Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS )

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)"

Transcript

1 «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.18 Ενημέρωση με τα στοιχεία από τα ευρήματα της έρευνας για τη δραστηριότητα με τίτλο «Γενετική ανάλυση των κουνουπιών του είδους Culex pipiens» Υπεύθυνοι φορείς: Εργαστήριο Γενετικής, Εξελικτικής και Συγκριτικής Βιολογίας, Τμήμα Βιοχημείας και Βιοτεχνολογίας, Πανεπιστήμιο Θεσσαλίας Λάρισα, 2013

2 Περιεχόμενα Εισαγωγή.. 3 Μεθοδολογία Αποτελέσματα 8 Συμπεράσματα Συζήτηση. 16 Βιβλιογραφία. 17 2

3 Εισαγωγή Τα κουνούπια του συμπλέγματος Culex pipiens είναι οι πρωταρχικοί φορείς νοσημάτων με παγκόσμια κατανομή όπως η εγκεφαλίτιδα του Δυτικού Νείλου, η εγκεφαλίτιδα των ιπποειδών, η λεμφική φιλαρίαση, καθώς και πολλών αρμποϊών (Diamond, 2009). Αν και τα είδη που αποτελούν την ομάδα αυτή των κουνουπιών μοιάζουν μορφολογικά, η διαφοροποίηση των ηθολογικών, φυσιολογικών και αναπαραγωγικών χαρακτήρων οδηγεί σε περιορισμένη γεωγραφική κατανομή ή και σε εξειδικευμένους οικολογικούς θώκους. Στην Ευρώπη δύο μορφές κουνουπιών του συμπλέγματος, οι pipiens και molestus, έχουν χαρακτηριστεί ως βασικοί φορείς του ιού του Δυτικού Νείλου. Η μορφή pipiens είναι ευρύγαμη (διασταυρώνεται σε ανοιχτούς χώρους), ενώ η molestus είναι στενόγαμη (μπορεί να διασταυρωθεί σε περιορισμένους χώρους) (Kent, et al., 2007). Η μορφή pipiens είναι μη αυτογενής (απαιτεί πρόσληψη αίματος για την παραγωγή αυγών) και προτιμάει το αίμα των πτηνών (Kent, et al., 2007), σε αντίθεση με τη μορφή molestus που είναι αυτογενής (δεν απαιτεί πρόσληψη αίματος για την παραγωγή απογόνων) (Kent, et al., 2007) και προτιμάει να θρέφεται από θηλαστικά, συμπεριλαμβανομένου του ανθρώπου. Η μορφή pipiens είναι ετεροδυναμική (υποβάλλεται σε χειμέρια αναπαραγωγική διάπαυση), ενώ η μορφή molestus είναι ομοδυναμική, παραμένοντας ενεργή κατά τη διάρκεια του χειμώνα. Τέλος, αν και οι δύο μορφές στη Βόρεια Ευρώπη έχουν διαχωρισμένους οικολογικούς θώκους με υπέργεια (pipiens) και υπόγεια (molestus) ενδιαιτήματα, στη Νότια Ευρώπη οι δύο μορφές μπορεί να διαβιούν συμπατρικά σε υπέργεια ενδιαιτήματα, γεγονός που ευνοεί τον υβριδισμό μεταξύ των ειδών, με αποτέλεσμα να έχουν περιγραφεί πληθυσμοί με ενδιάμεσα βιολογικά χαρακτηριστικά (Gomes, et al., 2013). Τα υβρίδια αυτά έχουν μεγάλη επιδημιολογική σημασία, καθώς έχουν επιδεικνύουν περισσότερο τυχαίες συμπεριφορές ως προς τις διατροφικές τους συνήθειες (Gomes, et al., 2013). Οι επιπτώσεις αυτών των διαφορετικών συμπεριφορών στην μετάδοση των ασθενειών είναι σημαντικές και ως εκ τούτου 3

