Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS )

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)"


1 «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.18 Ενημέρωση με τα στοιχεία από τα ευρήματα της έρευνας για τη δραστηριότητα με τίτλο «Γενετική ανάλυση των κουνουπιών του είδους Culex pipiens» Υπεύθυνοι φορείς: Εργαστήριο Γενετικής, Εξελικτικής και Συγκριτικής Βιολογίας, Τμήμα Βιοχημείας και Βιοτεχνολογίας, Πανεπιστήμιο Θεσσαλίας Λάρισα, 2013

2 Περιεχόμενα Εισαγωγή.. 3 Μεθοδολογία Αποτελέσματα 8 Συμπεράσματα Συζήτηση. 16 Βιβλιογραφία. 17 2

3 Εισαγωγή Τα κουνούπια του συμπλέγματος Culex pipiens είναι οι πρωταρχικοί φορείς νοσημάτων με παγκόσμια κατανομή όπως η εγκεφαλίτιδα του Δυτικού Νείλου, η εγκεφαλίτιδα των ιπποειδών, η λεμφική φιλαρίαση, καθώς και πολλών αρμποϊών (Diamond, 2009). Αν και τα είδη που αποτελούν την ομάδα αυτή των κουνουπιών μοιάζουν μορφολογικά, η διαφοροποίηση των ηθολογικών, φυσιολογικών και αναπαραγωγικών χαρακτήρων οδηγεί σε περιορισμένη γεωγραφική κατανομή ή και σε εξειδικευμένους οικολογικούς θώκους. Στην Ευρώπη δύο μορφές κουνουπιών του συμπλέγματος, οι pipiens και molestus, έχουν χαρακτηριστεί ως βασικοί φορείς του ιού του Δυτικού Νείλου. Η μορφή pipiens είναι ευρύγαμη (διασταυρώνεται σε ανοιχτούς χώρους), ενώ η molestus είναι στενόγαμη (μπορεί να διασταυρωθεί σε περιορισμένους χώρους) (Kent, et al., 2007). Η μορφή pipiens είναι μη αυτογενής (απαιτεί πρόσληψη αίματος για την παραγωγή αυγών) και προτιμάει το αίμα των πτηνών (Kent, et al., 2007), σε αντίθεση με τη μορφή molestus που είναι αυτογενής (δεν απαιτεί πρόσληψη αίματος για την παραγωγή απογόνων) (Kent, et al., 2007) και προτιμάει να θρέφεται από θηλαστικά, συμπεριλαμβανομένου του ανθρώπου. Η μορφή pipiens είναι ετεροδυναμική (υποβάλλεται σε χειμέρια αναπαραγωγική διάπαυση), ενώ η μορφή molestus είναι ομοδυναμική, παραμένοντας ενεργή κατά τη διάρκεια του χειμώνα. Τέλος, αν και οι δύο μορφές στη Βόρεια Ευρώπη έχουν διαχωρισμένους οικολογικούς θώκους με υπέργεια (pipiens) και υπόγεια (molestus) ενδιαιτήματα, στη Νότια Ευρώπη οι δύο μορφές μπορεί να διαβιούν συμπατρικά σε υπέργεια ενδιαιτήματα, γεγονός που ευνοεί τον υβριδισμό μεταξύ των ειδών, με αποτέλεσμα να έχουν περιγραφεί πληθυσμοί με ενδιάμεσα βιολογικά χαρακτηριστικά (Gomes, et al., 2013). Τα υβρίδια αυτά έχουν μεγάλη επιδημιολογική σημασία, καθώς έχουν επιδεικνύουν περισσότερο τυχαίες συμπεριφορές ως προς τις διατροφικές τους συνήθειες (Gomes, et al., 2013). Οι επιπτώσεις αυτών των διαφορετικών συμπεριφορών στην μετάδοση των ασθενειών είναι σημαντικές και ως εκ τούτου 3

4 προκύπτει η ανάγκη ανάπτυξης μεθόδων, οι οποίες θα επιτρέπουν την έγκυρη ταυτοποίηση των κουνουπιών πριν εκτιμηθεί με ακρίβεια ο ρόλος τους ως φορείς. Δυστυχώς, παρά τις έντονες διαφοροποιήσεις των βιολογικών τους χαρακτηριστικών οι μορφολογικές διαφορές είναι πολύ περιορισμένες γεγονός που δυσχεραίνει την ταυτοποίηση των ειδών του συμπλέγματος βάσει μορφολογίας και κατά συνέπεια την ορθολογική τους διαχείριση. Στην προσπάθεια ταυτοποίησης των ειδών του συμπλέγματος προτάθηκαν και εφαρμόστηκαν διάφορες γενετικές προσεγγίσεις, που στα αρχικά στάδια αφορούσαν ηλεκτροφορήσεις πρωτεϊνών και μεθόδους υβριδισμό. Σχετικά πρόσφατα οι εφαρμογές της μοριακής βιολογίας σε συνδυασμό με την αλυσιδωτή αντίδραση πολυμεράσης (PCR) επέτρεψαν την ανάπτυξη μοριακών δεικτών που απαιτούν μια ελάχιστη ποσότητα δείγματος προς ταυτοποίηση και είναι ικανοί να δώσουν ακριβέστερες απαντήσεις. Πολλές από τις μεθόδους PCR εξέτασαν την ποικιλομορφία αλληλουχιών σε ειδικούς πυρηνικούς τόπους, άλλες εστίασαν σε πληροφορίες από δύο ή και περισσότερα γονίδια καθώς και από αναλύσεις με Multiplex PCR που περιλάμβαναν τόσο «συντηρημένους», «παγκόσμιους» όσο και εξειδικευμένους εκκινητές. Τέλος, πρόσφατα επιχειρείται διαχωρισμός ειδών και υβριδίων με τη χρήση μικροδορυφορικών δεικτών. Ωστόσο, οι περισσότερες μελέτες με ικανοποιητικά αποτελέσματα εστιάζονται στις αναλύσεις πολυμορφισμών (α) του γονιδίου της κυτοχρωμικής οξειδάσης 1 (CO1) του mtdna (β) του γονιδίου της ακετυλοχολινεστεράσης (ace-2) του πυρηνικού DNA (3) του internal transcribed spacer (ITS) ριβοσωμικού DNA και (4) δεικτών μικροδορυφορικού DNA. Σε αντίθεση με τις πολλές μελέτες με πυρηνικά γονίδια, σχετικά λίγες ταξινομικές μελέτες εστιάστηκαν στο μιτοχονδριακό (mt) DNA στα κουνούπια και ακόμη λιγότερες μελέτησαν τον πολυμορφισμό του γονιδίου CO1 παρά τη διαγνωσμένη ικανότητά του στη διευθέτηση ταξινομικών προβλημάτων και ανάλυσης της βιοποικιλότητας (Hebert, et al., 2004). Το γονίδιο CO1 είναι παρόν σε εκατοντάδες 4

