http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology mrna
|
|
- Μάξιμος Μανωλάς
- 7 χρόνια πριν
- Προβολές:
Transcript
1 ISSN CN / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology ~ 479 FGF * fibroblast growth factor 5 FGF5 FGF5 PCR Western FGF5 mrna PCR FGF P < 0 01 Western FGF5 FGF5 P < 0 01 FGF5 5 PCR Western Q78 S852 FGF5 Expression and Immunolocalization in Back and Ear Skin of Young Alpaca Lama pacos LIU Dan-Dan 1 ZHANG Zhi-Yu 2 HE Xiao-Yan 1 * DONG Yan-Jun 1 ZHU Zhi-Wei 1 BAI Rui 1 ZHANG Jie 1 HAO Huan-Qing 1 XING Hai-Quan 1 1 College of Animal Science and Technology Shanxi Agricultural University Taigu 2 Shanghai Heng Feng Qiang Animal Pharmaceutical Co LTD Shanghai China China Abstract Alpaca Lama pacos is a fiber-producing animal of commercial importance The quality and growth of hair at the ear and back skin are different The fibroblast growth factor 5 FGF5 affects hair length in a diverse set of mammalian species Mutations in FGF5 lead to recessive long hair phenotypes in mice dogs and cats and were implicated contributing to the hair length variation in rabbits The aim of this study was to explore the function of FGF5 in the regulation of alpaca hair development and growth by comparing its expression and immunolocalization in the ear and back skin of young alpaca The mrna and protein levels of FGF5 were determined by real-time PCR Western blot and immunohistochemistry The results showed that the FGF5 gene was expressed in alpaca skin reliably The gene expression No No XB * Tel hexiaoyan630805@ yahoo com cn Received December Accepted March Supported by Shanxi Science and Technology Issue Foundation No and Shanxi Agricultural University Research Startup Project for Introducing Talents in 2009 No XB * Corresponding author Tel hexiaoyan630805@ yahoo com cn
2 quantity of FGF5 in ear skin of alpaca was times than that in back The distribution of FGF5 in alpaca skin were demonstrated and the expression was notable difference between the ear and back skin of young alpaca based on the average optical density Our findings showed that FGF5 might be involved in the regulation of hair development and growth of alpaca and might inhibit the hair growth in alpaca Key words fibroblast growth factor 5 alpaca real-time PCR Western blot immunohistochemistry alpaca Lama pacos FGF5 FGF5 90% FGF5 FGF5 1 ~ 3 let-7b PCR mirna let-7b 8 mm 3 let-7b 2 RNA 5 fibroblast growth factor 5 FGF5 1 Bouin's FGF5 23 FGFs FGF5 FGF Trizol Reagent Invitrogen 1994 Hebert 5 FGF5 PrimeScript TM RT reagent Kit SYBR Premix Ex Taq TM Ⅵ Ⅱ Perfect Real Time Marker NC Sundberg 6 TaKaRa 2 Taq Angora MasterMix BCA HRP- FGF5 2kb IgG Housley 7 β FGF5 FGF5 DAB Kehler 8 Drogemuller 9 FGF5 1 2 RNA 10 FGF5 RNA 1% RNA ND-100 Roca 11 RNA FGF5 RNA 10 μl 2 FGF5 5 PrimeScript TM 2 μl PrimeScript TM RT Enzyme Mix 0 5 μl Oligo dt 25 pmol Random 6 mers 50 pmol RNA 1 μl 10 μl PCR min 85 5 s PCR PCR FGF5 NCBI
3 5 FGF5 475 FGF5 cdna FGF5 mrna 2 - ΔΔCT Primer 3 0 plus FGF5 1 6 Western NCBI Blast FGF5 BCA Table 1 Table 1 genes Gene FGF5 β-actin Primer sequences of target and house-keeping Primer sequences F 5'-GTTCAGGGAGCGATTTCAAG-3' R 5'-AAAGAAAGTTCCGGCTGCTC-3' F 5'-ACCCTCATAGATGGGCACAAG-3' R 5'-AGCCATGTACGTAGCCATCC-3' Product / bp TBST 3 PCR 5 min HRP- Taq MasterMix 12 5 μl IgG TBST h 10 μmol / L 1 μl cdna1 μl 500 ~ ng TBST 3 10 min DAB 25 μl PCR ~ 5 min min s s s β min PCR Image-pro plus 6 0 Media 1% Cybernetics FGF5 β DNA western DNA - 20 FGF5 = 1 4 PCR = FGF5 / β cdna FGF5 β Table 1 SPSS 17 0 PCR SYBR Premix Ex Taq TM Ⅱ μl PCR Forward Primer μmol / L 0 8 μl PCR Reverse Primer 10 μmol / L Bouin's 0 8 μl ROX Reference DyeⅡ μl cdna 1 0 μl 20 0 μl 30 s 95 5 s s s min s s FGF5 45 3% H 2 O 2 10 min PBS β 3 20 min PCR FGF5 4 C t 1 5 PCR 100 HRP- IgG min SPSS17 0 PBS 4 5 min DAB β 3 ~ 5 min PBS 3 3 min 2 - ΔΔCt FGF5 2 5 PBS ΔC t = C t -C t 1 8 ΔΔC t = ΔC t - ΔC t SDS-PAGE 12% 4% Marker 60 μg 30 min NC NC 5% 1 h FGF5 TBST μm 3 3 min 5% 30 min PBS 3 3 min 1 Image-pro plus 6 0 FGF5
4 S 4 5 SPSS 17 0 Fig 2A ± Mean ± S D FGF5 cdna PCR Fig 2B T m 1 PCR bp 2 - ΔΔCt FGF5 2 5 PCR Fig 1 FGF Fig 2C 2 3 FGF5 Western FGF5 Fig 3A FGF5 P < 0 01 Fig 3B Fig 1 PCR analysis of FGF5 in alpaca skin Total RNA was extracted from alpaca skin After cdna was synthesized FGF5 gene was amplified by PCR using specific primers PCR products were analyzed on 1% agarose gels 1 Negative control 2 3 PCR products of FGF5 gene M DL2000 DNA marker 5'-GT- Fig 3 Western blot analysis of FGF5 protein in TCAGGGAGCGTTTCAAGAGAACAGCTATAACACCT alpaca skin A The level of FGF5 protein was ATGCCTCAGTGATACACAGAACTGAGAACACGGG detected by Western blotting Protein extracts were GCGGGAGTGGTACGTGGCCCTGAACAAGAGGGGG separated by 12% SDS-PAGE Western blot were probed AAAGCTAAACGGGGCTGCAGCCCCCGGGTTAAAC with rabbit anti-fgf5 polyclonal antibody and goat antirabbit IgG conjugated with HRP as the second antibody CCCAGCACGTCTCCACTCACTTTCTGCCAAGATTTA AGCAATCGGAGCAGCCGGAACTTTCTTTA-3' then detected colorimetrically using a DAB detection kit DNAMAN FGF5 1 2 and 3 FGF5 protein in ear skin of alpaca 4 5 and NCBI 6 FGF5 protein in back skin of alpaca β-actin was 93% used as the internal control Each lane was from an FGF5 individual alpaca B Quantitative analysis of Western 2 2 FGF5 blots in panel A The level of FGF5 protein was normalized against the level of β-actin Bars in each panel represent the mean ± S D of three replicate PCR FGF5 expriments ** P < 0 01