4 προκύπτει η ανάγκη ανάπτυξης μεθόδων, οι οποίες θα επιτρέπουν την έγκυρη ταυτοποίηση των κουνουπιών πριν εκτιμηθεί με ακρίβεια ο ρόλος τους ως φορείς. Δυστυχώς, παρά τις έντονες διαφοροποιήσεις των βιολογικών τους χαρακτηριστικών οι μορφολογικές διαφορές είναι πολύ περιορισμένες γεγονός που δυσχεραίνει την ταυτοποίηση των ειδών του συμπλέγματος βάσει μορφολογίας και κατά συνέπεια την ορθολογική τους διαχείριση. Στην προσπάθεια ταυτοποίησης των ειδών του συμπλέγματος προτάθηκαν και εφαρμόστηκαν διάφορες γενετικές προσεγγίσεις, που στα αρχικά στάδια αφορούσαν ηλεκτροφορήσεις πρωτεϊνών και μεθόδους υβριδισμό. Σχετικά πρόσφατα οι εφαρμογές της μοριακής βιολογίας σε συνδυασμό με την αλυσιδωτή αντίδραση πολυμεράσης (PCR) επέτρεψαν την ανάπτυξη μοριακών δεικτών που απαιτούν μια ελάχιστη ποσότητα δείγματος προς ταυτοποίηση και είναι ικανοί να δώσουν ακριβέστερες απαντήσεις. Πολλές από τις μεθόδους PCR εξέτασαν την ποικιλομορφία αλληλουχιών σε ειδικούς πυρηνικούς τόπους, άλλες εστίασαν σε πληροφορίες από δύο ή και περισσότερα γονίδια καθώς και από αναλύσεις με Multiplex PCR που περιλάμβαναν τόσο «συντηρημένους», «παγκόσμιους» όσο και εξειδικευμένους εκκινητές. Τέλος, πρόσφατα επιχειρείται διαχωρισμός ειδών και υβριδίων με τη χρήση μικροδορυφορικών δεικτών. Ωστόσο, οι περισσότερες μελέτες με ικανοποιητικά αποτελέσματα εστιάζονται στις αναλύσεις πολυμορφισμών (α) του γονιδίου της κυτοχρωμικής οξειδάσης 1 (CO1) του mtdna (β) του γονιδίου της ακετυλοχολινεστεράσης (ace-2) του πυρηνικού DNA (3) του internal transcribed spacer (ITS) ριβοσωμικού DNA και (4) δεικτών μικροδορυφορικού DNA. Σε αντίθεση με τις πολλές μελέτες με πυρηνικά γονίδια, σχετικά λίγες ταξινομικές μελέτες εστιάστηκαν στο μιτοχονδριακό (mt) DNA στα κουνούπια και ακόμη λιγότερες μελέτησαν τον πολυμορφισμό του γονιδίου CO1 παρά τη διαγνωσμένη ικανότητά του στη διευθέτηση ταξινομικών προβλημάτων και ανάλυσης της βιοποικιλότητας (Hebert, et al., 2004). Το γονίδιο CO1 είναι παρόν σε εκατοντάδες 4