5 αντίγραφα ανά κύτταρο, δεν εμπεριέχει ενθέσεις ή ελλείμματα και όπως κάθε γονίδιο που κωδικοποιεί για πρωτεΐνες, η τρίτη θέση των κωδικονίων παρουσιάζει μεγάλο ρυθμό νουκλεοτιδικών υποκαταστάσεων. Αλλαγές στην αμινοξική του αλληλουχία εμφανίζονται πιο αργά από κάθε άλλο μιτοχονδριακό γονίδιο, βοηθώντας στη διερεύνηση μεγαλύτερων ταξινομικών λεπτομερειών και στον ευκολότερο σχεδιασμό εκκινητών. Μελέτη σε εξέλιξη στο εργαστήριό μας για τον διαχωρισμό των ειδών του συμπλέγματος με τη χρήση του γονιδίου CO1 απέδειξε την αποτελεσματικότητα της μεθόδου. H παρουσία δύο πυρηνικών γονιδίων που κωδικοποιούν για την ακετυλοχολινεστεράση (ACE) ανακαλύφθηκαν για πρώτη φορά στο Culex pipiens και στη συνέχεια βρέθηκαν και σε άλλα είδη κουνουπιών (Weill, et al., 2002). Το γονίδιο ace-1 προσδίδει ανθεκτικότητα στα οργανοφωσφορικά εντομοκτόνα και συνεπώς υπόκειται σε επιλεκτική πίεση. Το γονίδιο ace-2 είναι φυλοσύνδετο και η ακριβής λειτουργία του, καθώς και οι επιλεκτικές πιέσεις που ασκούνται σε αυτό δεν έχουν διευκρινισθεί. Η ανάλυση συνήθως εστιάζεται στους πολυμορφισμούς του γονίδιου ace-2 μετά από ενίσχυση με PCR με τη χρήση ειδικών εκκινητών (Savage, et al., 2007, Kang and Sim, 2013). Οι αλληλουχίες των πυρηνικών ριβοσωμικών DNA (rdna) γονιδίων στα αρθρόποδα είναι διατεταγμένες επαναλαμβανόμενα σε σειρά και η κάθε μονάδα περιλαμβάνει τα γονίδια για τα 18S, 5,8S και 28S ριβοσωμικά RNA. Οι συντηρημένες δομικές μονάδες των γονιδίων διαχωρίζονται από διαγονιδικά διαστήματα και τα εσωτερικά μεταγραφόμενα διαστήματα. Μέσα στις μονάδες, το πρώτο ενδιάμεσο μεταγραφόμενο διάστημα (internal transcribed spacer, ITS-1) διαχωρίζει το γονίδιο 18S από το γονίδιο 5,8S, ενώ το δεύτερο ενδιάμεσο μεταγραφόμενο διάστημα (ITS- 2) διαχωρίζει το γονίδιο 5,8S από το γονίδιο 28S. Οι περιοχές ITS-1 και ITS-2 έχουν χρησιμοποιηθεί ευρέως σε ταξινομικές και φυλογενετικές αναλύσεις των κουνουπιών και έχουν αποδειχθεί χρήσιμες στην επίλυση προβλημάτων που 5

6 σχετίζονται με την ταυτοποίηση και διαχωρισμό μορφολογικά παρόμοιων ειδών μετά από ενίσχυση με PCR (Marrelli, et al., 2005). Οι μικροδορυφορικοί δείκτες αποτελούν την καλύτερη επιλογή για μελέτες σε επίπεδο ενδοειδικών πληθυσμών και υποειδών, ειδικότερα για τον χαρακτηρισμό υβριδίων, λόγω του ότι εμφανίζουν υψηλά επίπεδα πολυμορφισμού και μπορούν να χρησιμοποιηθούν για να περιγράψουν την γενετική ποικιλότητα μέσα σε πληθυσμούς και να εκτιμήσουν το βαθμό γενετικής διαφοροποίησης μεταξύ των πληθυσμών. Υπάρχουν αρκετές δημοσιεύσεις που περιγράφουν μικροδορυφορικούς τόπους κατάλληλους να χρησιμοποιηθούν στα μέλη του συμπλέγματος Culex pipiens (για επισκόπηση Gomes, et al., 2013). Πολύ πρόσφατα η χρήση μικροδορυφόρων αποδείχτηκε χρήσιμη στην ταυτοποίηση υβριδίων ανάμεσα σε pipiens και molestus (Gomes, et al., 2013). Η συνδυαστική εφαρμογή των μεθόδων που περιγράφηκαν εν συντομία και έχει αποδειχτεί αρκετά αξιόπιστη στην τυποποίηση του συμπλέγματος τόσο σε παγκόσμιο όσο και ευρωπαϊκό επίπεδο, έχοντας συμβάλει σημαντικά στο σχεδιασμό πρωτοκόλλων διαχείρισης των ασθενειών, των οποίων είναι φορείς. Είναι προφανές ότι αφενός η ευρεία εφαρμογή τους στην Ελλάδα και αφετέρου η ανάπτυξη αποτελεσματικότερων και όσο το δυνατόν λιγότερο κοστοβόρων και χρονοβόρων μεθόδων είναι επιβεβλημένη και αποτελεί απαραίτητη προϋπόθεση για την ανάλυση της εμφάνισης και της επιδημιολογίας ασθενειών όπως αυτή που προέρχεται από τον ιό του Δυτικού Νείλου. Στόχος Στόχος του πρωτοκόλλου είναι η εφαρμογή μεθόδων που περιλαμβάνουν ένα πλέγμα τεχνικών και τύπων DNA, προκειμένου να ταυτοποιηθούν και να διαχωριστούν τα είδη του συμπλέγματος Cx. pipiens καθώς και τα μεταξύ τους υβρίδια με ταχύτητα και ακρίβεια.. Πιο συγκεκριμένα η μελέτη θα εστιαστεί στις αναλύσεις πολυμορφισμών (α) του γονιδίου της κυτοχρωμικής οξειδάσης 1 (CO1) 6