5 5 FGF5 477 Fig 2 Real-time PCR analysis of the expression of FGF5 mrna A Real-time PCR amplification plots for FGF5 and β-actin B Real-time PCR dissociation curve for FGF5 and β-actin C Real-time PCR analysis of FGF5 abundance in different areas of skin samples collected from alpacas with back vs ear n = 3 each After real-time PCR amplification plots and dissociation curve analysis and judgement the Ct values could be used for datas analysis through 2 - ΔΔCT Abundance of FGF5 was normalized relative to abundance of β-actin Bars in each panel represent the mean ± S D of three independent expriments ** P < 0 01 Fig 4 Immunohistochemistry analysis of FGF5 protein in different areas of skin samples collected from alpacas with back vs ear The localization of FGF5 protein in ear and back skin of alpaca was detected by immunohistochemistry Immunohistochemistry were probed with rabbit anti-fgf5 polyclonal antibody and goat anti-rabbit IgG conjugated with HRP as the second antibody then detected colorimetricly using a DAB detection kit PBS buffer took the place of rabbit anti-fgf5 polyclonal antibody as negative control A Experiment group in ear skin of alpaca B Negative control in ear skin of alpaca C Experiment group in back skin of alpaca D Negative control in back skin of alpaca indicates root sheath shows hair medulla shows the hair matrix cell
6 FGF5 FGF5 FGF5 FGF5 FGF5 Fig 4 FGF5 Table 2 FGF5 21 FGF5 P < Table 2 Average optical density of FGF5 positive signal in FGF5 1 Bgl I alpaca hair follicle n = 3 Location Back of alpaca Ear of aplaca FGF5 Root sheath Hair matrix cell Hair medulla ± A ± A ± A ± B ± B ± B All data represent the mean ± S D of three replicate experiments In the same column different capital letters mean extremely significant difference FGF5 Hebert 5 FGF5 mrna FGF5 mrna Ⅵ 1 / FGF5 mrna Suzuki 17 FGF5 FGF-5S FGF5 anagen catagen FGF5 telogen 12 FGF5 FGF5 1 FGF5 13 FGF FGF5 FGF5 50% 15 ~ FGF5 20 FGF5 mrna FGF5 mrna FGF5 FGF5-5S FGF5 FGF5 FGF5 FGF5-5S mrna let-7b 4 FGF5 let-7b FGF5 Western FGF5 mrna References FGF5 FGF5 1 Zhu Z He J Jia X et al MicroRNA-25 functions in regulation
7 5 FGF5 479 of pigmentation by targeting the transcription factor MITF in alpaca Lama pacos skin melanocytes J Domest Anim Endocrinol Dong Y Cao J Wang H et al Nitrc oxide enhances the sensitivity of alpaca melanocytes to respond to α-melanocytestimulating hormone by up-regulation melanocortin-1 receptor J Biochem Biophys Res Commun B hair cycle J Arch Dermatol Res J Geng J J Mu X L Sun L T et al Expression and immunolocalization of enodothelin receptor B in alpaca skin of different colors J Acta Vet Zootech Sin Ota Y Saitoh Y Suzuki S et al Fibroblast growth factor 5 mirna J inhibits hair growth by blocking dermal papilla cell activation He X Y Hao H Q Liu D D et al Differential microrna expression in ear and back skin in young alpaca Vicugna pacos J Chin J Biochem Mol Biol Hebert J M Rosenquist T Gotz J et al FGF5 as a regulator of the hair growth cycle evidence from targeted and spontaneous mutations J Cell Sundberg J P Rourk M H Boggess D et al Angora mouse mutation altered hair cycle follicular dystrophy phenotypic maintenance of skin grafts and change in keratin expression J Vet Pathol Housley D J Venta P J The long and the short of it evidence that FGF5 is a major determinant of canine hair'-itability J Anim Genet Kehler J S David V A Schaffer A A et al Four independent mutations in the feline fibroblast growth factor 5 gene determine the long-haired phenotype in domestic cats J J Hered Drogemuller C Rufenacht S Wichert B et al Mutations within the FGF5 gene are associated with hair length in cats J Anim Genet J Liu H Y Yang G Q Zhang W et al FGF5 SNP J Li C Effects of FGF5gene on fiber traits on inner Mongolian cashmere X Jiang M S Chen S Y et al Correlation analysis between goats J J Hereditas Beijing single nucleotide polymorphism of FGF5 gene and wool yield in rabbits J Hereditas Beijing Roca A L Ishida Y Nikolaidis N et al Genetic variation at hair length candidate genes in elephants and the extinct woolly mammoth J BMC Evol Biol Ryan A F The cell cycle and the development and regeneration of hair cells J Curr Top Dev Biol J Liu Z H Ren L M GuoY et al The cyclical variation and regulation of hair follicles and the study on cashmere goat J China Anim Husb Vet Med Peth -Schramm A Müller H J Paus R FGF5 and the mufine 15 Rosenquist T A Martin G R Fibroblast growth factor signailing in the hair growth cycle expression of the fibroblast growth factor receptor and ligand genes in the marine hair follicle J Dev Dyn J Biochem Biophys Res Commun Suzuki S Kato T Takimoto H et al Localization of rat FGF5 protein in skin macrophage-like cells and FGF-5S protein in hair follicle possible involvement of two Fgf5 gene products in hair growth cycle regulation J J Invest Dermato Suzuki S Ota Y Ozawa K et al Dual-mode regulation of hair growth cycle by two FGF-5 gene products J J Invest Dermatol Ito C Saitoh Y Fujita Y et al Decapeptide with fibroblast growth factor FGF 5 partial sequence inhibits hair growth suppressing activity of FGF5 J J Cell Physiol Konyukhov B V Martynova Mlu Nesterova A P Gene angora as a modifier of the hairless gene in mouse J Genetika FGF5 SNP J Gao A Q Li J Q Li N et al The SNP bioinformatics analysis of FGF5 gene in sheep J Chin J Anim Sci FGF FGF5 D Han Sarula Study in the cyclical role growth-contorl of fibroblast growth factor 5 FGF5 goat hair D Rnuinant animal genetic and production Hohhot Inner Mongolia Agricultural University 2009
Cellular Physiology and Biochemistry
Original Paper 2016 The Author(s). 2016 Published The Author(s) by S. Karger AG, Basel Published online: November 25, 2016 www.karger.com/cpb Published by S. Karger AG, Basel 486 www.karger.com/cpb Accepted:
Διαβάστε περισσότεραhttp / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 2016 5 32 5 578 ~ 586 DOI 10. 13865 /j. cnki. cjbmb. 2016. 05. 14 α- * 030801 α- α-melanocyte-stimulating
Διαβάστε περισσότεραIL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2
344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.
Διαβάστε περισσότεραIdentification of Fish Species using DNA Method
5 * * * Identification of Fish Species using DNA Method Yuumi KAWASHIMA*, Takayuki KATAYAMA* and Yukihiko YAMAZAKI* *Central Customs Laboratory, Ministry of Finance 6-3-5, Kashiwanoha, Kashiwa, Chiba 277-0882,
Διαβάστε περισσότεραLocalization and Expression of EDN3 in Mouse Skin with Different Coat Colors
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology 2016 3 32 3 339 ~ 345 DOI 10. 13865 /j. cnki. cjbmb. 2016. 03. 15 3 1 1 2 1 1 1 3 * 1 030801
Διαβάστε περισσότεραNucleotide Sequence of Cloned cd NA for alpha Subunit of Goat Follicle Stimulating Hormone
ISSN 100727626 CN 1123870ΠQ 2002 12 Chinese Journal of Biochemistry and Molecular Biology 18 (6) :693 697 cdna, 3, (, 150030) RNA, cdna cdna PCR, 380 bp cdna pmd2182t2verctor 3,,, 96 %, 95 %,, 74 %, 95
Διαβάστε περισσότεραOptimizing Microwave-assisted Extraction Process for Paprika Red Pigments Using Response Surface Methodology
2012 34 2 382-387 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com 212018 105 W 42 2 min 0. 631 TS202. 3 A 1000-2286 2012 02-0382 - 06 Optimizing
Διαβάστε περισσότερα30s 56 60s 72 60s dntp cm s s s 23
31 3 Vol 31 No 3 2012 8 JOURNAL OF OCEANOGRAPHY IN TAIWAN STRAIT Aug 2012 AFLP 1 1 2 1 1 361005 2 361005 dntp Taq Mg 2 + 300 ng DNA 5U PstI 5U MseI 4 h 16 10 50 AFLP AFLP 64 12 AFLP DOI 10 3969 /J ISSN
Διαβάστε περισσότεραThe toxicity of three chitin synthesis inhibitors to Calliptamus italicus Othoptera Acridoidea
2011 48 4 909 914 * 1 2** 2 2 2 2 2*** 1. 110161 2. 100081 026000 3 Calliptamus italicus L. 3 LC 50 LC 90 1. 34 14. 17 mg / L LC 50 LC 90 2. 09 45. 22 mg / L 50 mg / L 14 d 87% 100% 50 mg / L 50% The toxicity
Διαβάστε περισσότεραΜελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου Cyld στον καρκίνο του μαστού
Σχολή Θετικών Επιστημών Τμήμα Βιολογίας Πρόγραμμα Μεταπτυχιακών Σπουδών Κατεύθυνση: Εφαρμοσμένη γενετική και βιοτεχνολογία ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Μελέτη της έκφρασης του ογκοκατασταλτικού γονιδίου
Διαβάστε περισσότεραScience of Sericulture
Science of Sericulture 2012 38 1 0065-0069 ISSN 0257-4799 CN 32-1115 /S E-mail CYKE@ chinajournal. net. cn 215123 25 0 ~ 24 h GSH GSSG GSH + 2GSSG GSH /GSSG S- GST TPX 23% GR 57% GSH TPX GST GSSG 61% GSH
Διαβάστε περισσότερα,,, (, 100875) 1989 12 25 1990 2 23, - 2-4 ;,,, ; -
25 3 2003 5 RESOURCES SCIENCE Vol. 25 No. 3 May 2003 ( 100875) : 500L - 2-4 - 6-8 - 10 114h - 120h 6h 1989 12 25 1990 2 23-2 - 4 : ; ; - 4 1186cm d - 1 10cm 514d ; : 714 13 317 714 119 317 : ; ; ; :P731
Διαβάστε περισσότεραα 1 2- Cloning and Expression of alpha 1 2-fucosyltransferase in E. coli BIOTECHNOLOGY BULLETIN
BIOTECHNOLOGY BULLETIN 2011 3 α 1 2-300457 PCR Helicobacter pylori HP DNA α 1 2- α 1 2-fucosyltransferase α 1 2-fuct 906 bp pet-22b + pet-fuct BL21 DE3 25 0. 1 mmol /L IPTG 4 h SDS-PAGE 33 kd α 1 2- BL21
Διαβάστε περισσότεραAntimicrobial Ability of Limonene, a Natural and Active Monoterpene
2010,32 (1) :24 28 http :/ / xuebao. jlau. edu. cn Journal of Jilin Agricultural University E2mail : jlndxb @vip. sina. com Ξ,,,, ΞΞ, 200062 : : 320 mg/ L,; ph 4 9, ; 80, 100,121 : : ; ; : TS20213 : A
Διαβάστε περισσότεραGro wth Properties of Typical Water Bloom Algae in Reclaimed Water
31 1 2010 1 ENVIRONMENTAL SCIENCE Vol. 31,No. 1 Jan.,2010, 3, (,, 100084) :,.,, ( Microcystis aeruginosa),3 (A 2 O ) 10 6 ml - 1,> 0139 d - 1. A 2 O222,. TP ( K max ) ( R max ), Monod. :; ; ; ; :X173 :A
Διαβάστε περισσότεραΜΟΡΙΑΚΕΣ ΜΕΘΟΔΟΙ ΚΡΙΤΗΡΙΑ ΕΠΙΛΟΓΗΣ ΑΞΙΟΛΟΓΗΣΗ
- - ό ό : Ω ί ό ί ώ.. ά ή ί ός ή ς ύ ί ί ή έ ώ ό. ή ς ά ς ής ό ός ά ς ή έ ός ή ς ί ής ί ς. ό έ ώ - ώ ή ής ή ς- ί ά ά ς ί ς. ά ί ί έ έ ά ύ ή, ό ί ά, ό ό ά έ ά ής ί ύ George Wald ή ί έ ς ί ύ ό ς ί ς ά έ
Διαβάστε περισσότεραΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ
ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΠΡΑΓΜΑΤΙΚΟΥ ΧΡΟΝΟΥ ΣΠΑΝΑΚΗΣ ΝΙΚΟΣ Αρχή λειτουργίας Real-time PCR * Βασίζεται στην ανίχνευση και ποσοτικοποίηση του φθορισμού που εκπέμπεται από ειδικά φθοριοχρώματα * Η αρχική αύξηση
