Localization and Expression of EDN3 in Mouse Skin with Different Coat Colors

Transcript

1 ISSN CN / Q http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology ~ 345 DOI /j. cnki. cjbmb * endothelin 3 PCR 2 P < ELISA P < S Localization and Expression of in Mouse Skin with Different Coat Colors WANG Hai-Dong 1 LI Ya-Nan 1 XUE Lin-Li 2 ZHAO Bing-Ling 1 HE Xiao-Yan 1 DONG Chang-Sheng 1 WANG Juan 3 * 1 College of Animal Science and Veterinary Medicine Shanxi Agricultural University Taigu Shanxi China 2 College of Information Shanxi Agricultural University Taigu Shanxi China 3 The Affiliated Tongji Hospital of Tongji University Shanghai China Abstract Endothelin 3 END3 binds to its receptor to promote the migration proliferation and differentiation of early melanocyte also boosts the synthesis of melanin. The diversity of END3 among different coat color mice and the effects of END3 on the formation of coat color need to be investigated. The real - time quantitative PCR result showed that expression in gray mouse skin was significantly higher about 2 folds P < than those from black and brown mice whereas in Western blotting the fold difference was 5 or 2 between brown and black mice P < The ELISA result indicated that protein levels in gray mice was 1. 8 times higher than in black mice or 1. 4 times than in brown mice P < Immunohistochemistry showed that the was predominantly expressed in the matrix outer root sheath but weak in dermal papilla of hair follicular. The results indicated that END3 was an essential factor in melanocytes which played a role in the conversion No * Tel wangjuanshanghai@ 163. com Received November Accepted January Supported by National Natural Science Foundation of China No Doctoral Program of Higher Education * Corresponding author Tel wangjuanshanghai@ 163. com

2 between two types of pigment particles. Key words endothelin-3 mice immunohistochemistry melanin 1 eumelanin pheomelanin 1. 1 RNA TaKaRa 1-3 QuantiFast SYBR Green PCR Kit QIAGEN 3 ELISA DAB 4 Streptavidin-HRP C57BL/6J RNA 1 Bouin s 1. 2 RNA cdna Trizol RNA 6 7 TaKaRa cdna 8 oligdt Primer 1 μl dntp Mix 1 μl RNA 2 μg 10 μl PCR 65 5 min 2 min 10 μl 5 Primer Script Buffer 4 μl RNase inhibitor 0. 5 μl Primer script II RNase 1 μl 20 μl PCR min min -20 cdna 1. 3 PCR GenBank EDNRB Premier5. 0 PCR NCBI Table 1 Table 1 Sequence of premier and condition of PCR amplification Gene Primer sequence 5' 3' Product size /bp EDNRB β-actin F TCCTGAACAGACTGTGCCCTA R CGGTGGGCTTTATCTGTCCTT F CAGGAAGAAGAGCGGTATGC R CAGAGCGATTGGATTGATGC F TTGCTGACAGGATGCAGAAG R ACATCTGCTGGAAGGTGGAC

3 PCR 25 μl 2 Taq MasterMix μl 1 μl cdna 1 μg 25 μl 94 5 min s s s min % PCR 200 V 15 min min PBS 1. 4 qrt-pcr PCR QIAGEN min 10 μl 2 QuantiFast SYBR Green PCR Master Mix 5 μl 1 μl ng 10 μl 95 5 min s s 40 ~ min PBS 2 - CT EDNRB 5 min 3 HRP = min PBS 5 CT CT - CT CT = CT - CT mrna 2 - CT 1. 5 ELISA 4 TBST NC 10 min 3 HRP h TBST NC 5 min 6 ECL Image- = = /βactin Means ± SE SPSS 5 min PBS 4 30 min PBS 5 min 3 min 3 DAB 10 min PBS 3 min 3 2 ELISA 2. 1 EDNRB 1% EDNRB min 279 bp 30 s bp Fig μl EDNRB min 30 s EDNRB 100 μl min 30 s 5 qrt-pcr 100 μl 37 1 Tm 15 min 100 μl 450 nm S 1. 6 qrt-pcr 50 μg SDS-PAGE NC ± 5% 1 h GAPDH ± P < Fig. 2A EDNRB ProPlus 6. 0 P < Fig. 2B

4 Fig. 1 Electrophoresis pattern of β-actin and EDNRB PCR product Total RNA was extracted from mouse skin. Then cdna was synthesized and gene was amplified by PCR. We used 1% agarose to detected sequences. The result showed a clear electrophoresis band of 279 bp 140 bp and 256 bp. There was no other band for this experiment. M DL DNA marker Fig. 2 qrt-pcr analysis of the expression of and EDNRB mrna in different colors of skin tissue collected from mice with black grey brown n = 3 each Data are presented as mean ± SD and three groups comparisons were done with one-way ANOVA. * P < ** P < compared to black 2. 3 ELISA nm ± CurveExpert 1. 4 Fig ± ± ± Fig. 3 Relative expression of in different hair color mouse skin A The standard curve of B ELISA analysis of in different colors of mouse skin. Data are presented as mean ± SD. The experimental operation accorded to ELISA kits. Three groups comparisons were done with one-way ANOVA. Note ** Mean significant difference P < compared to black