7 του mtdna και (β) των γονιδίων της ακετυλοχολινεστεράσης (ace-2 και ace-1) και του kdr του πυρηνικού DNA. Σε αντίθεση με τις πολλές μελέτες με πυρηνικά γονίδια, σχετικά λίγες ταξινομικές μελέτες εστιάστηκαν στο μιτοχονδριακό (mt) DNA στα κουνούπια και ακόμη λιγότερες μελέτησαν τον πολυμορφισμό του γονιδίου CO1 (Rey et al. 2001; Fairley et al. 2000, 2002; Sallum et al ), παρά τη διαγνωσμένη ικανότητά του στη διευθέτηση ταξινομικών προβλημάτων και ανάλυσης της βιοποικιλότητας (Hebert et al. 2004). Το γονίδιο CO1 είναι παρόν σε εκατοντάδες αντίγραφα ανά κύτταρο, δεν εμπεριέχει ενθέσεις ή ελλείμματα και όπως κάθε γονίδιο που κωδικοποιεί για πρωτεΐνες, η τρίτη θέση των κωδικονίων παρουσιάζει μεγάλο ρυθμό νουκλεοτιδικών υποκαταστάσεων. Αλλαγές στην αμινοξική του αλληλουχία εμφανίζονται πιο αργά από κάθε άλλο μιτοχονδριακό γονίδιο, βοηθώντας στη διερεύνηση μεγαλύτερων ταξινομικών λεπτομερειών και στον ευκολότερο σχεδιασμό εκκινητών. H παρουσία δύο πυρηνικών γονιδίων που κωδικοποιούν για την ακετυλοχολινεστεράση (ACE) ανακαλύφθηκαν για πρώτη φορά στο Cx. pipiens (Bourguet et al. 1996; Malcolm et al. 1998) και στη συνέχεια βρέθηκαν και σε άλλα είδη κουνουπιών (Weill et al. 2002). Το γονίδιο ace-1 προσδίδει ανθεκτικότητα στα οργανοφωσφορικά εντομοκτόνα και συνεπώς υπόκειται σε επιλεκτική πίεση. Το γονίδιο ace-2 είναι φυλοσύνδετο και η ακριβής λειτουργία του, καθώς και οι επιλεκτικές πιέσεις που ασκούνται σε αυτό δεν έχουν διευκρινισθεί. Η ανάλυση θα εστιαστεί στους πολυμορφισμούς του γονίδιου ace-2 μετά από ενίσχυση με PCR με τη χρήση ειδικών εκκινητών. 7

8 Μεθοδολογία Αποτελέσματα Συνολικά αναλύθηκαν 520 έντομα που προέρχονταν από την περιοχή της Κάρλας 1. Πρωτόκολλο: Κατάταξη των μελών του συμπλέγματος Cx. pipiens σε φυλογενετικές ομάδες με τη χρήση του μιτοχονδριακού γονιδίου CO1. Πραγματοποιήθηκε ενίσχυση τμήματος τους γονιδίου COI με τη χρήση των κάτωθι εκκινητών: Forward: GGTCAACAAATCATAAAGATATTGG Reverse: TAAACTTCAGGGTGACCAAAAAATCA Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 52 ο C για 50 και επέκτασης στους 72 ο C για 55 και τελική επέκταση στους 72 ο C για 10. Tα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα προϊόντα της PCR καθαρίστηκαν και αλληλουχήθηκαν Τα αποτελέσματα της αλληλούχησης ήταν τα ακόλουθα Είδος Ποσοστό Culex pipiens pipiens 35 Culex pipiens molestus 48 Culex modestus 2,5 Ochlerotatus caspius 8 Aedes vexans 0,5 Anopheles labranchiae 1 Coquillettidia richardii 0,5 Chironomus plumosus 1 Chironomus balatonicus 2 Sesamia nonagrioides 0,8 Opostega salaciella 0,7 2. Πρωτόκολλο: ειδο-ειδική PCR που βασίζεται στους πολυμορφισμούς του 2 ου ιντρονίου του γονιδιακού τόπου της ακετυλοχολινεστεράσης-2 με σκοπό την 8

9 ταυτοποίηση και τον διαχωρισμό ανάμεσα σε Culex pipiens pipiens και Culex pipiens molestus Πραγματοποιήθηκε ενίσχυση τμήματος του γονιδίου ACE-2 χρησιμοποιώντας τους κάτωθι εκκινητές: Forward: GAGGAGATGTGGAATCCCAA Reverse: TGGAGCCTCCTCTTCACGGC Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 96 ο C για 4, 35 κύκλοι αποδιάταξης στους 96 ο C για 40, υβριδοποίησης των εκκινητών στους 52 ο C για 45 και επέκτασης στους 72 ο C για 55 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην κάτωθι εικόνα: Τα πρώτα 10 δείγματα είναι pipiens ενώ τα υπόλοιπα είναι molestus. Ελέγχθηκαν συνολικά 400 δείγματα και ταυτοποιήθηκαν 180 pipiens και 220 molestus. 3. Πρωτόκολλο: Ανίχνευση της μετάλλαξης G119S στο ace-1 του Culex pipiens pipiens με χρήση διαγνωστικού ελέγχου βασισμένου στην PCR με σκοπό τον προσδιορισμό ανθεκτικών ή μη στελεχών Πραγματοποιήθηκε ενίσχυση τμήματος τους γονιδίου ACE-1 με τη χρήση των κάτωθι εκκινητών: Forward: CCGGGGGCCACCATGTGGAA 9

10 Reverse: ACGATCACGTTCTCCTCCGA Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 40 και επέκτασης στους 72 ο C για 30 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Η γονοτύπηση του πολυμορφισμού (G119S) πραγματοποιήθηκε με μεθοδολογία PCR-RFLP με τη χρήση του ενζύμου AluI. Η ανάλυση έγινε σύμφωνα με το ακόλουθο πρότυπο. Εάν ομοζυγωτικό ευαίσθητο: 194 bp Εάν ομοζυγωτικό ανθεκτικό: bp Εάν ετεροζυγωτικό ανθεκτικό: bp Από τα 180 δείγματα pipiens που γονοτυπήθηκαν, τα 24 ήταν ετερόζυγα για το αλληλόμορφο που σχετίζεται με ανθεκτικότητα, ενώ τα υπόλοιπα 156 άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία σε εντομοκτόνα. 4. Πρωτόκολλο: Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens Η ενίσχυση τμήματος του γονιδίου ACE1 για την ταυτόχρονη γονοτύπηση της θέσης F290V, η οποία σχετίζεται με ανθεκτικότητα σε εντομοκτόνα, πραγματοποιήθηκε σε 3 ξεχωριστές αντιδράσεις. Οι εκκινητές που χρησιμοποιήθηκαν για την κάθε αντίδραση είναι οι κάτωθι: Αντίδραση 1: ενίσχυση τμήματος 542 bp όπου περιέχεται η θέση F290V (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) Forward: GTCTGGCCGAGGCCGTCA Reverse: TGCTTCTGTGCGTGTACAGG 10

11 Αντίδραση 2: ενίσχυση τμήματος 148 bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ανθεκτικότητα Forward: GTCTGGCCGAGGCCGTCA Reverse: TCCACAACCGGAACGAACGGAAA Αντίδραση 3: ενίσχυση τμήματος 435 bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ευαισθησία Forward: ACGCTGGGGATCTGCGAGG Reverse: TGCTTCTGTGCGTGTACAGG Όλες οι αντιδράσεις πραγματοποιήθηκαν στις ίδιες συνθήκες PCR. Οι συνθήκες που χρησιμοποιήθηκαν είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 30, υβριδοποίησης των εκκινητών στους 56 ο C για 40 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην ακόλουθη εικόνα: Ανθεκτικότητα Ευαισθησία Το R συμβολίζει τα δείγματα που φέρουν το αλληλόμορφο που σχετίζεται με ανθεκτικότητα. Η αρίθμηση 1 3 αντιστοιχεί στην αρίθμηση των αντιδράσεων. Ελέγχθηκαν 180 δείγματα pipiens. Όλα τα άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. 11

12 5. Πρωτόκολλο: Ανίχνευση αλληλομόρφων του γονιδίου kdr του Culex pipiens pipiens με χρήση διαγνωστικού ελέγχου βασισμένου στην PCR με σκοπό την ανίχνευση ανθεκτικότητας ή μη. Πραγματοποιήθηκε ενίσχυση τμήματος του γονιδίου kdr που κωδικοποιεί για ένα τασοεξαρτώμενο κανάλι νατρίου σε 2 αντιδράσεις. Οι εκκινητές που χρησιμοποιήθηκαν για την κάθε αντίδραση είναι οι κάτωθι: Αντίδραση 1: ενίσχυση ενός τμήματος bp (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) κι ενός τμήματος bp, η οποία πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ευαισθησία. Forward 1: GTGGAACTTCACCGACTTC Forward 2: CCACCGTAGTGATAGGAAATTTA Reverse: GCAAGGCTAAGAAAAGGTTAAG Αντίδραση 2: ενίσχυση ενός τμήματος bp (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) κι ενός τμήματος bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ανθεκτικότητα. Forward 1: GTGGAACTTCACCGACTTC Forward 2: CCACCGTAGTGATAGGAAATTTT Reverse: GCAAGGCTAAGAAAAGGTTAAG Όλες οι αντιδράσεις πραγματοποιήθηκαν στις ίδιες συνθήκες PCR. Οι συνθήκες που χρησιμοποιήθηκαν είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 45 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην ακόλουθη εικόνα: 12

13 Το R συμβολίζει τα δείγματα που φέρουν το αλληλόμορφο που σχετίζεται με ανθεκτικότητα και το S αυτά που φέρουν το αλληλόμορφο που σχετίζεται με ευαισθησία. Η αρίθμηση 1 14 αντιστοιχεί στον αριθμό των δειγμάτων. Στο πάνω μέρος του πηκτώματος φαίνονται οι αντιδράσεις 1 και στο κάτω μέρος του πηκτώματος οι αντιδράσεις 2. Η κάθε στήλη αντιστοιχεί σε ένα δείγμα. Τα πρώτα 7 δείγματα είναι pipiens ενώ τα υπόλοιπα είναι molestus. Φαίνεται πως αυτή η τεχνική δεν εφαρμόζεται στα molestus. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. 6. Πρωτόκολλο: Ανίχνευση υβριδίων pipiens X molestus Η μέθοδος βασίζεται στην PCR με τη χρήση ενός forward και δύο reverse εκκινητών ειδικών για τις μορφές pipiens και molestus, οι οποίοι ενισχύουν την παρακείμενη περιοχή του μικροδορυφορικού τόπου CQ11. Ο διαχωρισμός βασίζεται στο μέγεθος 13

14 του προϊόντος της PCR: περίπου 200 bp για τη μορφή pipiens, 250 bp για τη μορφή molestus, και οι δύο ζώνες για τα υβρίδια pipiens/molestus. Πρότυπη εικόνα primers: pipcq11r, molcq11r, CQ11F2 για τα υβρίδια pipiensmolestus Πραγματοποιήθηκε ενίσχυση του μικροδορυφόρου CQ11 στα 120 άτομα pipiens με τη χρήση των κάτωθι εκκινητών: Forward: GATCCTAGCAAGCGAGAAC Reverse 1: CATGTTGAGCTTCGGTGAA Reverse 2: CCCTCCAGTAAGGTATCAAC Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 45 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Ενδεικτικά, στην εικόνα φαίνονται 6 άτομα pipiens. 14

15 Από την ανάλυση δεν προέκυψε η ανίχνευση υβριδίων ανάμεσα στις δυο μορφές 15

16 Συμπεράσματα Συζήτηση Στα δείγματα που αναλύθηκαν ανιχνεύτηκαν 35% pipiens και 48% molestus Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens. Από τα 180 δείγματα pipiens που γονοτυπήθηκαν, τα 24 ήταν ετερόζυγα για το αλληλόμορφο που σχετίζεται με ανθεκτικότητα, ενώ τα υπόλοιπα 156 άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία σε εντομοκτόνα. Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. Ανίχνευση αλληλομόρφων του γονιδίου kdr του Culex pipiens pipiens. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. Ανίχνευση υβριδίων pipiens X molestus. Από την ανάλυση δεν προέκυψε η ανίχνευση υβριδίων ανάμεσα στις δυο μορφές 16

17 Βιβλιογραφία Diamond MS. West Nile Encephalitis Virus Infection: Viral Pathogenesis and the Host Immune Response. Springer, New York, NY Gomes B, Kioulos E, Papa A, Almeida APG, Vontas J, Pinto J. Distribution and hybridization of Culex pipiens forms in Greece during the West Nile virus outbreak of Infection, Genetics and Evolution 2013; 16: Hebert PDN, Stoeckle MY., Zemlak TS, Francis CM. Identification of birds through DNA barcodes. Public Library of Science, Biology 2004; 2: Kang D., Sim C. Identification of Culex complex species using SNP markers based on high-resolution melting analysis. Mol. Ecol. Resources 2013; 13: Kent RJ, Harrington LC, Norris DE. Genetic differences between Culex pipiens f. molestus and Culex pipiens pipiens (Diptera: Culicidae) in New York. Journal of Medical Entomology. 2007; 44, Marrelli MT, Floeter-Winter LM, Malafronte RS, Tadei WP, Lourenco-De-Oliveira R, Flores-Mendoza C, Marinotti O. Amazonian malaria vector anopheline relationships interpreted from ITS2 rdna sequences. Medical and Veterinary Entomology. 2005; 19: Savage HM, Aggarwal D, Apperson CS, Katholi CR, Gordon E, Hassan HK, Anderson M, Charnetzky D, McMillen L, Unnasch EA, Unnasch TR. Host choice and West Nile virus infection rates in blood-fed mosquitoes, including members of the Culex pipiens complex, from Memphis and Shelby County, Tennessee, Vector-Borne Zoonotic Dis. 2007; 7: Weill M, Fort P, Berthomieu A, Dubois MP, Pasteur N, Raymond M. A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is nonhomologous to the ace gene in Drosophila. Proc R Soc Lond. B. Biol. Sci. 2002; 269:


Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.1 Έκθεση ερευνητικού έργου Υπεύθυνος φορέας: Πανεπιστήμιο Λάρισα,

Διαβάστε περισσότερα

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΥΓΙΕΙΝΗΣ ΚΑΙ ΕΠΙΔΗΜΙΟΛΟΓΙΑΣ Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία Μάρκα Ανδριανή Ιατρός,

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία)

Βιοτεχνολογία Φυτών. Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Βιοτεχνολογία Φυτών ΔΠΘ / Τμήμα Αγροτικής Ανάπτυξης ΠΜΣ Αειφορικά Συστήματα Παραγωγής και Περιβάλλον στη Γεωργία Μοριακοί Δείκτες (Εισαγωγή στη Μοριακή Βιολογία) Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο

Διαβάστε περισσότερα

Πρακτικά συνάντησης εργασίας

Πρακτικά συνάντησης εργασίας Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια. Ειδικό Πρόγραμμα Ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία Ενίσχυση

Διαβάστε περισσότερα

Γνώσεις που αποκτήθηκαν από το πρόγραμμα ελέγχου νοσημάτων που μεταδίδονται με διαβιβαστές - MALWEST

Γνώσεις που αποκτήθηκαν από το πρόγραμμα ελέγχου νοσημάτων που μεταδίδονται με διαβιβαστές - MALWEST Γνώσεις που αποκτήθηκαν από το πρόγραμμα ελέγχου νοσημάτων που μεταδίδονται με διαβιβαστές - MALWEST Χρήστος Χατζηχριστοδούλου Καθηγητής Υγιεινής και Επιδημιολογίας Τμήμα Ιατρικής, Πανεπιστήμιο Θεσσαλίας

Διαβάστε περισσότερα

Πρακτικά συνάντησης εργασίας

Πρακτικά συνάντησης εργασίας Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια. Πρακτικά συνάντησης εργασίας Τετάρτη 13 Φεβρουαρίου 2013 Τοποθεσία : Εργαστήριο

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της...

ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ. Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... ΓΕΝΕΤΙΚΗ ΜΗΧΑΝΙΚΗ Η τεχνολογία του ανασυνδυασμένου DNA και οι εφαρμογές της... Γενετική Μηχανική o Περιλαμβάνει όλες τις τεχνικές με τις οποίες μπορούμε να επεμβαίνουμε στο γενετικό υλικό των οργανισμών.

Διαβάστε περισσότερα

Πρακτικά συνάντησης εργασίας

Πρακτικά συνάντησης εργασίας Ειδικό Πρόγραμμα Ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία Ενίσχυση της επιτήρησης στην ελληνική επικράτεια Πρακτικά συνάντησης εργασίας Τετάρτη 16 Μαΐου 2012 Τοποθεσία : Εργαστήριο Υγιεινής

Διαβάστε περισσότερα

Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA

Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA Εφαρμογές της τεχνολογίας του ανασυνδυασμένου DNA Aνάλυση SNP που επηρεάζουν θέσεις περιορισμού, με στύπωμα Southern. Ένα χρωμοσωμικό τμήμα μεγέθους 7 kb φέρει θέσεις BamHI σε κάθε άκρο του. Το αλληλόμορφο

Διαβάστε περισσότερα


ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΝΕΕΣ MΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΓΙΑ ΤΗΝ ΤΥΠΟΠΟΙΗΣΗ ΤΩΝ ΒΑΚΤΗΡΙΩΝ ΑΠΟΣΤΟΛΟΣ ΒΑΝΤΑΡΑΚΗΣ ΒΙΟΛΟΓΟΣ (M.Sc, Ph.D) Επιδημίες μολυσματικών ασθενειών συχνά οφείλονται σε έκθεση σε μία κοινή πηγή ενός αιτιολογικού παράγοντα.