Διαβάστε περισσότεραHigh mobility group 1 HMG1
Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1
Διαβάστε περισσότερα,HLA2B2704,, The Technique of Producing HLA2B2704 Gene Transgenic Mice. Chinese Journal of Biochemistry and Molecular Biology HLA2 B2704 ,1,2 Q33,Q78
ISSN 100727626 CN 1123870ΠQ 2002 4 Chinese Journal of Biochemistry and Molecular Biology 18 (2) :245 249 HLA2B2704 3 2) ( 2) 100044) HLA2B2704 286 HLA2B2704 DNA ( HLA2B2704 DNA) PCR F0 F1 RT2PCR HLA2B2704
Διαβάστε περισσότεραA strategy for the identification of combinatorial bioactive compounds. contributing to the holistic effect of herbal medicines
1 2 Supplementary information 3 4 A strategy for the identification of combinatorial bioactive compounds contributing to the holistic effect of herbal medicines 5 6 Fang Long 1, Hua Yang 1, Yanmin Xu,
Διαβάστε περισσότερα( ) , ) , ; kg 1) 80 % kg. Vol. 28,No. 1 Jan.,2006 RESOURCES SCIENCE : (2006) ,2 ,,,, ; ;
28 1 2006 1 RESOURCES SCIENCE Vol. 28 No. 1 Jan. 2006 :1007-7588(2006) 01-0002 - 07 20 1 1 2 (11 100101 ; 21 101149) : 1978 1978 2001 ; 2010 ; ; ; : ; ; 24718kg 1) 1990 26211kg 260kg 1995 2001 238kg( 1)
Διαβάστε περισσότεραSampling Basics (1B) Young Won Lim 9/21/13
Sampling Basics (1B) Copyright (c) 2009-2013 Young W. Lim. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.2 or any
Διαβάστε περισσότεραCPT. Tsuchiya. beta. quantitative RT PCR QIAGEN IGFBP. Fect Transfection Reagent sirna. RT PCR RNA Affymetrix GeneChip Expression Array
7 PTEN p Tsuchiya DNA Hepatocyte nuclear factor beta HNF beta HNFbeta IGFBP GLUT G Pase MODY maturity onset diabetes of the young Tsuchiya HNFbeta HNFbeta HNFbeta sirna CPT HNFbeta HNFbeta TOVG KOC ESMCAS
Διαβάστε περισσότερα1 h, , CaCl 2. pelamis) 58.1%, (Headspace solid -phase microextraction and gas chromatography -mass spectrometry,hs -SPME - Vol. 15 No.
2 0 1 5 7 Journal of Chinese Institute of Food Science and Technology Vol. 15 No. 7 Jul. 2 0 1 5 1,2 1 1 1 1* ( 1 315211 2 315502) : ( ) : (E-Nose), - : GC-MS, 20.98% 2.5%, 53.15% 11.2%, 0. 51% 71.86%
Διαβάστε περισσότεραRapid determination of soluble reactive silicate in seawater by flow injection analysis with spectrophotometric detection and its application
31 5 2011 5 Acta Scientiae Circumstantiae Vol 31 No 5 May 2011 2011 - J 31 5 935-940 Huang Y M Yuan D X Peng Y Z et al 2011 Rapid determination of soluble reactive silicate in seawater by flow injection
Διαβάστε περισσότεραhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology Aβ42 Alzheimer's disease AD insulin degrading enzyme IDE.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 1 29 1 70 ~ 75 PPARγ IDE TNF-α Aβ42 430030 metformin MET MET β- β-amyloid Aβ Alzheimer's
Διαβάστε περισσότερα, DYY-8B, ; : Centrifuge 11 R. min
40 Chinese Journal of Otology Vol. 8 No.1 2010 DNA A1555G - ( 030001) 2 12 68 DNA (polymerase chain reaction PCR) DNA A1555G 7 DNA 12S rrna 1555 A G A1555G ; DNA A1555G ; ; ; R764.433 R342.4 A 1672-2922(2010)01-040-06
Διαβάστε περισσότερα, SLC26A4 HEK 293. The construction of wild-type SLC26A4 gene expression vector and the expression in HEK293 cells
2011 9 1 77 SLC26A4 HEK 293 1 2 1 1 1 1 (100853) 2 ( 050051) SLC26A4 (pegfp enhanced green fluorescent protein) SLC26A4 pegfp-slc26a4 HEK293 pegfp-slc26a4 HEK293 - (RT-PCR) SLC26A4 mrna Western Blot (
Διαβάστε περισσότεραCorV CVAC. CorV TU317. 1
30 8 JOURNAL OF VIBRATION AND SHOCK Vol. 30 No. 8 2011 1 2 1 2 2 1. 100044 2. 361005 TU317. 1 A Structural damage detection method based on correlation function analysis of vibration measurement data LEI
Διαβάστε περισσότεραΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ. Πτυχιακή εργασία
ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΤΡΟΦΙΜΩΝ Πτυχιακή εργασία ΜΕΛΕΤΗ ΠΟΛΥΦΑΙΝΟΛΩΝ ΚΑΙ ΑΝΤΙΟΞΕΙΔΩΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΣΟΚΟΛΑΤΑΣ Αναστασία Σιάντωνα Λεμεσός
Διαβάστε περισσότερα; +302 ; +313; +320,.
