σφάλματος Παράδειγμα 1: Ισομεγέθη δείγματα Ανάλυση Διασποράς Έστω ότι μας δίνονται δείγματα που προέρχονται από άγνωστους πληθυσμούς. Πόσο διαφέρουν οι μέσες τιμές τους; Με άλλα λόγια: πόσο πιθανό είναι να προέρχονται από πληθυσμούς με την ίδια

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013

ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΑΣΚΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΕΙΣΑΓΩΓΙΚΩΝ ΕΞΕΤΑΣΕΩΝ ΑΠΟ ΤΟ 2003-2013 ΧΡΙΣΤΙΝΑ ΠΕΡΔΙΟΥ ΒΙΟΛΟΓΟΣ (MSc) 1 ΠΕΡΙΕΧΟΜΕΝΑ ΕΝΟΤΗΤΑ ΣΕΛΙΔΑ Ενότητα 2 : Χημεία της ζωής 4 Ενότητα 3: Ενέργεια και οργανισμοί 13 Ενότητα 4: κυτταρική

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2012 ΕΚΦΩΝΗΣΕΙΣ

ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 2012 ΕΚΦΩΝΗΣΕΙΣ ΜΑΘΗΜΑΤΙΚΑ & ΣΤΟΙΧΕΙΑ ΣΤΑΤΙΣΤΙΚΗΣ ΓΕΝΙΚΗΣ ΠΑΙ ΕΙΑΣ 0 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Α. Αν οι συναρτήσεις f, g είναι παραγωγίσιµες στο, να αποδείξετε ότι (f() + g ()) f () + g (),. Μονάδες 7 Α. Σε ένα πείραµα µε ισοπίθανα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

3 Μεθοδολογία στη μελέτη ανάπτυξης των φυτών

3 Μεθοδολογία στη μελέτη ανάπτυξης των φυτών ΠΕΡΙΕΧΟΜΕΝΑ 1 Εισαγωγικές έννοιες 1.1. Η ΑΝΑΠΤΥΞΗ ΤΩΝ ΦΥΤΩΝ 1.1.1. Ανάπτυξη του γαμετόφυτου 1.1.2. Ανάπτυξη του σποριόφυτου (εμβρυογένεση) 1.1.3. Βλάστηση Πρωτογενής και δευτερογενής ανάπτυξη 1.2. ΣΥΝΤΟΝΙΣΜΟΣ

Διαβάστε περισσότερα

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΗΛΕΚΤΡΟΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ

ΠΟΛΥΤΕΧΝΕΙΟ ΚΡΗΤΗΣ ΤΜΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΗΛΕΚΤΡΟΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ ΤΜΗΜΑ ΗΛΕΚΤΡΟΝΙΚΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΗΛΕΚΤΡΟΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΤΟΜΕΑΣ ΤΗΛΕΠΙΚΟΙΝΩΝΙΩΝ Ελαχιστοποίηση χαρακτηριστικών ταξινομητή για γονιδιακή σύνθεση ΑΚΑΔΗΜΑΪΚΟ ΕΤΟΣ : 2008 2009 ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Διαβάστε περισσότερα

----------Εισαγωγή στη Χρήση του SPSS for Windows ------------- Σελίδα: 0------------

----------Εισαγωγή στη Χρήση του SPSS for Windows ------------- Σελίδα: 0------------ ----------Εισαγωγή στη Χρήση του SPSS for Windows ------------- Σελίδα: 0------------ ΚΕΦΑΛΑΙΟ 9 ο 9.1 ηµιουργία µοντέλων πρόβλεψης 9.2 Απλή Γραµµική Παλινδρόµηση 9.3 Αναλυτικά για το ιάγραµµα ιασποράς

Διαβάστε περισσότερα

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι

ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΒΙΟΛΟΓΙΑΣ Ι ΛΕΙΤΟΥΡΓΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΓΟΝΙΔΙΩΜΑΤΙΚΗ ΥΨΗΛΗΣ ΑΝΑΛΥΣΗΣ ΟΡΓΑΝΙΣΜΩΝ ΜΟΝΤΕΛΩΝ in vivo Δρ. Γεώργιος Μαρκόπουλος, Ph.D. Βιολόγος, Μεταδιδακτορικός Ερευνητής και Ευάγγελος Κωλέττας,

Διαβάστε περισσότερα

Εκπαιδευτική Έρευνα: Μέθοδοι Συλλογής και Ανάλυσης εδομένων Έλεγχοι Υποθέσεων

Εκπαιδευτική Έρευνα: Μέθοδοι Συλλογής και Ανάλυσης εδομένων Έλεγχοι Υποθέσεων Εκπαιδευτική Έρευνα: Μέθοδοι Συλλογής και Ανάλυσης εδομένων Έλεγχοι Υποθέσεων Ένα Ερευνητικό Παράδειγμα Σκοπός της έρευνας ήταν να διαπιστωθεί εάν ο τρόπος αντίδρασης μιας γυναίκας απέναντι σε φαινόμενα

Διαβάστε περισσότερα

ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ

ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΜΑΘΗΜΑΤΙΚΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ ΘΕΜΑ Α A Να αποδείξετε ότι η συνάρτηση f () είναι παραγωγίσιμη στο R με f () Α Αν είναι οι τιμές μιας μεταβλητής Χ ενός δείγματος παρατηρήσεων μεγέθους ν ( ) να ορίσετε την

Διαβάστε περισσότερα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Το γονιδίωμα περιλαμβάνει τόσο τα γονίδια όσο και τις μη κωδικοποιούσες ακολουθίες DNA. Ο όρος προτάθηκε το 1920 από τον καθηγητή Hans

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή.

3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική αναπνοή. 5ο ΓΕΛ ΧΑΛΑΝΔΡΙΟΥ Μ. ΚΡΥΣΤΑΛΛΙΑ 2/4/2014 Β 2 ΚΕΦΑΛΑΙΟ 3 ΒΙΟΛΟΓΙΑΣ 3.1 Ενέργεια και οργανισμοί..σελίδα 2 3.2 Ένζυμα βιολογικοί καταλύτες...σελίδα 4 3.3 Φωτοσύνθεση..σελίδα 5 3.4 Κυτταρική

Διαβάστε περισσότερα

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες:

Α4. Να μεταφέρετε στο τετράδιό σας τις παρακάτω χημικές εξισώσεις σωστά συμπληρωμένες: ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 18 ΜΑΪΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ - ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΥΚΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΠΑΡΑΓΩΓΗΣ)

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα