Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS )

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)"

Transcript

1 «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.18 Ενημέρωση με τα στοιχεία από τα ευρήματα της έρευνας για τη δραστηριότητα με τίτλο «Γενετική ανάλυση των κουνουπιών του είδους Culex pipiens» Υπεύθυνοι φορείς: Εργαστήριο Γενετικής, Εξελικτικής και Συγκριτικής Βιολογίας, Τμήμα Βιοχημείας και Βιοτεχνολογίας, Πανεπιστήμιο Θεσσαλίας Λάρισα, 2013

2 Περιεχόμενα Εισαγωγή.. 3 Μεθοδολογία Αποτελέσματα 8 Συμπεράσματα Συζήτηση. 16 Βιβλιογραφία. 17 2

3 Εισαγωγή Τα κουνούπια του συμπλέγματος Culex pipiens είναι οι πρωταρχικοί φορείς νοσημάτων με παγκόσμια κατανομή όπως η εγκεφαλίτιδα του Δυτικού Νείλου, η εγκεφαλίτιδα των ιπποειδών, η λεμφική φιλαρίαση, καθώς και πολλών αρμποϊών (Diamond, 2009). Αν και τα είδη που αποτελούν την ομάδα αυτή των κουνουπιών μοιάζουν μορφολογικά, η διαφοροποίηση των ηθολογικών, φυσιολογικών και αναπαραγωγικών χαρακτήρων οδηγεί σε περιορισμένη γεωγραφική κατανομή ή και σε εξειδικευμένους οικολογικούς θώκους. Στην Ευρώπη δύο μορφές κουνουπιών του συμπλέγματος, οι pipiens και molestus, έχουν χαρακτηριστεί ως βασικοί φορείς του ιού του Δυτικού Νείλου. Η μορφή pipiens είναι ευρύγαμη (διασταυρώνεται σε ανοιχτούς χώρους), ενώ η molestus είναι στενόγαμη (μπορεί να διασταυρωθεί σε περιορισμένους χώρους) (Kent, et al., 2007). Η μορφή pipiens είναι μη αυτογενής (απαιτεί πρόσληψη αίματος για την παραγωγή αυγών) και προτιμάει το αίμα των πτηνών (Kent, et al., 2007), σε αντίθεση με τη μορφή molestus που είναι αυτογενής (δεν απαιτεί πρόσληψη αίματος για την παραγωγή απογόνων) (Kent, et al., 2007) και προτιμάει να θρέφεται από θηλαστικά, συμπεριλαμβανομένου του ανθρώπου. Η μορφή pipiens είναι ετεροδυναμική (υποβάλλεται σε χειμέρια αναπαραγωγική διάπαυση), ενώ η μορφή molestus είναι ομοδυναμική, παραμένοντας ενεργή κατά τη διάρκεια του χειμώνα. Τέλος, αν και οι δύο μορφές στη Βόρεια Ευρώπη έχουν διαχωρισμένους οικολογικούς θώκους με υπέργεια (pipiens) και υπόγεια (molestus) ενδιαιτήματα, στη Νότια Ευρώπη οι δύο μορφές μπορεί να διαβιούν συμπατρικά σε υπέργεια ενδιαιτήματα, γεγονός που ευνοεί τον υβριδισμό μεταξύ των ειδών, με αποτέλεσμα να έχουν περιγραφεί πληθυσμοί με ενδιάμεσα βιολογικά χαρακτηριστικά (Gomes, et al., 2013). Τα υβρίδια αυτά έχουν μεγάλη επιδημιολογική σημασία, καθώς έχουν επιδεικνύουν περισσότερο τυχαίες συμπεριφορές ως προς τις διατροφικές τους συνήθειες (Gomes, et al., 2013). Οι επιπτώσεις αυτών των διαφορετικών συμπεριφορών στην μετάδοση των ασθενειών είναι σημαντικές και ως εκ τούτου 3

4 προκύπτει η ανάγκη ανάπτυξης μεθόδων, οι οποίες θα επιτρέπουν την έγκυρη ταυτοποίηση των κουνουπιών πριν εκτιμηθεί με ακρίβεια ο ρόλος τους ως φορείς. Δυστυχώς, παρά τις έντονες διαφοροποιήσεις των βιολογικών τους χαρακτηριστικών οι μορφολογικές διαφορές είναι πολύ περιορισμένες γεγονός που δυσχεραίνει την ταυτοποίηση των ειδών του συμπλέγματος βάσει μορφολογίας και κατά συνέπεια την ορθολογική τους διαχείριση. Στην προσπάθεια ταυτοποίησης των ειδών του συμπλέγματος προτάθηκαν και εφαρμόστηκαν διάφορες γενετικές προσεγγίσεις, που στα αρχικά στάδια αφορούσαν ηλεκτροφορήσεις πρωτεϊνών και μεθόδους υβριδισμό. Σχετικά πρόσφατα οι εφαρμογές της μοριακής βιολογίας σε συνδυασμό με την αλυσιδωτή αντίδραση πολυμεράσης (PCR) επέτρεψαν την ανάπτυξη μοριακών δεικτών που απαιτούν μια ελάχιστη ποσότητα δείγματος προς ταυτοποίηση και είναι ικανοί να δώσουν ακριβέστερες απαντήσεις. Πολλές από τις μεθόδους PCR εξέτασαν την ποικιλομορφία αλληλουχιών σε ειδικούς πυρηνικούς τόπους, άλλες εστίασαν σε πληροφορίες από δύο ή και περισσότερα γονίδια καθώς και από αναλύσεις με Multiplex PCR που περιλάμβαναν τόσο «συντηρημένους», «παγκόσμιους» όσο και εξειδικευμένους εκκινητές. Τέλος, πρόσφατα επιχειρείται διαχωρισμός ειδών και υβριδίων με τη χρήση μικροδορυφορικών δεικτών. Ωστόσο, οι περισσότερες μελέτες με ικανοποιητικά αποτελέσματα εστιάζονται στις αναλύσεις πολυμορφισμών (α) του γονιδίου της κυτοχρωμικής οξειδάσης 1 (CO1) του mtdna (β) του γονιδίου της ακετυλοχολινεστεράσης (ace-2) του πυρηνικού DNA (3) του internal transcribed spacer (ITS) ριβοσωμικού DNA και (4) δεικτών μικροδορυφορικού DNA. Σε αντίθεση με τις πολλές μελέτες με πυρηνικά γονίδια, σχετικά λίγες ταξινομικές μελέτες εστιάστηκαν στο μιτοχονδριακό (mt) DNA στα κουνούπια και ακόμη λιγότερες μελέτησαν τον πολυμορφισμό του γονιδίου CO1 παρά τη διαγνωσμένη ικανότητά του στη διευθέτηση ταξινομικών προβλημάτων και ανάλυσης της βιοποικιλότητας (Hebert, et al., 2004). Το γονίδιο CO1 είναι παρόν σε εκατοντάδες 4

5 αντίγραφα ανά κύτταρο, δεν εμπεριέχει ενθέσεις ή ελλείμματα και όπως κάθε γονίδιο που κωδικοποιεί για πρωτεΐνες, η τρίτη θέση των κωδικονίων παρουσιάζει μεγάλο ρυθμό νουκλεοτιδικών υποκαταστάσεων. Αλλαγές στην αμινοξική του αλληλουχία εμφανίζονται πιο αργά από κάθε άλλο μιτοχονδριακό γονίδιο, βοηθώντας στη διερεύνηση μεγαλύτερων ταξινομικών λεπτομερειών και στον ευκολότερο σχεδιασμό εκκινητών. Μελέτη σε εξέλιξη στο εργαστήριό μας για τον διαχωρισμό των ειδών του συμπλέγματος με τη χρήση του γονιδίου CO1 απέδειξε την αποτελεσματικότητα της μεθόδου. H παρουσία δύο πυρηνικών γονιδίων που κωδικοποιούν για την ακετυλοχολινεστεράση (ACE) ανακαλύφθηκαν για πρώτη φορά στο Culex pipiens και στη συνέχεια βρέθηκαν και σε άλλα είδη κουνουπιών (Weill, et al., 2002). Το γονίδιο ace-1 προσδίδει ανθεκτικότητα στα οργανοφωσφορικά εντομοκτόνα και συνεπώς υπόκειται σε επιλεκτική πίεση. Το γονίδιο ace-2 είναι φυλοσύνδετο και η ακριβής λειτουργία του, καθώς και οι επιλεκτικές πιέσεις που ασκούνται σε αυτό δεν έχουν διευκρινισθεί. Η ανάλυση συνήθως εστιάζεται στους πολυμορφισμούς του γονίδιου ace-2 μετά από ενίσχυση με PCR με τη χρήση ειδικών εκκινητών (Savage, et al., 2007, Kang and Sim, 2013). Οι αλληλουχίες των πυρηνικών ριβοσωμικών DNA (rdna) γονιδίων στα αρθρόποδα είναι διατεταγμένες επαναλαμβανόμενα σε σειρά και η κάθε μονάδα περιλαμβάνει τα γονίδια για τα 18S, 5,8S και 28S ριβοσωμικά RNA. Οι συντηρημένες δομικές μονάδες των γονιδίων διαχωρίζονται από διαγονιδικά διαστήματα και τα εσωτερικά μεταγραφόμενα διαστήματα. Μέσα στις μονάδες, το πρώτο ενδιάμεσο μεταγραφόμενο διάστημα (internal transcribed spacer, ITS-1) διαχωρίζει το γονίδιο 18S από το γονίδιο 5,8S, ενώ το δεύτερο ενδιάμεσο μεταγραφόμενο διάστημα (ITS- 2) διαχωρίζει το γονίδιο 5,8S από το γονίδιο 28S. Οι περιοχές ITS-1 και ITS-2 έχουν χρησιμοποιηθεί ευρέως σε ταξινομικές και φυλογενετικές αναλύσεις των κουνουπιών και έχουν αποδειχθεί χρήσιμες στην επίλυση προβλημάτων που 5

6 σχετίζονται με την ταυτοποίηση και διαχωρισμό μορφολογικά παρόμοιων ειδών μετά από ενίσχυση με PCR (Marrelli, et al., 2005). Οι μικροδορυφορικοί δείκτες αποτελούν την καλύτερη επιλογή για μελέτες σε επίπεδο ενδοειδικών πληθυσμών και υποειδών, ειδικότερα για τον χαρακτηρισμό υβριδίων, λόγω του ότι εμφανίζουν υψηλά επίπεδα πολυμορφισμού και μπορούν να χρησιμοποιηθούν για να περιγράψουν την γενετική ποικιλότητα μέσα σε πληθυσμούς και να εκτιμήσουν το βαθμό γενετικής διαφοροποίησης μεταξύ των πληθυσμών. Υπάρχουν αρκετές δημοσιεύσεις που περιγράφουν μικροδορυφορικούς τόπους κατάλληλους να χρησιμοποιηθούν στα μέλη του συμπλέγματος Culex pipiens (για επισκόπηση Gomes, et al., 2013). Πολύ πρόσφατα η χρήση μικροδορυφόρων αποδείχτηκε χρήσιμη στην ταυτοποίηση υβριδίων ανάμεσα σε pipiens και molestus (Gomes, et al., 2013). Η συνδυαστική εφαρμογή των μεθόδων που περιγράφηκαν εν συντομία και έχει αποδειχτεί αρκετά αξιόπιστη στην τυποποίηση του συμπλέγματος τόσο σε παγκόσμιο όσο και ευρωπαϊκό επίπεδο, έχοντας συμβάλει σημαντικά στο σχεδιασμό πρωτοκόλλων διαχείρισης των ασθενειών, των οποίων είναι φορείς. Είναι προφανές ότι αφενός η ευρεία εφαρμογή τους στην Ελλάδα και αφετέρου η ανάπτυξη αποτελεσματικότερων και όσο το δυνατόν λιγότερο κοστοβόρων και χρονοβόρων μεθόδων είναι επιβεβλημένη και αποτελεί απαραίτητη προϋπόθεση για την ανάλυση της εμφάνισης και της επιδημιολογίας ασθενειών όπως αυτή που προέρχεται από τον ιό του Δυτικού Νείλου. Στόχος Στόχος του πρωτοκόλλου είναι η εφαρμογή μεθόδων που περιλαμβάνουν ένα πλέγμα τεχνικών και τύπων DNA, προκειμένου να ταυτοποιηθούν και να διαχωριστούν τα είδη του συμπλέγματος Cx. pipiens καθώς και τα μεταξύ τους υβρίδια με ταχύτητα και ακρίβεια.. Πιο συγκεκριμένα η μελέτη θα εστιαστεί στις αναλύσεις πολυμορφισμών (α) του γονιδίου της κυτοχρωμικής οξειδάσης 1 (CO1) 6

7 του mtdna και (β) των γονιδίων της ακετυλοχολινεστεράσης (ace-2 και ace-1) και του kdr του πυρηνικού DNA. Σε αντίθεση με τις πολλές μελέτες με πυρηνικά γονίδια, σχετικά λίγες ταξινομικές μελέτες εστιάστηκαν στο μιτοχονδριακό (mt) DNA στα κουνούπια και ακόμη λιγότερες μελέτησαν τον πολυμορφισμό του γονιδίου CO1 (Rey et al. 2001; Fairley et al. 2000, 2002; Sallum et al ), παρά τη διαγνωσμένη ικανότητά του στη διευθέτηση ταξινομικών προβλημάτων και ανάλυσης της βιοποικιλότητας (Hebert et al. 2004). Το γονίδιο CO1 είναι παρόν σε εκατοντάδες αντίγραφα ανά κύτταρο, δεν εμπεριέχει ενθέσεις ή ελλείμματα και όπως κάθε γονίδιο που κωδικοποιεί για πρωτεΐνες, η τρίτη θέση των κωδικονίων παρουσιάζει μεγάλο ρυθμό νουκλεοτιδικών υποκαταστάσεων. Αλλαγές στην αμινοξική του αλληλουχία εμφανίζονται πιο αργά από κάθε άλλο μιτοχονδριακό γονίδιο, βοηθώντας στη διερεύνηση μεγαλύτερων ταξινομικών λεπτομερειών και στον ευκολότερο σχεδιασμό εκκινητών. H παρουσία δύο πυρηνικών γονιδίων που κωδικοποιούν για την ακετυλοχολινεστεράση (ACE) ανακαλύφθηκαν για πρώτη φορά στο Cx. pipiens (Bourguet et al. 1996; Malcolm et al. 1998) και στη συνέχεια βρέθηκαν και σε άλλα είδη κουνουπιών (Weill et al. 2002). Το γονίδιο ace-1 προσδίδει ανθεκτικότητα στα οργανοφωσφορικά εντομοκτόνα και συνεπώς υπόκειται σε επιλεκτική πίεση. Το γονίδιο ace-2 είναι φυλοσύνδετο και η ακριβής λειτουργία του, καθώς και οι επιλεκτικές πιέσεις που ασκούνται σε αυτό δεν έχουν διευκρινισθεί. Η ανάλυση θα εστιαστεί στους πολυμορφισμούς του γονίδιου ace-2 μετά από ενίσχυση με PCR με τη χρήση ειδικών εκκινητών. 7

8 Μεθοδολογία Αποτελέσματα Συνολικά αναλύθηκαν 520 έντομα που προέρχονταν από την περιοχή της Κάρλας 1. Πρωτόκολλο: Κατάταξη των μελών του συμπλέγματος Cx. pipiens σε φυλογενετικές ομάδες με τη χρήση του μιτοχονδριακού γονιδίου CO1. Πραγματοποιήθηκε ενίσχυση τμήματος τους γονιδίου COI με τη χρήση των κάτωθι εκκινητών: Forward: GGTCAACAAATCATAAAGATATTGG Reverse: TAAACTTCAGGGTGACCAAAAAATCA Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 52 ο C για 50 και επέκτασης στους 72 ο C για 55 και τελική επέκταση στους 72 ο C για 10. Tα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα προϊόντα της PCR καθαρίστηκαν και αλληλουχήθηκαν Τα αποτελέσματα της αλληλούχησης ήταν τα ακόλουθα Είδος Ποσοστό Culex pipiens pipiens 35 Culex pipiens molestus 48 Culex modestus 2,5 Ochlerotatus caspius 8 Aedes vexans 0,5 Anopheles labranchiae 1 Coquillettidia richardii 0,5 Chironomus plumosus 1 Chironomus balatonicus 2 Sesamia nonagrioides 0,8 Opostega salaciella 0,7 2. Πρωτόκολλο: ειδο-ειδική PCR που βασίζεται στους πολυμορφισμούς του 2 ου ιντρονίου του γονιδιακού τόπου της ακετυλοχολινεστεράσης-2 με σκοπό την 8

9 ταυτοποίηση και τον διαχωρισμό ανάμεσα σε Culex pipiens pipiens και Culex pipiens molestus Πραγματοποιήθηκε ενίσχυση τμήματος του γονιδίου ACE-2 χρησιμοποιώντας τους κάτωθι εκκινητές: Forward: GAGGAGATGTGGAATCCCAA Reverse: TGGAGCCTCCTCTTCACGGC Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 96 ο C για 4, 35 κύκλοι αποδιάταξης στους 96 ο C για 40, υβριδοποίησης των εκκινητών στους 52 ο C για 45 και επέκτασης στους 72 ο C για 55 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην κάτωθι εικόνα: Τα πρώτα 10 δείγματα είναι pipiens ενώ τα υπόλοιπα είναι molestus. Ελέγχθηκαν συνολικά 400 δείγματα και ταυτοποιήθηκαν 180 pipiens και 220 molestus. 3. Πρωτόκολλο: Ανίχνευση της μετάλλαξης G119S στο ace-1 του Culex pipiens pipiens με χρήση διαγνωστικού ελέγχου βασισμένου στην PCR με σκοπό τον προσδιορισμό ανθεκτικών ή μη στελεχών Πραγματοποιήθηκε ενίσχυση τμήματος τους γονιδίου ACE-1 με τη χρήση των κάτωθι εκκινητών: Forward: CCGGGGGCCACCATGTGGAA 9

10 Reverse: ACGATCACGTTCTCCTCCGA Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 40 και επέκτασης στους 72 ο C για 30 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Η γονοτύπηση του πολυμορφισμού (G119S) πραγματοποιήθηκε με μεθοδολογία PCR-RFLP με τη χρήση του ενζύμου AluI. Η ανάλυση έγινε σύμφωνα με το ακόλουθο πρότυπο. Εάν ομοζυγωτικό ευαίσθητο: 194 bp Εάν ομοζυγωτικό ανθεκτικό: bp Εάν ετεροζυγωτικό ανθεκτικό: bp Από τα 180 δείγματα pipiens που γονοτυπήθηκαν, τα 24 ήταν ετερόζυγα για το αλληλόμορφο που σχετίζεται με ανθεκτικότητα, ενώ τα υπόλοιπα 156 άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία σε εντομοκτόνα. 4. Πρωτόκολλο: Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens Η ενίσχυση τμήματος του γονιδίου ACE1 για την ταυτόχρονη γονοτύπηση της θέσης F290V, η οποία σχετίζεται με ανθεκτικότητα σε εντομοκτόνα, πραγματοποιήθηκε σε 3 ξεχωριστές αντιδράσεις. Οι εκκινητές που χρησιμοποιήθηκαν για την κάθε αντίδραση είναι οι κάτωθι: Αντίδραση 1: ενίσχυση τμήματος 542 bp όπου περιέχεται η θέση F290V (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) Forward: GTCTGGCCGAGGCCGTCA Reverse: TGCTTCTGTGCGTGTACAGG 10

11 Αντίδραση 2: ενίσχυση τμήματος 148 bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ανθεκτικότητα Forward: GTCTGGCCGAGGCCGTCA Reverse: TCCACAACCGGAACGAACGGAAA Αντίδραση 3: ενίσχυση τμήματος 435 bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ευαισθησία Forward: ACGCTGGGGATCTGCGAGG Reverse: TGCTTCTGTGCGTGTACAGG Όλες οι αντιδράσεις πραγματοποιήθηκαν στις ίδιες συνθήκες PCR. Οι συνθήκες που χρησιμοποιήθηκαν είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 30, υβριδοποίησης των εκκινητών στους 56 ο C για 40 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην ακόλουθη εικόνα: Ανθεκτικότητα Ευαισθησία Το R συμβολίζει τα δείγματα που φέρουν το αλληλόμορφο που σχετίζεται με ανθεκτικότητα. Η αρίθμηση 1 3 αντιστοιχεί στην αρίθμηση των αντιδράσεων. Ελέγχθηκαν 180 δείγματα pipiens. Όλα τα άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. 11

12 5. Πρωτόκολλο: Ανίχνευση αλληλομόρφων του γονιδίου kdr του Culex pipiens pipiens με χρήση διαγνωστικού ελέγχου βασισμένου στην PCR με σκοπό την ανίχνευση ανθεκτικότητας ή μη. Πραγματοποιήθηκε ενίσχυση τμήματος του γονιδίου kdr που κωδικοποιεί για ένα τασοεξαρτώμενο κανάλι νατρίου σε 2 αντιδράσεις. Οι εκκινητές που χρησιμοποιήθηκαν για την κάθε αντίδραση είναι οι κάτωθι: Αντίδραση 1: ενίσχυση ενός τμήματος bp (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) κι ενός τμήματος bp, η οποία πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ευαισθησία. Forward 1: GTGGAACTTCACCGACTTC Forward 2: CCACCGTAGTGATAGGAAATTTA Reverse: GCAAGGCTAAGAAAAGGTTAAG Αντίδραση 2: ενίσχυση ενός τμήματος bp (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) κι ενός τμήματος bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ανθεκτικότητα. Forward 1: GTGGAACTTCACCGACTTC Forward 2: CCACCGTAGTGATAGGAAATTTT Reverse: GCAAGGCTAAGAAAAGGTTAAG Όλες οι αντιδράσεις πραγματοποιήθηκαν στις ίδιες συνθήκες PCR. Οι συνθήκες που χρησιμοποιήθηκαν είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 45 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην ακόλουθη εικόνα: 12

13 Το R συμβολίζει τα δείγματα που φέρουν το αλληλόμορφο που σχετίζεται με ανθεκτικότητα και το S αυτά που φέρουν το αλληλόμορφο που σχετίζεται με ευαισθησία. Η αρίθμηση 1 14 αντιστοιχεί στον αριθμό των δειγμάτων. Στο πάνω μέρος του πηκτώματος φαίνονται οι αντιδράσεις 1 και στο κάτω μέρος του πηκτώματος οι αντιδράσεις 2. Η κάθε στήλη αντιστοιχεί σε ένα δείγμα. Τα πρώτα 7 δείγματα είναι pipiens ενώ τα υπόλοιπα είναι molestus. Φαίνεται πως αυτή η τεχνική δεν εφαρμόζεται στα molestus. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. 6. Πρωτόκολλο: Ανίχνευση υβριδίων pipiens X molestus Η μέθοδος βασίζεται στην PCR με τη χρήση ενός forward και δύο reverse εκκινητών ειδικών για τις μορφές pipiens και molestus, οι οποίοι ενισχύουν την παρακείμενη περιοχή του μικροδορυφορικού τόπου CQ11. Ο διαχωρισμός βασίζεται στο μέγεθος 13

14 του προϊόντος της PCR: περίπου 200 bp για τη μορφή pipiens, 250 bp για τη μορφή molestus, και οι δύο ζώνες για τα υβρίδια pipiens/molestus. Πρότυπη εικόνα primers: pipcq11r, molcq11r, CQ11F2 για τα υβρίδια pipiensmolestus Πραγματοποιήθηκε ενίσχυση του μικροδορυφόρου CQ11 στα 120 άτομα pipiens με τη χρήση των κάτωθι εκκινητών: Forward: GATCCTAGCAAGCGAGAAC Reverse 1: CATGTTGAGCTTCGGTGAA Reverse 2: CCCTCCAGTAAGGTATCAAC Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 45 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Ενδεικτικά, στην εικόνα φαίνονται 6 άτομα pipiens. 14

15 Από την ανάλυση δεν προέκυψε η ανίχνευση υβριδίων ανάμεσα στις δυο μορφές 15

16 Συμπεράσματα Συζήτηση Στα δείγματα που αναλύθηκαν ανιχνεύτηκαν 35% pipiens και 48% molestus Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens. Από τα 180 δείγματα pipiens που γονοτυπήθηκαν, τα 24 ήταν ετερόζυγα για το αλληλόμορφο που σχετίζεται με ανθεκτικότητα, ενώ τα υπόλοιπα 156 άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία σε εντομοκτόνα. Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. Ανίχνευση αλληλομόρφων του γονιδίου kdr του Culex pipiens pipiens. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. Ανίχνευση υβριδίων pipiens X molestus. Από την ανάλυση δεν προέκυψε η ανίχνευση υβριδίων ανάμεσα στις δυο μορφές 16

17 Βιβλιογραφία Diamond MS. West Nile Encephalitis Virus Infection: Viral Pathogenesis and the Host Immune Response. Springer, New York, NY Gomes B, Kioulos E, Papa A, Almeida APG, Vontas J, Pinto J. Distribution and hybridization of Culex pipiens forms in Greece during the West Nile virus outbreak of Infection, Genetics and Evolution 2013; 16: Hebert PDN, Stoeckle MY., Zemlak TS, Francis CM. Identification of birds through DNA barcodes. Public Library of Science, Biology 2004; 2: Kang D., Sim C. Identification of Culex complex species using SNP markers based on high-resolution melting analysis. Mol. Ecol. Resources 2013; 13: Kent RJ, Harrington LC, Norris DE. Genetic differences between Culex pipiens f. molestus and Culex pipiens pipiens (Diptera: Culicidae) in New York. Journal of Medical Entomology. 2007; 44, Marrelli MT, Floeter-Winter LM, Malafronte RS, Tadei WP, Lourenco-De-Oliveira R, Flores-Mendoza C, Marinotti O. Amazonian malaria vector anopheline relationships interpreted from ITS2 rdna sequences. Medical and Veterinary Entomology. 2005; 19: Savage HM, Aggarwal D, Apperson CS, Katholi CR, Gordon E, Hassan HK, Anderson M, Charnetzky D, McMillen L, Unnasch EA, Unnasch TR. Host choice and West Nile virus infection rates in blood-fed mosquitoes, including members of the Culex pipiens complex, from Memphis and Shelby County, Tennessee, Vector-Borne Zoonotic Dis. 2007; 7: Weill M, Fort P, Berthomieu A, Dubois MP, Pasteur N, Raymond M. A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is nonhomologous to the ace gene in Drosophila. Proc R Soc Lond. B. Biol. Sci. 2002; 269:

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.1 Έκθεση ερευνητικού έργου Υπεύθυνος φορέας: Πανεπιστήμιο Λάρισα,

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΥΓΙΕΙΝΗΣ ΚΑΙ ΕΠΙΔΗΜΙΟΛΟΓΙΑΣ Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία Μάρκα Ανδριανή Ιατρός,

Διαβάστε περισσότερα

Γνώσεις που αποκτήθηκαν από το πρόγραμμα ελέγχου νοσημάτων που μεταδίδονται με διαβιβαστές - MALWEST

Γνώσεις που αποκτήθηκαν από το πρόγραμμα ελέγχου νοσημάτων που μεταδίδονται με διαβιβαστές - MALWEST Γνώσεις που αποκτήθηκαν από το πρόγραμμα ελέγχου νοσημάτων που μεταδίδονται με διαβιβαστές - MALWEST Χρήστος Χατζηχριστοδούλου Καθηγητής Υγιεινής και Επιδημιολογίας Τμήμα Ιατρικής, Πανεπιστήμιο Θεσσαλίας

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.17 Συγγραφή επιστημονικής εργασίας για την παρουσία και διακύμανση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013

ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

ΕΚΘΕΣΗ ΕΝΤΟΜΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ, ΕΛΛΑΔΑ, 2014

ΕΚΘΕΣΗ ΕΝΤΟΜΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ, ΕΛΛΑΔΑ, 2014 1 Εισαγωγή ΕΚΘΕΣΗ ΕΝΤΟΜΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ, ΕΛΛΑΔΑ, 2014 Η συστηματική εντομολογική επιτήρηση θεωρείται σε παγκόσμιο επίπεδο αναπόσπαστο μέρος των ολοκληρωμένων προγραμμάτων ελέγχου των διαβιβαστών και