5 ± ± Fig. 4 Western blot analysis of protein expression in different color of mouse skin The proteins of different coat color mice were resolved by SDS-PAGE transferred into a nitrocellulose membrane and immunoblotted using an antibody of. The second panel was imaged after longer exposure to confirm the presence of. Three groups comparisons were done with one-way ANOVA. * P < ** P < compared to black 2. 5 Fig. 5 Immunohistochemistry results of in different hair color mouse skin 400 Different coat color mouse skin was stained with immunohistochemistry. Immunohistochemistry were probed with rabbit anti- polyclonal antibody and goat anti-rabbit IgG conjugated HRP as the second antibody then detected colorimetricly using a DAB detection kit. A black mouse skin positive group a black mouse skin negative control group B grey mouse skin positive group b grey mouse skin negative control group C brown mouse skin positive group c brown mouse skin negative control group. 1 hair follicle matrix 2 dermal papilla 3 inside root sheath 4 outside root sheath 3 MC1R Agouti

6 MITF References EDNRB EDNRB 18 Toxicol regulated J Land EJ Ito S Wakamatsu K et al. Rate constants for the first two chemical steps of eumelanogenesis J. Pigment Cell Res Olivares C Jinenez-Cervantes C Lozano JA et al. The 5 6- dihydroxyindole-2-carboxylic acid DHICA oxidase activity of human tyrosinase J. Biochem J Pt Wilczk A Kondoh H Mishima Y. Composition of mammalian eumelanins analyses of dhica-derived units in pigments from hair and melanoma-cells J. Pigment Cell Res Kedzierski RM Yanagisawa M. Endothelin system the doubleedged sword in health and disease J. Annu Rev Pharmacol 5 Hirobe T. How are proliferation and differentiation of melanocytes J mrna in the chicken J. PLoS One e86361 pigmentation patterns in domestic and wild cats J decreases the content of eumelanin mouse hair J MITF TYR TRP1 melanocytes J. Pigment Cell Melanoma Res Garcia RJ Ittah A Mirabal S et al. Endothelin 3 induces skin pigmentation in a keratin-driven inducible mouse model J. J Invest Dermatol Murase D Hachiya A Kikuchi-Onoe M et al. Cooperation of endothelin-1 signaling with melanosomes plays a role in developing and / or maintaining human skin hyperpigmentation. Biol Open Kinoshita K Akiyama T Mizutani M et al. Endothelin receptor B2 EDNRB2 is responsible for the tyrosinase-independent recessive white mo w and mottled mo plumage phenotypes 9 Kaelin CB Xu X Hong LZ et al. Specifying and sustaining. Science 10 Hirobe T Ito S Wakamatsu K. The slaty slt /Dctslt allele but not pheomelanin in the. Pigment Cell Melanoma Res Regazzetti C De Donatis GM Ghorbel HH et al. Endothelial cells promote pigmentation through endothelin receptor b activation J. J Invest Dermatol Endou M Aoki H Kobayashi T et al. Prevention of hair graying by factors that promote the growth and differentiation of. J Dermatol Barnes KJ Spencer NJ. Can colonic migrating motor complexes occur in mice lacking the endothelin-3 gene J. Clin Exp Pharmcol Physiol von Koschembahr AM Swope VB Starner RJ et al. Endothelin-1 protects human melanocytes from UV-induced DNA

7 damage by activating JNK and p38 signalling pathways J. Exp Dermatol Skovsted GF Kilic S Edvinsson L. Endothelin-1 and endothelin-3 regulate endothelin receptor expression in rat coronary arteries J. Basic Clin Pharmacol Toxicol Fang D Leishear K Nguyen TK et al. Defining the conditions for the generation of melanocytes from human embryonic stem cells J. Stem Cells Moraes MN Lima LH Ramos BC et al. Endothelin modulates the circadian expression of non-visual opsins J. Gen Comp Endocrinol Van Raamsdonk CD Barsh GS Wakamaysu K et al. Independent regulation of hair and skin color by two G proteincoupled pathways J. Pigment Cell Melanoma Res Garcia RJ Ittah A Mirabal S et al. Endothelin 3 induces skin pigmentation in a keratin-driven inducible mouse model J. J Invest Dermatol D Orazio JA. Melanocy te UV resistance Feelin the endothe lin J. Exp Dermatol Dong C Wang H Xue L et al. Coat color determination by mir-137 mediated down-regulation of microphthalmia-associated transcription factor in a mouse model J. RNA