5 αντίγραφα ανά κύτταρο, δεν εμπεριέχει ενθέσεις ή ελλείμματα και όπως κάθε γονίδιο που κωδικοποιεί για πρωτεΐνες, η τρίτη θέση των κωδικονίων παρουσιάζει μεγάλο ρυθμό νουκλεοτιδικών υποκαταστάσεων. Αλλαγές στην αμινοξική του αλληλουχία εμφανίζονται πιο αργά από κάθε άλλο μιτοχονδριακό γονίδιο, βοηθώντας στη διερεύνηση μεγαλύτερων ταξινομικών λεπτομερειών και στον ευκολότερο σχεδιασμό εκκινητών. Μελέτη σε εξέλιξη στο εργαστήριό μας για τον διαχωρισμό των ειδών του συμπλέγματος με τη χρήση του γονιδίου CO1 απέδειξε την αποτελεσματικότητα της μεθόδου. H παρουσία δύο πυρηνικών γονιδίων που κωδικοποιούν για την ακετυλοχολινεστεράση (ACE) ανακαλύφθηκαν για πρώτη φορά στο Culex pipiens και στη συνέχεια βρέθηκαν και σε άλλα είδη κουνουπιών (Weill, et al., 2002). Το γονίδιο ace-1 προσδίδει ανθεκτικότητα στα οργανοφωσφορικά εντομοκτόνα και συνεπώς υπόκειται σε επιλεκτική πίεση. Το γονίδιο ace-2 είναι φυλοσύνδετο και η ακριβής λειτουργία του, καθώς και οι επιλεκτικές πιέσεις που ασκούνται σε αυτό δεν έχουν διευκρινισθεί. Η ανάλυση συνήθως εστιάζεται στους πολυμορφισμούς του γονίδιου ace-2 μετά από ενίσχυση με PCR με τη χρήση ειδικών εκκινητών (Savage, et al., 2007, Kang and Sim, 2013). Οι αλληλουχίες των πυρηνικών ριβοσωμικών DNA (rdna) γονιδίων στα αρθρόποδα είναι διατεταγμένες επαναλαμβανόμενα σε σειρά και η κάθε μονάδα περιλαμβάνει τα γονίδια για τα 18S, 5,8S και 28S ριβοσωμικά RNA. Οι συντηρημένες δομικές μονάδες των γονιδίων διαχωρίζονται από διαγονιδικά διαστήματα και τα εσωτερικά μεταγραφόμενα διαστήματα. Μέσα στις μονάδες, το πρώτο ενδιάμεσο μεταγραφόμενο διάστημα (internal transcribed spacer, ITS-1) διαχωρίζει το γονίδιο 18S από το γονίδιο 5,8S, ενώ το δεύτερο ενδιάμεσο μεταγραφόμενο διάστημα (ITS- 2) διαχωρίζει το γονίδιο 5,8S από το γονίδιο 28S. Οι περιοχές ITS-1 και ITS-2 έχουν χρησιμοποιηθεί ευρέως σε ταξινομικές και φυλογενετικές αναλύσεις των κουνουπιών και έχουν αποδειχθεί χρήσιμες στην επίλυση προβλημάτων που 5

6 σχετίζονται με την ταυτοποίηση και διαχωρισμό μορφολογικά παρόμοιων ειδών μετά από ενίσχυση με PCR (Marrelli, et al., 2005). Οι μικροδορυφορικοί δείκτες αποτελούν την καλύτερη επιλογή για μελέτες σε επίπεδο ενδοειδικών πληθυσμών και υποειδών, ειδικότερα για τον χαρακτηρισμό υβριδίων, λόγω του ότι εμφανίζουν υψηλά επίπεδα πολυμορφισμού και μπορούν να χρησιμοποιηθούν για να περιγράψουν την γενετική ποικιλότητα μέσα σε πληθυσμούς και να εκτιμήσουν το βαθμό γενετικής διαφοροποίησης μεταξύ των πληθυσμών. Υπάρχουν αρκετές δημοσιεύσεις που περιγράφουν μικροδορυφορικούς τόπους κατάλληλους να χρησιμοποιηθούν στα μέλη του συμπλέγματος Culex pipiens (για επισκόπηση Gomes, et al., 2013). Πολύ πρόσφατα η χρήση μικροδορυφόρων αποδείχτηκε χρήσιμη στην ταυτοποίηση υβριδίων ανάμεσα σε pipiens και molestus (Gomes, et al., 2013). Η συνδυαστική εφαρμογή των μεθόδων που περιγράφηκαν εν συντομία και έχει αποδειχτεί αρκετά αξιόπιστη στην τυποποίηση του συμπλέγματος τόσο σε παγκόσμιο όσο και ευρωπαϊκό επίπεδο, έχοντας συμβάλει σημαντικά στο σχεδιασμό πρωτοκόλλων διαχείρισης των ασθενειών, των οποίων είναι φορείς. Είναι προφανές ότι αφενός η ευρεία εφαρμογή τους στην Ελλάδα και αφετέρου η ανάπτυξη αποτελεσματικότερων και όσο το δυνατόν λιγότερο κοστοβόρων και χρονοβόρων μεθόδων είναι επιβεβλημένη και αποτελεί απαραίτητη προϋπόθεση για την ανάλυση της εμφάνισης και της επιδημιολογίας ασθενειών όπως αυτή που προέρχεται από τον ιό του Δυτικού Νείλου. Στόχος Στόχος του πρωτοκόλλου είναι η εφαρμογή μεθόδων που περιλαμβάνουν ένα πλέγμα τεχνικών και τύπων DNA, προκειμένου να ταυτοποιηθούν και να διαχωριστούν τα είδη του συμπλέγματος Cx. pipiens καθώς και τα μεταξύ τους υβρίδια με ταχύτητα και ακρίβεια.. Πιο συγκεκριμένα η μελέτη θα εστιαστεί στις αναλύσεις πολυμορφισμών (α) του γονιδίου της κυτοχρωμικής οξειδάσης 1 (CO1) 6

7 του mtdna και (β) των γονιδίων της ακετυλοχολινεστεράσης (ace-2 και ace-1) και του kdr του πυρηνικού DNA. Σε αντίθεση με τις πολλές μελέτες με πυρηνικά γονίδια, σχετικά λίγες ταξινομικές μελέτες εστιάστηκαν στο μιτοχονδριακό (mt) DNA στα κουνούπια και ακόμη λιγότερες μελέτησαν τον πολυμορφισμό του γονιδίου CO1 (Rey et al. 2001; Fairley et al. 2000, 2002; Sallum et al ), παρά τη διαγνωσμένη ικανότητά του στη διευθέτηση ταξινομικών προβλημάτων και ανάλυσης της βιοποικιλότητας (Hebert et al. 2004). Το γονίδιο CO1 είναι παρόν σε εκατοντάδες αντίγραφα ανά κύτταρο, δεν εμπεριέχει ενθέσεις ή ελλείμματα και όπως κάθε γονίδιο που κωδικοποιεί για πρωτεΐνες, η τρίτη θέση των κωδικονίων παρουσιάζει μεγάλο ρυθμό νουκλεοτιδικών υποκαταστάσεων. Αλλαγές στην αμινοξική του αλληλουχία εμφανίζονται πιο αργά από κάθε άλλο μιτοχονδριακό γονίδιο, βοηθώντας στη διερεύνηση μεγαλύτερων ταξινομικών λεπτομερειών και στον ευκολότερο σχεδιασμό εκκινητών. H παρουσία δύο πυρηνικών γονιδίων που κωδικοποιούν για την ακετυλοχολινεστεράση (ACE) ανακαλύφθηκαν για πρώτη φορά στο Cx. pipiens (Bourguet et al. 1996; Malcolm et al. 1998) και στη συνέχεια βρέθηκαν και σε άλλα είδη κουνουπιών (Weill et al. 2002). Το γονίδιο ace-1 προσδίδει ανθεκτικότητα στα οργανοφωσφορικά εντομοκτόνα και συνεπώς υπόκειται σε επιλεκτική πίεση. Το γονίδιο ace-2 είναι φυλοσύνδετο και η ακριβής λειτουργία του, καθώς και οι επιλεκτικές πιέσεις που ασκούνται σε αυτό δεν έχουν διευκρινισθεί. Η ανάλυση θα εστιαστεί στους πολυμορφισμούς του γονίδιου ace-2 μετά από ενίσχυση με PCR με τη χρήση ειδικών εκκινητών. 7