1.,,*+, - +./ +/2 +, -. ; +, - +* cm : Key words: snow-water content, surface soil, snow type, water permeability, water retention +,**. +,,**/.. +30- +302 ; +302 ; +313; +320,. + *+, *2// + -.*, **. **+.,
Διαβάστε περισσότεραShiraia sp. Slf14 III
39 4 Vol 39 No 4 2015 7 Journal of Jiangxi Normal University Natural Science Jul 2015 1000-5862 2015 04-0430-05 Shiraia sp Slf14 III 1 1 2 1 1 1 2* 1 330022 2 330013 Polyketide synthase PKS Shiraia sp
Διαβάστε περισσότεραA Systematic Review of Procalcitonin for Early Detection of Septicemia of Newborn
56 [ ] 167-3619(009)03-056-05 Journal of Tropical Medicine Vol.9 No.3 Mar.009 * ( 510515) (PCT) CNKI VIP PCT QUADAS Metadisc1.4 DOR (SROC) SROC (AUC) Review Manager5 Meta 8 ; 7 8 (χ =3.8P=0.858I =0.0%)
Διαβάστε περισσότεραCorrection of chromatic aberration for human eyes with diffractive-refractive hybrid elements
5 5 2012 10 Chinese Optics Vol. 5 No. 5 Oct. 2012 1674-2915 2012 05-0525-06 - * 100190-14 - - 14. 51 μm 81. 4 μm - 1. 64 μm / O436. 1 TH703 A doi 10. 3788 /CO. 20120505. 0525 Correction of chromatic aberration
Διαβάστε περισσότεραΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ
1 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 04.02.2014 Αρ. πρωτ. 1054 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης
Διαβάστε περισσότερα[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,
in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro
Διαβάστε περισσότεραHOMEWORK 4 = G. In order to plot the stress versus the stretch we define a normalized stretch:
HOMEWORK 4 Problem a For the fast loading case, we want to derive the relationship between P zz and λ z. We know that the nominal stress is expressed as: P zz = ψ λ z where λ z = λ λ z. Therefore, applying
Διαβάστε περισσότεραEffects of Chlorogenic Acid on the Activity of Cultured Osteoblasts in vitro
32 2 Vol 32 No 2 2013 6 Journal of South-Central University for NationalitiesNat Sci Edition Jun 2013 1 1 1 1 1 2* 1 4300742 430074 CGA MC3T3-E1 MTT 11 02 22 05 44 0988 19μmol /L CGA ALP PCR 11 02 ~ 88
Διαβάστε περισσότεραTGFp FSH INH INH
(210095) E-mail ( genlinwang@hotmail.com) - -(Strept Avidin-Biotin-Peroxidase Complex SABC), 1 32,, 1 inhibin INH α 32 000 TGFp FSH FSH [1] INHα Sertoli Noguchi 1997 [2] Meunier et al.1988 [3] INH INH
Διαβάστε περισσότεραDifferential Expression of DNMTs Between Gastric Tissues with and without H. Pylori Infection
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2011 11 27 11 1032 ~ 1038 DNMT 1 2 3 1 1 4 1 * 1 400016 2 400016 3 400016 4 400016 DNA DNA
Διαβάστε περισσότεραQ L -BFGS. Method of Q through full waveform inversion based on L -BFGS algorithm. SUN Hui-qiu HAN Li-guo XU Yang-yang GAO Han ZHOU Yan ZHANG Pan
3 2015 12 GLOBAL GEOLOGY Vol. 3 No. Dec. 2015 100 5589 2015 0 1106 07 L BFGS Q 130026 Q 2D L BFGS Marmousi Q L BFGS P631. 3 A doi 10. 3969 /j. issn. 1005589. 2015. 0. 02 Method of Q through full waveform
Διαβάστε περισσότερα1 (forward modeling) 2 (data-driven modeling) e- Quest EnergyPlus DeST 1.1. {X t } ARMA. S.Sp. Pappas [4]
212 2 ( 4 252 ) No.2 in 212 (Total No.252 Vol.4) doi 1.3969/j.issn.1673-7237.212.2.16 STANDARD & TESTING 1 2 2 (1. 2184 2. 2184) CensusX12 ARMA ARMA TU111.19 A 1673-7237(212)2-55-5 Time Series Analysis
Διαβάστε περισσότεραsvari Real-time RT-PCR RSV
19 39-43 12 Real-time RS svarireal-time RSV subgroup HMPV RSV N Real-time 100 100 Real-time RSV subgroup RSV HMPV F Real-time 55.8 95.5 genotype A2 B1 TaqMan svari InfV RS RSV HMPV HRV PIV RSV HMPV RSV
Διαβάστε περισσότεραhttp / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology human telomerase reverse transcriptase htert
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2013 4 29 4 383 ~ 388 PCR htert mrna 1 2 2 3 1 1 2 2 1 1 530021 2 530021 3 * 3 530021 human
Διαβάστε περισσότεραStress Relaxation Test and Constitutive Equation of Saturated Soft Soil
8 7 011 7 Journal of Highway and Transportation Research and Development Vol. 8 No. 7 Jul. 011 100-068 011 07-0014 - 05 1 1. 0009. 710064 k 0 Merchant 4 Merchant U416. 1 + 6 A Stress Relaxation Test and
Διαβάστε περισσότεραJournal of Ningxia Medical University BRCA2. M2610I 2405 delt stp ± t = P > %
33 6 2011 6 Journal of Ningxia Medical University 515 1674-6309 2011 06-0515 - 04 16 BRCA2 1 2 2 1 3 1. 750004 2. 750021 3. 750004 16-2 BRCA2 16 16 30 PCR BRCA2 16 3 18. 75% 2 M2610I 2405 delt stp729 1
Διαβάστε περισσότεραNov Journal of Zhengzhou University Engineering Science Vol. 36 No FCM. A doi /j. issn
2015 11 Nov 2015 36 6 Journal of Zhengzhou University Engineering Science Vol 36 No 6 1671-6833 2015 06-0056 - 05 C 1 1 2 2 1 450001 2 461000 C FCM FCM MIA MDC MDC MIA I FCM c FCM m FCM C TP18 A doi 10
Διαβάστε περισσότεραAccumulation of Soil Arsenic by Panax notoginseng and Its Associated Health Risk
32 3 2011 3 ENVIRONMENTAL SCIENCE Vol 32 No 3 Mar 2011 1 1 1 2 1 100101 2 663000 Panax notoginseng Burk F H Chen 6 9 ~ 242 0 mg kg - 1 48% 2 mg kg - 1 24% 81% 14% 57% 44% 100 mg kg - 1 ADI > > > > FAO
Διαβάστε περισσότεραResurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo
Bull. Earthq. Res. Inst. Univ. Tokyo Vol. 2.,**3 pp.,,3,.* * +, -. +, -. Resurvey of Possible Seismic Fissures in the Old-Edo River in Tokyo Kunihiko Shimazaki *, Tsuyoshi Haraguchi, Takeo Ishibe +, -.
Διαβάστε περισσότερα[1] P Q. Fig. 3.1
1 (a) Define resistance....... [1] (b) The smallest conductor within a computer processing chip can be represented as a rectangular block that is one atom high, four atoms wide and twenty atoms long. One
Διαβάστε περισσότερα2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb. 2 0 1 2 SNAT2. HEK293T Western blot SNAT2 - HA Q 31 A 1000-5137 2012 01-0083-06
4 1 1 Vol 41 No 1 2 0 1 2 2 Journal of Shanghai Normal University Natural Sciences Feb 2 0 1 2 SNAT2 - HA * 200234 SNAT2 - SNAT2 PCR HA SNAT2 C pbk - CMVΔ 1098-1300 - SNAT2 - HA HEK293T Western blot SNAT2
Διαβάστε περισσότεραCongruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Διαβάστε περισσότεραLUO, Hong2Qun LIU, Shao2Pu Ξ LI, Nian2Bing
2003 61 3, 435 439 ACTA CHIMICA SINICA Vol 61, 2003 No 3, 435 439 2 ΞΞ ( 400715), 2, 2, 2, 3/ 2 2,, 2,, Ne w Methods for the Determination of the Inclusion Constant between Procaine Hydrochloride and 2Cyclodextrin
Διαβάστε περισσότεραCollege of Life Science, Dalian Nationalities University, Dalian , PR China.
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Postsynthetic modification
Διαβάστε περισσότεραNATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS
NATIONAL AND KAPODISTRIAN UNIVERSITY OF ATHENS SCHOOL OF SCIENCE FACULTY OF INFORMATICS AND TELECOMMUNICATIONS INTERDICIPLINARY POSTGRADUATE PROGRAMME "INFORMATION TECHNOLOGIES IN MEDICINE AND BIOLOGY"
Διαβάστε περισσότεραStudy on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
33 2 2011 4 Vol. 33 No. 2 Apr. 2011 1002-8412 2011 02-0096-08 1 1 1 2 3 1. 361005 3. 361004 361005 2. 30 TU746. 3 A Study on the Strengthen Method of Masonry Structure by Steel Truss for Collapse Prevention
Διαβάστε περισσότεραDifferences in Contents of Neutral Aroma Components and Sensory Evaluation in Air-cured Burley Leaves from Different Curing Barns
2 0 1 0 25 3 1 13-1 1 7 1 2 2 1 1 2 2 1. 450002 2. 635000 6 > > > > > > > > > > > > > > > S572 A 1000-7091 2010 03-0113 - 05 Differences in Contents of Neutral Aroma Components and Sensory Evaluation in
Διαβάστε περισσότεραSupplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue.