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. (Μοριακή Βελτίωση) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ (Μοριακή Βελτίωση) 1 Βασίζεται στη χρήση μοριακών δεικτών που είναι συνδεδεμένοι με επιθυμητές χρωμοσωμικές περιοχές. Μοριακοί δείκτες είναι τυχαία επιλεγμένα τμήματα DNA χωρίς

Διαβάστε περισσότερα

Πρακτικά συνάντησης εργασίας

Πρακτικά συνάντησης εργασίας Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια. Ειδικό Πρόγραμμα Ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία Ενίσχυση

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.17 Συγγραφή επιστημονικής εργασίας για την παρουσία και διακύμανση

Διαβάστε περισσότερα

Μοριακή Ανάλυση Φυτών

Μοριακή Ανάλυση Φυτών Μοριακή Ανάλυση Φυτών Μοριακοί Δείκτες Αριστοτέλης Χ. Παπαγεωργίου Εργαστήριο Δασικής Γενετικής / ΔΠΘ Γενετική ποικιλομορφία Είναι η βάση της εξέλιξης Προϋπόθεση προσαρμογής σε νέα περιβάλλοντα Το μέρος

Διαβάστε περισσότερα

Παραδοτέο Π1.19 Πρωτόκολλο για τη μελέτη διαχείμασης εκτρεφόμενων πληθυσμών κουνουπιών

Παραδοτέο Π1.19 Πρωτόκολλο για τη μελέτη διαχείμασης εκτρεφόμενων πληθυσμών κουνουπιών «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.19 Πρωτόκολλο για τη μελέτη διαχείμασης εκτρεφόμενων πληθυσμών κουνουπιών

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS )

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS ) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.2 Τελική έκθεση πεπραγμένων ερευνητικού έργου Υπεύθυνος φορέας:

Διαβάστε περισσότερα


ΕΚΘΕΣΗ ΕΝΤΟΜΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ, ΕΛΛΑΔΑ, 2014 1 Εισαγωγή ΕΚΘΕΣΗ ΕΝΤΟΜΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ, ΕΛΛΑΔΑ, 2014 Η συστηματική εντομολογική επιτήρηση θεωρείται σε παγκόσμιο επίπεδο αναπόσπαστο μέρος των ολοκληρωμένων προγραμμάτων ελέγχου των διαβιβαστών και

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

Πληθυσμιακή Γενετική

Πληθυσμιακή Γενετική Τμήμα Αγροτικής Ανάπτυξης Πληθυσμιακή Γενετική Γενετική Ποικιλότητα Κων/νος Τζανταρμάς Αριστοτέλης Παπαγεωργίου Κλάδοι της Γενετικής 1. Κλασική γενετική 2. Μοριακή γενετική 3. Πληθυσμιακή γενετική 4. Ποσοτική

Διαβάστε περισσότερα


ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΓΕΝΕΤΙΚΗΣ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΑΝΟΙΧΤΑ ΑΚΑΔΗΜΑΙΚΑ ΜΑΘΗΜΑΤΑ ΕΙΔΙΚΑ ΘΕΜΑΤΑ ΓΕΝΕΤΙΚΗΣ Εργαστήριο 1 ο : Ιχνηλασιμότητα. Εφαρμογές των μοριακών δεικτών (στις τροφές) στα ψάρια Τριανταφυλλίδης Α Άδειες

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Β Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελκάση ε. RNA πολυμεράση Β3. Σχολικό βιβλίο, Σελ.: 98: «Η διάγνωση των

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΜΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΟ 1-2-4-5-6 ΘΕΜΑ 1 Ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό αν η πρόταση είναι σωστή,

Διαβάστε περισσότερα


Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ Tρίτη, 3 Ιουνίου 2003 ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 1Α. Να γράψετε τον αριθµό της καθεµιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν

Διαβάστε περισσότερα


ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ»

Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» Νικόλαος Σιαφάκας Λέκτορας Διαγνωστικής Ιολογίας Εργαστήριο Κλινικής Μικροβιολογίας ΠΓΝ «ΑΤΤΙΚΟΝ» DNA RNA: ΑΝΤΙΓΡΑΦΗ, ΜΕΤΑΓΡΑΦΗ, ΜΕΤΑΦΡΑΣΗ DNA RNA: Βασικά Χαρακτηριστικά Ρόλος Κεντικό Δόγμα της Βιολογίας:

Διαβάστε περισσότερα

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014

Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Θέμα Α Α1. δ Α2. γ Α3. β Α4. γ Α5. β Θέμα Β ΑΓ.ΚΩΝΣΤΑΝΤΙΝΟΥ 11 -- ΠΕΙΡΑΙΑΣ -- 18532 -- ΤΗΛ. 210-4224752, 4223687 Ενδεικτικές απαντήσεις βιολογίας κατεύθυνσης 2014 Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΑΠΑΝΤΗΣΕΙΣ ΣΤΗ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 24 ΜΑΪΟΥ 2013 ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ Β Β1. Σελ. 123 124 σχολ. βιβλίου: «Η διαδικασία που ακολουθείται παράγουν το ένζυμο ADA». Β2. Σελ. 133 σχολ.

Διαβάστε περισσότερα

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο.

Γ1. Το γνώρισμα για το μέγεθος των φτερών ελέγχεται από αυτοσωμικό γονίδιο. ΠΑΝΕΛΛΗΝΙΕΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2013 AΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1.γ Α2.β Α3.α Α4.δ Α5.α ΘΕΜΑ Β Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το 1990 σε ένα κορίτσι που έπασχε από έλλειψη της απαμινάσης

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα


Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 ο Α. 1 - Γ 2 - Β 3-4 - Γ 5 - Β. 1 - Σ 2 - Λ 3 - Λ 4 - Λ 5 - Σ ΘΕΜΑ 2 ο ΑΠΑΝΤΗΣΕΙΣ 1. Κάθε είδος αντισώµατος που αναγνωρίζει έναν αντιγονικό καθοριστή παράγεται

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

Γιατί είναι σημαντική η Βιοποικιλότητα;

Γιατί είναι σημαντική η Βιοποικιλότητα; Γενετική Διαχείριση Ο όρος βιοποικιλότητα αναφέρεται σε όλους τους διαφορετικούς οργανισμούς του πλανήτη μας και περιλαμβάνει τόσο την ποικιλότητα σε επίπεδο ειδών, όσο και τη γενετική ποικιλότητα. Γιατί

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS )

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS ) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.11 Χάρτες απεικόνισης με χρήση GIS κρουσμάτων, παγίδων εντόμων,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Θετικής κατεύθυνσης Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή σειρά είναι: 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάσες ε. RNA πολυμεράση Β3. Σχολικό