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. α 2. γ 3. δ 4. γ 5. β 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΛΙΟΥ 2007 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 2ο 1. Σχολικό βιβλίο,

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 10 ΣΕΠΤΕΜΒΡΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ:

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗ ΤΕΤΑΡΤΗ 30 ΜΑΙΟΥ 2012 ΕΝ ΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α 1 : α Α 2 : γ Α 3 : δ Α 4 : β Α 5 : γ ΘΕΜΑ Β Β 1 : σελ. 120 σχολικού: >. Β 2 :

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Γιατί είναι σημαντική η Βιοποικιλότητα;

Γιατί είναι σημαντική η Βιοποικιλότητα; Γενετική Διαχείριση Ο όρος βιοποικιλότητα αναφέρεται σε όλους τους διαφορετικούς οργανισμούς του πλανήτη μας και περιλαμβάνει τόσο την ποικιλότητα σε επίπεδο ειδών, όσο και τη γενετική ποικιλότητα. Γιατί

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΦΡΟΝΤΙΣΤΗΡΙΑ ΜΕΣΗΣ ΕΚΠΑΙΔΕΥΣΗΣ : - ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 2014 ΘΕΜΑ A Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ B Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 1 ΙΟΥΛΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. β 2. γ 3. α 4. γ 5. δ ΘΕΜΑ 2ο 1. Σχολικό

Διαβάστε περισσότερα

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Γενετική δομή και πρότυπα διαφοροποίησης των πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Δημήτρης Τσαπάρης Jacob Fric Αθήνα, Οκτώβριος 2012 Jon

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

Κατα ολέµησηκουνου ιών

Κατα ολέµησηκουνου ιών Κατα ολέµησηκουνου ιών Κουνού ιακαιάνθρω ος: µια δύσκολη συµβίωση Α. Μιχαηλάκης Εργαστήριο Γεωργικής Εντοµολογίας, Τµήµα Εντοµολογίας και Γ. Ζωολογίας, Μπενάκειο Φυτοπαθολογικό Ινστιτούτο Βιολογικός κύκλος

Διαβάστε περισσότερα

www.epignosi.edu.gr ΘΕΜΑ Α

www.epignosi.edu.gr ΘΕΜΑ Α ΘΕΜΑ Α Να γράψετε στην κόλλα σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase

Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Επισκεφτήκαμε το ινστιτούτο νευρολογίας και γενετικής όπου μας μίλησε ο κύριος Βάσος Νεοκλέους και η κ. Αλέξια Φαίδωνος για τη μηχανή Polymerase Chain Reaction (pcr)- Αλυσιδωτή αντίδραση πολυμεράσης.η

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΝΕΛΛΗΝΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΤΕΤΑΡΤΗ 30 ΜΑΪΟΥ 2012 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o

ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ

ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ 1η ΕΠΙΣΤΗΜΟΝΙΚΗ ΔΙΗΜΕΡΙΔΑ «ΕΛΕΓΧΟΣ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΛΟΙΜΩΞΕΩΝ ΕΦΑΡΜΟΓΕΣ ΣΤΗ ΚΑΘΗΜΕΡΙΝΗ ΠΡΑΞΗ ΔΥΝΑΤΟΤΗΤΕΣ ΠΡΟΟΠΤΙΚΕΣ» ΛΑΜΙΑ 21 22 22 ΟΚΤΩΒΡΙΟΥ 2005 ΤΟ ΕΡΓΑΣΤΗΡΙΟ ΚΛΙΝΙΚΗΣ ΜΙΚΡΟΒΙΟΛΟΓΙΑΣ ΣΤΟΝ ΕΛΕΓΧΟ ΤΩΝ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

Πρακτικά Τελικής Διάσκεψης

Πρακτικά Τελικής Διάσκεψης Πρακτικά Τελικής Διάσκεψης 24-25 Φεβρουαρίου 2014 Τοποθεσία : Ξενοδοχείο Radisson Blu Park Λεωφόρος Αλεξάνδρας 10, Αθήνα Συμμετέχοντες 116 Περιεχόμενα 1. Στόχοι συνάντησης... 3 2. Συμμετέχοντες... 4 3.