Supplementary Table 1. Primers used for RT-qPCR analysis of striatal and nigral tissue. Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) Dopaminergic Markers TH CTG GCC ATT GAT GTA CTG GA ACA CAC ATG GGA
Διαβάστε περισσότεραCHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS
CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =
Διαβάστε περισσότεραSupporting Information. Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka
Supporting Information Multigenerational Disruption of Thyroid Endocrine System in Marine Medaka after A Life-Cycle Exposure to Perfluorobutane Sulfonate (PFBS) Lianguo Chen,, Chenyan Hu #, Mirabelle M.
Διαβάστε περισσότεραPNS mg kg - 1. Rb 1
94 2 3 3. 53002 2. 53000 3. 543000 86. 2 mg kg -. 8 mg kg - R Rg Rb 3P97 AUC 0 - R Rg Rb R 0. 8 ± 0. 09 vs 0. 6 ± 0. 06 h Rg 2. 03 ± 0. 76 vs. 74 ± 0. 27 h Rb 0. 76 ± 0. 39 vs 0. 74 ± 0. 7 h R 0. 96 ±
Διαβάστε περισσότερα* ** *** *** Jun S HIMADA*, Kyoko O HSUMI**, Kazuhiko O HBA*** and Atsushi M ARUYAMA***
J. Jpn. Soc. Soil Phys. No. +*2, p. +3,2,**2 * ** *** *** Influence Area of Stem Flow on a Soil of Deciduous Forest Floor by Electric Resistivity Survey and the Evaluation of Groundwater Recharge through
Διαβάστε περισσότεραQuick algorithm f or computing core attribute
24 5 Vol. 24 No. 5 Cont rol an d Decision 2009 5 May 2009 : 100120920 (2009) 0520738205 1a, 2, 1b (1. a., b., 239012 ; 2., 230039) :,,.,.,. : ; ; ; : TP181 : A Quick algorithm f or computing core attribute
Διαβάστε περισσότεραJ. Dairy Sci. 93: doi: /jds American Dairy Science Association, 2010.
Supplementary Table 1. Primers and PCR conditions used for the amplification of the goat SCD1 cdna (PCR1 to PCR6) and three SCD1 polymorphic regions (PCR7 to PCR9) PCR Primers Sequence Position 1 Thermal
Διαβάστε περισσότεραJournal of Ningxia Medical University. Annexin P19 mrna P < AnnexinA2 P19 mrna. AnnexinA2 P19 mrna. PCR 1.
33 6 2011 6 Journal of Ningxia Medical University 511 1674-6309 2011 06-0511 - 04 AnnexinA2 P19 1 2 3 3 3 1. 415700 2. 750004 3. 750004 AnnexinA2 P19 62 IHC RT - PCR Western blot AnnexinA2P19 mrna AnnexinA2
Διαβάστε περισσότεραDistribution of Mercury and Selenium in the Proteins of Porcine Liver and Kidney Under Different Mercury Exposure Level
ISSN 100727626 CN 1123870ΠQ 2003 6 Chinese Journal of Biochemistry and Molecular Biology 19 (3) :377 382, 3,, (, 918 100039), (, 550002) (Sephadex G2100),, ;, ;, 11 kd (MT),,,,,,,,, Q51,X132 Distribution
Διαβάστε περισσότεραQuantum dot sensitized solar cells with efficiency over 12% based on tetraethyl orthosilicate additive in polysulfide electrolyte
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supplementary Information (SI) Quantum dot sensitized solar cells with
Διαβάστε περισσότεραER-Tree (Extended R*-Tree)
1-9825/22/13(4)768-6 22 Journal of Software Vol13, No4 1, 1, 2, 1 1, 1 (, 2327) 2 (, 3127) E-mail xhzhou@ustceducn,,,,,,, 1, TP311 A,,,, Elias s Rivest,Cleary Arya Mount [1] O(2 d ) Arya Mount [1] Friedman,Bentley
Διαβάστε περισσότεραΣχέση µεταξύ της Μεθόδου των ερµατοπτυχών και της Βιοηλεκτρικής Αντίστασης στον Υπολογισµό του Ποσοστού Σωµατικού Λίπους
Ερευνητική Aναζητήσεις στη Φυσική Αγωγή & τον Αθλητισµότόµος 1(3), 244 251 ηµοσιεύτηκε: 2 8 εκεµβρίου 2003 Inquiries in Sport & Physical Education Volume 1(3), 244 251 Released: December 28, 2003 www.hape.gr/emag.asp
Διαβάστε περισσότεραΕΠΙΔΡΑΣΗ ΤΗΣ ΧΡΗΣΗΣ ΕΛΑΙΟΠΛΑΚΟΥΝΤΑ ΣΤΗΝ ΔΙΑΤΡΟΦΗ ΤΩΝ ΑΙΓΩΝ ΔΑΜΑΣΚΟΥ ΩΣ ΠΡΟΣ ΤΗΝ ΠΟΣΟΤΗΤΑ ΚΑΙ ΠΟΙΟΤΗΤΑ ΤΟΥ ΠΑΡΑΓΟΜΕΝΟΥ ΓΑΛΑΚΤΟΣ
Σχολή Γεωπονικών Επιστημών και Διαχείρισης Περιβάλλοντος Πτυχιακή εργασία ΕΠΙΔΡΑΣΗ ΤΗΣ ΧΡΗΣΗΣ ΕΛΑΙΟΠΛΑΚΟΥΝΤΑ ΣΤΗΝ ΔΙΑΤΡΟΦΗ ΤΩΝ ΑΙΓΩΝ ΔΑΜΑΣΚΟΥ ΩΣ ΠΡΟΣ ΤΗΝ ΠΟΣΟΤΗΤΑ ΚΑΙ ΠΟΙΟΤΗΤΑ ΤΟΥ ΠΑΡΑΓΟΜΕΝΟΥ ΓΑΛΑΚΤΟΣ
Διαβάστε περισσότεραSupplementary Table 1. Construct List with key Biophysical Properties of the expression
SPINE Benchmark Target ID Well Code Tag (N or C) Fusion MW (kda) Fusion pi Cleavage site Prot MW (Da) Prot pi 1 A1 OPPF 2585 N-His6 21.75 6.41 Protease 3C 19.77 5.43 2 B1 OPPF 2586 N-His6 15.6 6.27 Protease
Διαβάστε περισσότεραΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ
ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΤΜΗΜΑ ΟΔΟΝΤΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΟΔΟΝΤΙΚΗΣ ΚΑΙ ΑΝΩΤΕΡΑΣ ΠΡΟΣΘΕΤΙΚΗΣ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ ΤΗΣ ΣΥΓΚΡΑΤΗΤΙΚΗΣ ΙΚΑΝΟΤΗΤΑΣ ΟΡΙΣΜΕΝΩΝ ΠΡΟΚΑΤΑΣΚΕΥΑΣΜΕΝΩΝ ΣΥΝΔΕΣΜΩΝ ΑΚΡΙΒΕΙΑΣ
Διαβάστε περισσότεραQuantitative chemical analyses of rocks with X-ray fluorescence analyzer: major and trace elements in ultrabasic rocks
98 Scientific Note X : Quantitative chemical analyses of rocks with X-ray fluorescence analyzer: major and trace elements in ultrabasic rocks Kimiko Seno and Yoichi Motoyoshi,**- +, +, ;,**. -,/ Abstract:
Διαβάστε περισσότεραSUPPLEMENTARY INFORMATION
Sensitivity of [Ru(phen) 2 dppz] 2+ Light Switch Emission to Ionic Strength, Temperature, and DNA Sequence and Conformation Andrew W. McKinley, Per Lincoln and Eimer M. Tuite* SUPPLEMENTARY INFORMATION
Διαβάστε περισσότεραGateway cdna. cdna. pdest TM ~ cfu/ ml ~ cfu bp
2010 32 4 0791-0796 http / /xuebao. jxau. edu. cn Acta Agriculturae Universitatis Jiangxiensis E - mail ndxb7775@ sina. com Gateway cdna * * 350002 cdna cdna Gateway RNA mrna 3 cdna BP LR cdna pdest TM
Διαβάστε περισσότεραComparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus bovis
HPLC * 271016 HPLC - DAD DiamonsilC 18 250 mm 4. 6 mm 5 μm - -1% 370 nm 1. 0 ml /min 40 R282. 7 A 1001-1528 2011 01-0001-05 Comparison of HPLC fingerprint between enzymatic Calculus bovis and natural Calculus
Διαβάστε περισσότεραFENXI HUAXUE Chinese Journal of Analytical Chemistry. Savitzky-Golay. n = SG SG. Savitzky-Golay mmol /L 5700.
38 2010 3 FENXI HUAXUE Chinese Journal of Analytical Chemistry 3 342 ~ 346 DOI 10. 3724 /SP. J. 1096. 2010. 00342 Savitzky-Golay 1 * 1 2 1 3 1 1 510632 2 510632 3 200444 PLS Savitzky-Golay SG 10000 ~ 5300
Διαβάστε περισσότεραReaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil
J. Jpn. Soc. Soil Phys. No. +*0, p.- +*,**1 Eh * ** Reaction of a Platinum Electrode for the Measurement of Redox Potential of Paddy Soil Daisuke MURAKAMI* and Tatsuaki KASUBUCHI** * The United Graduate
Διαβάστε περισσότεραΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ
ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΡΗΤΗΣ ΕΙΔΙΚΟΣ ΛΟΓΑΡΙΑΣΜΟΣ ΑΝΑΡΤΗΤΕΑ ΣΤΟ ΔΙΑΔΙΚΤΥΟ ΠΡΟΣΚΛΗΣΗ ΕΚΔΗΛΩΣΗΣ ΕΝΔΙΑΦΕΡΟΝΤΟΣ Ηράκλειο, 5.0.0 Αρ. πρωτ. 957 Ο Ειδικός Λογαριασμός του Πανεπιστημίου Κρήτης πρόκειται
Διαβάστε περισσότεραSupplementary Information 1.
Supplementary Information 1. Fig. S1. Correlations between litter-derived-c and N (percent of initial input) and Al-/Fe- (hydr)oxides dissolved by ammonium oxalate (AO); a) 0 10 cm; b) 10 20 cm; c) 20
Διαβάστε περισσότεραΠΕΡΙΛΗΨΗ. Λέξεις κλειδιά: Υγεία και συμπεριφορές υγείας, χρήση, ψυχότροπες ουσίες, κοινωνικό κεφάλαιο.
Α.Τ.Ε.Ι. ΚΡΗΤΗΣ Σ.Ε.Υ.Π. ΤΜΗΜΑ ΚΟΙΝΩΝΙΚΗΣ ΕΡΓΑΣΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Τίτλος: «Χρήση ψυχοτρόπων ουσιών από μαθητές Α Λυκείου της Δευτεροβάθμιας Εκπαίδευσης του Νομού Ηρακλείου και ο ρόλος του Κοινωνικού
Διαβάστε περισσότεραJesse Maassen and Mark Lundstrom Purdue University November 25, 2013
Notes on Average Scattering imes and Hall Factors Jesse Maassen and Mar Lundstrom Purdue University November 5, 13 I. Introduction 1 II. Solution of the BE 1 III. Exercises: Woring out average scattering
Διαβάστε περισσότεραPCR. Site-directed Mutagenesis of Sumf 1 Gene of Mouse Based on Overlap Extension PCR and Construction of Eukaryotic Expression Vector
13 5 Vol13 No5 9 10 Life Science Research Oct 9 9 PCR Sumf1 *,,,,, 481 : (chromatin immunoprecipitation assay, ChIP) activator protein-2 alpha (AP-2 α) Sumf 1 PCR, AP-2 α Sumf 1, DNA, Sumf 1 103 ~111,
Διαβάστε περισσότεραStudy of Ne w Chemiluminescence Technique Recognition of Sodium Azide by External Reference Method
2004 62 8, 794 798 ACTA CHIMICA SINICA Vol 62, 2004 No 8, 794 798 Ξ Ξ ( 200032),, : :H 2 O 2 2CH 3 CN2 ( ) H 2 O 2 2CH 3 CN2N2 252 ( ),,, IgG Study of Ne w Chemiluminescence Technique Recognition of Sodium
Διαβάστε περισσότεραTABLE OF CONTENTS Page
TABLE OF CONTENTS Page Acknowledgements... VI Declaration... VII List of abbreviations... VIII 1. INTRODUCTION... 1 2. BASIC PRINCIPLES... 3 2.1. Hereditary Colorectal Cancer... 3 2.1.1. Differential diagnosis...
Διαβάστε περισσότερα(1) A lecturer at the University College of Applied Sciences in Gaza. Gaza, Palestine, P.O. Box (1514).