Διαβάστε περισσότερα

Τελική Διάσκεψη MALWEST

Τελική Διάσκεψη MALWEST Τελική Διάσκεψη MALWEST 24-25 Φεβρουαρίου 2014 Πρόγραμμα Τοποθεσία : Ξενοδοχείο Radisson Blu Park Λεωφόρος Αλεξάνδρας 10, Αθήνα Με τη συγχρηματοδότηση της www.ygeia-pronoia.gr Ευρωπαϊκής Ένωσης www.epanad.gov.gr

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β Β1. Σχολικό βιβλίο, Σελ.: 123-124: «Η διαδικασία που ακολουθείται με ενδοφλέβια ένεση στον οργανισμό». Β2. Σχολικό βιβλίο, Σελ.: 133: «Διαγονιδιακά

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 4 Ιουνίου 2014 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1δ Α.2 γ Α.3 β Α.4 γ Α.5 β ΘΕΜΑ Β B.1 4 2 1 6 3 5 B.2 α. DNAπολυμεράση β. πριμόσωμα

Διαβάστε περισσότερα

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών

πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Γενετική δομή και πρότυπα διαφοροποίησης των πληθυσμών του αρουραίου (Rattus rattus)σε συμπλέγματα νησιών και βραχονησίδων των ελληνικών θαλασσών Δημήτρης Τσαπάρης Jacob Fric Αθήνα, Οκτώβριος 2012 Jon

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ ΣΥΝΔΕΣΗ ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗ ΣΥΝΔΕΣΗ ΑΣΚΗΣΕΙΣ 1. Έστω ότι ο γενετικός τόπος pr απέχει από τον vg 11m.u Από την διασταύρωση pr vg/pr + vg + x pr vg/pr vg Τι ποσοστό των απογόνων θα είναι pr + vg/pr vg ; 1 2. Ποιες είναι οι

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. γ Α3. δ Α4. γ Α5. β


Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ


Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. δ Α2. α Α3. α Α4. γ Α5. β. ΘΕΜΑ Β Β1. Στήλη Ι Στήλη ΙΙ 1. Γ 2. Β 3. Ε 4. Α 5. Δ


Διαβάστε περισσότερα

PCR Εφαρμογές-2. RACE Site directed mutagenesis

PCR Εφαρμογές-2. RACE Site directed mutagenesis PCR Εφαρμογές-2 RACE Site directed mutagenesis Σκοπός της αντίδρασης PCR (Polymerase Chain Reaction) είναι το να φτιάξει ένα μεγάλο αριθμό αντιγράφων. BHMATA 1. ΑΠΟΔΙΑΤΑΞΗ 2. ΥΒΡΙΔΙΣΜΟΣ 3. ΕΠΙΜΗΚΥΝΣΗ Επειδή

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

Μικροβιολογία Τροφίμων Ι Εργαστήριο

Μικροβιολογία Τροφίμων Ι Εργαστήριο Μικροβιολογία Τροφίμων Ι Εργαστήριο Ενότητα 10: Μοριακή Βιολογία και Μικροβιολογία Τροφίμων (1/2), 1ΔΩ Τμήμα: Επιστήμης Τροφίμων και Διατροφής Του Ανθρώπου Διδάσκοντες: Ευστάθιος Ζ. Πανάγου Πασχαλίτσα

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β Β1 Κατά σειρά τα βήματα που οδηγούν στην κατασκευή του καρυότυπου είναι τα ακόλουθα: 4 2 1 6 3 5 Β2 α DNA πολυμεράσες

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α A1. β Α2. γ Α3. γ Α4. α Α5. δ


Διαβάστε περισσότερα

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι.

Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. σύγχρονο Φάσμα group προπαρασκευή για Α.Ε.Ι. & Τ.Ε.Ι. µαθητικό φροντιστήριο Γραβιάς 85 ΚΗΠΟΥΠΟΛΗ 50.51.557 50.56.296 25ης Μαρτίου 74 ΠΛ.ΠΕΤΡΟΥΠΟΛΗΣ 50.50.658 50.60.845 25ης Μαρτίου 111 ΠΕΤΡΟΥΠΟΛΗ 50.27.990

Διαβάστε περισσότερα

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ)

ΠΑΝΕΛΛΗΝΙΕΣ Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) ΠΑΝΕΛΛΗΝΙΕΣ 2016 Απαντήσεις Βιολογίας κατεύθυνσης (ΗΜΕΡΗΣΙΟ) Μιχάλης Χαλικιόπουλος ΘΕΜΑ Α Α1 β Α2 β Α3 δ Α4 γ Α5 γ ΘΕΜΑ Β Β1 Β2 1 Α 2 Γ 3 Α 4 Β 5 Α 6 Α 7 Γ Τα μεταφασικά χρωμοσώματα ενός κυττάρου διαφέρουν

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Department of Biochemistry

Διαβάστε περισσότερα


ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΞΕΤΑΣΕΙΣ 2013 ΑΠΑΝΤΗΣΕΙΣ στα ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1: γ Α2: β Α3: α Α4: δ Α5: α ΘΕΜΑ Β Β1: σελ. 123 από: «Η διαδικασία που ακολουθείται. Εισάγονται πάλι σ αυτόν». Β2: σελ. 133 από:

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 24 Μαΐου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. γ Α2. β Α3. α Α4. δ Α5. α ΘΕΜΑ B B1. Η διαδικασία που εφαρμόστηκε για πρώτη φορά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού

β) Σχολικό βιβλίο σελ. 96: «Αν κατά τη διάρκεια της µείωσης...τρισωµία», σελ. 97: «Η έλλειψη είναι η απώλεια γενετικού ΠΡΟΣΟΜΟΙΩΣΗ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΥΡΙΑΚΗ 4 ΜΑΪΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. α, Α2. β, Α3. δ, Α4. β, Α5. β ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1.