Διαβάστε περισσότερα

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ ΕΣ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 11 ΣΕΠΤΕΜΒΡΙΟΥ 2013 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ:

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 24 Μαΐου 2013 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Βασική μονάδα οργάνωσης αποτελεί το Γ. νουκλεόσωμα

Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

e-mail: g.koliopoulos@bpi.gr

e-mail: g.koliopoulos@bpi.gr 3ο ΠΑΝΕΛΛΗΝΙΟ ΣΥΝΕ ΡΙΟ ΤΟΥ ΦΟΡΟΥΜ ΗΜΟΣΙΑΣ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΙΑΤΡΙΚΗΣ Εντοµολογική επιτήρηση για την αντιµετώπιση της ελονοσίας ρ Γεώργιος Κολιόπουλος Εργαστήριο Ελέγχου Γεωργικών Φαρµάκων Τµήµα Ελέγχου

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα

Η Κυτταρογενετική στις αιματολογικές κακοήθειες

Η Κυτταρογενετική στις αιματολογικές κακοήθειες Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας, ΙΠΤ-Α, Ε.Κ.Ε.Φ.Ε. «Δημόκριτος» Η Κυτταρογενετική στις αιματολογικές κακοήθειες Μανωλά Καλλιόπη, Ph.D Ερευνήτρια Γ Κυτταρογενετική Κλάδος της Γενετικής

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2.

ΘΕΜΑ Α Α1. γ Α2. γ Α3. α Α4. β Α5. β ΘΕΜΑ B B1. B2. ΘΕΜΑ Α Α1. γ (το πριμόσωμα) Α2. γ (οι υποκινητές και οι μεταγραφικοί παράγοντες κάθε γονιδίου) Α3. α (μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα) Α4. β (αποδιάταξη των δύο συμπληρωματικών αλυσίδων)

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ ΘΕΜΑ 1ο 1. γ 2. γ 3. β 4. α 5. δ 1 ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 9 ΣΕΠΤΕΜΒΡΙΟΥ 2009 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ

Διαβάστε περισσότερα

Αϖοµόνωση και γενετική διαφοροϖοίηση ϖληθυσµών του ζαρκαδιού (Capreoluscapreolus) στην Ελλάδα νέα δεδοµένα για αϖοτελεσµατικότερη διαχείριση και διατήρηση ηµήτρης Τσαϖάρης Παναγιώτης Κασαϖίδης Κωνσταντίνος

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5.

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ. Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. ΘΕΜΑ Α Α1: δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 4 ΙΟΥΝΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Β1. Η σωστή σειρά για την κατασκευή καρυοτύπου: 4 2 1 6 3 5. Β2. α. DNA πολυµεράση β. πριµόσωµα.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση

ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003

ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΒΙΟΛΟΓΙΑ Γ ΤΑΞΗΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2003 ΘΕΜΑ 1ο Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι

Διαβάστε περισσότερα

Έκθεση πεπραγμένων φυσικού αντικειμένου

Έκθεση πεπραγμένων φυσικού αντικειμένου Ειδικό Πρόγραμμα Ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία Ενίσχυση της επιτήρησης στην ελληνική επικράτεια Αρ. Πρωτ.: 12 Ημερομηνία: 15/01/2013 Έκθεση πεπραγμένων φυσικού αντικειμένου 2 ου

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ:

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) DNA

Διαβάστε περισσότερα

Γενετική της ιατήρησης επαπειλούμενων ειδών

Γενετική της ιατήρησης επαπειλούμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2014 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Πασσιά Α. Γενικές εξετάσεις 20 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Θέμα Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013

ΘΕΜΑ 1 Ο ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 01/12/2013 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ:

ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ: ΓΕΝΕΤΙΚΗ ΠΡΟΔΙΑΘΕΣΗ ΣΤΗΝ ΕΜΦΑΝΙΣΗ ΝΟΣΩΝ ΠΟΥ ΣΧΕΤΙΖΟΝΤΑΙ ΜΕ ΠΕΡΙΒΑΛΛΟΝΤΙΚΗ ΕΚΘΕΣΗ: Ανάλυση γονιδιακών πολυμορφισμών Σταυροπούλου Χρύσα,PhD Εργαστήριο Υγειοφυσικής & Περιβαλλοντικής Υγείας Ινστιτούτο Πυρηνικής

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΔΙΑΓΩΝΙΣΜΑ 2 ΘΕΜΑ 1 Ο Α. 1 β, 2 α, 3 δ, 4 δ, 5 γ Β. 1 Λ, 2 Σ, 3 Λ, 4 Λ, 5 Λ ΘΕΜΑ 2 Ο Α. 1) α- θαλασσαιμία Σελ 93 σχολικού βιβλίου: ʽʽΤα γονίδια

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR)

ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) ΕΡΓΑΣΤΗΡΙΑΚΗ ΑΣΚΗΣΗ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ POLYMERASE CHAIN REACTION (PCR) Α. ΘΕΩΡΗΤΙΚΟ ΜΕΡΟΣ Σταμάτης Κουσίσης, Δημοσθένης Κίζης, Δήμητρα Χούχουλα Βασική αρχή της Αλυσιδωτής Αντίδρασης της Πολυμεράσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ÍÅÏ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ B ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ Β1. Η γονιδιακή θεραπεία εφαρµόστηκε για πρώτη φορά το Σεπτέµβριο του 1990 σε ένα τετράχρονο

Διαβάστε περισσότερα