1439 2017, 3,29, 1658 7677: 1439 2017,323 299, 3,29, 1 1438 09 06 ; 1438 02 23 : 33,,,,,,,,,,, : The attitudes of lecturers at the University College of Applied Sciences in Gaza (BA - Diploma) towards
Διαβάστε περισσότεραStudies on the Binding Mechanism of Several Antibiotics and Human Serum Albumin
2005 63 Vol. 63, 2005 23, 2169 2173 ACTA CHIMICA SINICA No. 23, 2169 2173 a,b a a a *,a ( a 130012) ( b 133002), 26 K A 1.98 10 4, 1.01 10 3, 1.38 10 3, 5.97 10 4 7.15 10 4 L mol 1, n 1.16, 0.86, 1.19,
Διαβάστε περισσότεραΕισαγωγή στη Real Time PCR. Καραπέτσας Θανάσης PhD, MSc
Εισαγωγή στη Real Time PCR Καραπέτσας Θανάσης PhD, MSc Μειονεκτήματα της κλασικής PCR Ανάλυση ύστερα από ηλεκτροφόρηση(συνήθως αγαρόζης) Τεχνική τελικού σημείου(end-point detection), Σύγκριση της έντασης
Διαβάστε περισσότεραMean bond enthalpy Standard enthalpy of formation Bond N H N N N N H O O O
Q1. (a) Explain the meaning of the terms mean bond enthalpy and standard enthalpy of formation. Mean bond enthalpy... Standard enthalpy of formation... (5) (b) Some mean bond enthalpies are given below.
Διαβάστε περισσότεραSupporting Information
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Supporting Information Crotonols A and B, Two Rare Tigliane Diterpenoid
Διαβάστε περισσότεραDetermination of Organophosphate Pesticides in Soil Samples by Accelerated Solvent Extraction-Gas Chromatography
2010 10 October 2010 ROCK AND MINERAL ANALYSIS Vol. 29 No. 5 503 ~ 507 0254 5357 2010 05 0503 05-1 2 3 1 1 1. 100037 2. 710021 3. 100083 13 Carb Rtx - OPP2-0. 67 ~ 1. 50 ng /ml 0. 67 ~ 600 ng /ml 0. 999
Διαβάστε περισσότεραSCITECH Volume 13, Issue 2 RESEARCH ORGANISATION Published online: March 29, 2018
Journal of rogressive Research in Mathematics(JRM) ISSN: 2395-028 SCITECH Volume 3, Issue 2 RESEARCH ORGANISATION ublished online: March 29, 208 Journal of rogressive Research in Mathematics www.scitecresearch.com/journals
Διαβάστε περισσότεραP450 CYP4G19. Prokaryotic Expression of German cockroach Cytochrome P450 CYP4G19 Gene and Preparation of Polyclonal Antibody , 518060; 2.
2009 6 9 6 [ ] 1672-3619(2009)06-0591-06 591 P450 CYP4G19 1,2 1,2*,, 2, 2, 2, 2 1, (1., 518060; 2., 518020) P450 CYP4G19, CYP4G19 RT-PCR CYP4G19, T-A, pet-28a, BL21 (DE3),,,, ELISA Western-blot cdna 771bp,
Διαβάστε περισσότεραΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ. ΘΕΜΑ: «ιερεύνηση της σχέσης µεταξύ φωνηµικής επίγνωσης και ορθογραφικής δεξιότητας σε παιδιά προσχολικής ηλικίας»
ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΙΓΑΙΟΥ ΣΧΟΛΗ ΑΝΘΡΩΠΙΣΤΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ ΤΗΣ ΠΡΟΣΧΟΛΙΚΗΣ ΑΓΩΓΗΣ ΚΑΙ ΤΟΥ ΕΚΠΑΙ ΕΥΤΙΚΟΥ ΣΧΕ ΙΑΣΜΟΥ «ΠΑΙ ΙΚΟ ΒΙΒΛΙΟ ΚΑΙ ΠΑΙ ΑΓΩΓΙΚΟ ΥΛΙΚΟ» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ που εκπονήθηκε για τη
Διαβάστε περισσότεραSection 8.3 Trigonometric Equations
99 Section 8. Trigonometric Equations Objective 1: Solve Equations Involving One Trigonometric Function. In this section and the next, we will exple how to solving equations involving trigonometric functions.
Διαβάστε περισσότερα2 PbO 2. Pb 3 O 4 Sn. Ti/SnO 2 -Sb 2 O 4 -CF/PbO x SnO 2 -Sb PbO 2. Sn-Sb 1:1. 1 h. Sn:Sb=10:1. PbO 2 - CeO 2 PbO 2. [8] SnO 2 +Sb 2 O 4 _
41 Vol.41, No. 01 RARE METAL MATERIALS AND ENGINEERING March 01 Pb O 4 PbO ( 710049) SnO -Sb Pb O 4 Pb O 4 100.5 h 970 h XRF XRD SEM Pb O 4 PbO PbO TG146.1 + A 100-185X(01)0-046-05 [1,] 1 PbO PbO Sn-Sb
Διαβάστε περισσότεραStudy on AgrobacteriunΟmediated transformation of tobacco plant with rol C gene
2001, 24 (1) : 2529 Journal of Nanjing Agricultural University rolc (, 210095) :, rolc ( Nicotiana tabacum ), GUS, PCR Southern rolc,, rolc : ; ; rolc ; : S572103513 : A : 1000Ο2030 (2001) 01Ο0025Ο05 Study
Διαβάστε περισσότεραΕΠΑΝΑΛΗΨΗ ΨΕΥΔΟΛΕΞΕΩΝ ΑΠΟ ΠΑΙΔΙΑ ΜΕ ΕΙΔΙΚΗ ΓΛΩΣΣΙΚΗ ΔΙΑΤΑΡΑΧΗ ΚΑΙ ΠΑΙΔΙΑ ΤΥΠΙΚΗΣ ΑΝΑΠΤΥΞΗΣ
Σχολή Επιστημών Υγείας Πτυχιακή εργασία ΕΠΑΝΑΛΗΨΗ ΨΕΥΔΟΛΕΞΕΩΝ ΑΠΟ ΠΑΙΔΙΑ ΜΕ ΕΙΔΙΚΗ ΓΛΩΣΣΙΚΗ ΔΙΑΤΑΡΑΧΗ ΚΑΙ ΠΑΙΔΙΑ ΤΥΠΙΚΗΣ ΑΝΑΠΤΥΞΗΣ Άντρια Πολυκάρπου Λεμεσός, Μάιος 2017 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ
Διαβάστε περισσότεραGene expression of mouse in early embryonic development 3
49 (2) :272 276, 2003 A cta Zoologica S inica 3 (, 265200) (, 712100) Gene expression of mouse in early embryonic development 3 ZHU Xin2Chan ZHAN G Yong WAN G Bao2Wei ( Depart ment of A ni mal Science,
Διαβάστε περισσότεραSalmonella produce microrna-like RNA fragment Sal-1 in the infected cells to. facilitate intracellular survival
Salmonella produce microrna-like RNA fragment Sal-1 in the infected cells to facilitate intracellular survival Hongwei Gu 1,2*, Chihao Zhao 1,2*, Tianfu Zhang 1,2*, Hongwei Liang 1,2, Xiao-Ming Wang 1,
Διαβάστε περισσότερα