Διαβάστε περισσότερα

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1

ΚΕΦΑΛΑΙΟ 4. Βασικές αρχές της μοριακής βιολογίας. Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΚΕΦΑΛΑΙΟ 4 Βασικές αρχές της μοριακής βιολογίας Ακαδημαϊκές Εκδόσεις 2011 Το κύτταρο-μια Μοριακή Προσέγγιση 1 ΕΙΚΟΝΑ 4.4 Η μεταφορά της γενετικής πληροφορίας μέσω του DNA. Ακαδημαϊκές Εκδόσεις 2011 Το

Διαβάστε περισσότερα

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός

Ζεύγη βάσεων ΓΕΝΕΤΙΚΗ 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ. Φωσφοδιεστερικός δεσμός Ζεύγη βάσεων Αδενίνη Θυμίνη Γουανίνη Κυτοσίνη ΓΕΝΕΤΙΚΗ Φωσφοδιεστερικός δεσμός 11. ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ 1 ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ άμεση πρόσβαση στο γενετικό υλικό εφαρμογές στην υγεία, βελτίωση φυτών και ζώων, προστασία

Διαβάστε περισσότερα


ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ.

ΘΕΜΑ Α ΘΕΜΑ Β ΘΕΜΑ Γ. Α1. δ. Α2. γ. Α3. β. Α4. γ. Α5. β Β1. Η σωστή σειρά είναι: 4,2,1,6,3,5. Β2. α. DNA πολυμεράση. β. Πριμόσωμα. γ. ΘΕΜΑ Α ΠΑΝΕΛΛΑ ΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΚΑΙ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ(ΟΜΑ Α Β ) ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β Β1. Η σωστή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ


Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Κατα ολέµησηκουνου ιών

Κατα ολέµησηκουνου ιών Κατα ολέµησηκουνου ιών Κουνού ιακαιάνθρω ος: µια δύσκολη συµβίωση Α. Μιχαηλάκης Εργαστήριο Γεωργικής Εντοµολογίας, Τµήµα Εντοµολογίας και Γ. Ζωολογίας, Μπενάκειο Φυτοπαθολογικό Ινστιτούτο Βιολογικός κύκλος

Διαβάστε περισσότερα

Σαγρή Χ.Ευθυμία. Department of Biochemistry and Biotechnology University of Thessaly

Σαγρή Χ.Ευθυμία. Department of Biochemistry and Biotechnology University of Thessaly Department of Biochemistry and Biotechnology University of Thessaly Laboratory of Molecular Biology and Genomics ΤΡΑΝΣΚΡΙΠΤΟΜΙΚΗ ΚΑΙ ΠΡΩΤΕΟΜΙΚΗ ΑΝΑΛΥΣΗ ΤΟΥ ΣΗΜΑΝΤΙΚΟΤΕΡΟΥ ΠΑΡΑΣΙΤΟΥ ΤΗΣ ΕΛΙΑΣ, ΤΟΥ ΕΝΤΟΜΟΥ

Διαβάστε περισσότερα



Διαβάστε περισσότερα

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής

αμινοξύ. Η αλλαγή αυτή έχει ελάχιστη επίδραση στη στερεοδιάταξη και τη λειτουργικότητα της πρωτεϊνης. Επιβλαβής Κεφάλαιο 6: ΜΕΤΑΛΛΑΞΕΙΣ -ΘΕΩΡΙΑ- Μεταλλάξεις είναι οι αλλαγές που συμβαίνουν στο γενετικό υλικό ενός οργανισμού, τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις) όσο και σε χρωμοσωμικό επίπεδο (χρωμοσωμικές

Διαβάστε περισσότερα


ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο

Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο Διάλεξη 2 Μοριακή ταυτοποίηςη: είδοσ, άτομο, φφλο (Κ. Ματθιόπουλοσ) Τι είναι «είδος»; Μοριακή ταυτοποίηση: είδος, άτομο,, φύλο Πόσο αξίζει μια ομάδα οργανισμών τις προσπάθειες διατήρησής τους Δηλαδή: πόσο

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ. Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό

ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ. Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό Γενετική Πληθυσμών γενετική δομή ενός πληθυσμού αλληλόμορφα γενότυποι Ομάδα ατόμων του ίδιου είδους που μπορούν να διασταυρωθούν Πρότυπα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 11 Ιουνίου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων & Εσπερινών Γενικών Λυκείων ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. γ Α5. δ ΘΕΜΑ B Β1. 1. Β 2. Γ 3. Α

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 1. Η ΠΡΟΕΛΕΥΣΗ ΚΑΙ Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΣΚΕΨΗΣ ΚΕΦΑΛΑΙΟ 1. Η ΠΡΟΕΛΕΥΣΗ ΚΑΙ Η ΕΠΙΔΡΑΣΗ ΤΗΣ ΕΞΕΛΙΚΤΙΚΗΣ ΣΚΕΨΗΣ Οι αρχές της εξελικτικής σκέψης Η προέλευση των ειδών Ορθές και λανθασµένες αντιλήψεις σχετικά µε τη θεωρία της εξέλιξης Η θεωρία της εξέλιξης

Διαβάστε περισσότερα


ΚΕΦΑΛΑΙΟ 2 ΙΣΟΡΡΟΠΙΑ HARDY-WEINBERG ΚΕΦΑΛΑΙΟ ΙΣΟΡΡΟΠΙΑ HARDY-WEINBERG 1 Σύνοψη Σε αυτό το κεφάλαιο θα ξεκινήσουµε να µιλάµε για γενετική πληθυσµών, η οποία αναφέρεται στη δυναµική των γονιδίων µέσα στους πληθυσµούς. Θα µάθουµε να υπολογίζουµε

Διαβάστε περισσότερα

Πρακτικά Τελικής Διάσκεψης

Πρακτικά Τελικής Διάσκεψης Πρακτικά Τελικής Διάσκεψης 24-25 Φεβρουαρίου 2014 Τοποθεσία : Ξενοδοχείο Radisson Blu Park Λεωφόρος Αλεξάνδρας 10, Αθήνα Συμμετέχοντες 116 Περιεχόμενα 1. Στόχοι συνάντησης... 3 2. Συμμετέχοντες... 4 3.

Διαβάστε περισσότερα

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά;

Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; ΒΙΟΛΟΓΙΚΗ ΑΝΘΡΩΠΟΛΟΓΙΑ 12 26/10/2016 Κεφάλαιο 3 Α μέρος Εισαγωγή στη Γενετική και στη Γονιδιωματική Τι είναι η κληρονομικότητα, και πώς μεταβιβάζεται η πληροφορία από γενιά σε γενιά; Ποια είναι η δομή

Διαβάστε περισσότερα