8 Μεθοδολογία Αποτελέσματα Συνολικά αναλύθηκαν 520 έντομα που προέρχονταν από την περιοχή της Κάρλας 1. Πρωτόκολλο: Κατάταξη των μελών του συμπλέγματος Cx. pipiens σε φυλογενετικές ομάδες με τη χρήση του μιτοχονδριακού γονιδίου CO1. Πραγματοποιήθηκε ενίσχυση τμήματος τους γονιδίου COI με τη χρήση των κάτωθι εκκινητών: Forward: GGTCAACAAATCATAAAGATATTGG Reverse: TAAACTTCAGGGTGACCAAAAAATCA Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 52 ο C για 50 και επέκτασης στους 72 ο C για 55 και τελική επέκταση στους 72 ο C για 10. Tα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα προϊόντα της PCR καθαρίστηκαν και αλληλουχήθηκαν Τα αποτελέσματα της αλληλούχησης ήταν τα ακόλουθα Είδος Ποσοστό Culex pipiens pipiens 35 Culex pipiens molestus 48 Culex modestus 2,5 Ochlerotatus caspius 8 Aedes vexans 0,5 Anopheles labranchiae 1 Coquillettidia richardii 0,5 Chironomus plumosus 1 Chironomus balatonicus 2 Sesamia nonagrioides 0,8 Opostega salaciella 0,7 2. Πρωτόκολλο: ειδο-ειδική PCR που βασίζεται στους πολυμορφισμούς του 2 ου ιντρονίου του γονιδιακού τόπου της ακετυλοχολινεστεράσης-2 με σκοπό την 8

9 ταυτοποίηση και τον διαχωρισμό ανάμεσα σε Culex pipiens pipiens και Culex pipiens molestus Πραγματοποιήθηκε ενίσχυση τμήματος του γονιδίου ACE-2 χρησιμοποιώντας τους κάτωθι εκκινητές: Forward: GAGGAGATGTGGAATCCCAA Reverse: TGGAGCCTCCTCTTCACGGC Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 96 ο C για 4, 35 κύκλοι αποδιάταξης στους 96 ο C για 40, υβριδοποίησης των εκκινητών στους 52 ο C για 45 και επέκτασης στους 72 ο C για 55 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην κάτωθι εικόνα: Τα πρώτα 10 δείγματα είναι pipiens ενώ τα υπόλοιπα είναι molestus. Ελέγχθηκαν συνολικά 400 δείγματα και ταυτοποιήθηκαν 180 pipiens και 220 molestus. 3. Πρωτόκολλο: Ανίχνευση της μετάλλαξης G119S στο ace-1 του Culex pipiens pipiens με χρήση διαγνωστικού ελέγχου βασισμένου στην PCR με σκοπό τον προσδιορισμό ανθεκτικών ή μη στελεχών Πραγματοποιήθηκε ενίσχυση τμήματος τους γονιδίου ACE-1 με τη χρήση των κάτωθι εκκινητών: Forward: CCGGGGGCCACCATGTGGAA 9

10 Reverse: ACGATCACGTTCTCCTCCGA Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 40 και επέκτασης στους 72 ο C για 30 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Η γονοτύπηση του πολυμορφισμού (G119S) πραγματοποιήθηκε με μεθοδολογία PCR-RFLP με τη χρήση του ενζύμου AluI. Η ανάλυση έγινε σύμφωνα με το ακόλουθο πρότυπο. Εάν ομοζυγωτικό ευαίσθητο: 194 bp Εάν ομοζυγωτικό ανθεκτικό: bp Εάν ετεροζυγωτικό ανθεκτικό: bp Από τα 180 δείγματα pipiens που γονοτυπήθηκαν, τα 24 ήταν ετερόζυγα για το αλληλόμορφο που σχετίζεται με ανθεκτικότητα, ενώ τα υπόλοιπα 156 άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία σε εντομοκτόνα. 4. Πρωτόκολλο: Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens Η ενίσχυση τμήματος του γονιδίου ACE1 για την ταυτόχρονη γονοτύπηση της θέσης F290V, η οποία σχετίζεται με ανθεκτικότητα σε εντομοκτόνα, πραγματοποιήθηκε σε 3 ξεχωριστές αντιδράσεις. Οι εκκινητές που χρησιμοποιήθηκαν για την κάθε αντίδραση είναι οι κάτωθι: Αντίδραση 1: ενίσχυση τμήματος 542 bp όπου περιέχεται η θέση F290V (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) Forward: GTCTGGCCGAGGCCGTCA Reverse: TGCTTCTGTGCGTGTACAGG 10

11 Αντίδραση 2: ενίσχυση τμήματος 148 bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ανθεκτικότητα Forward: GTCTGGCCGAGGCCGTCA Reverse: TCCACAACCGGAACGAACGGAAA Αντίδραση 3: ενίσχυση τμήματος 435 bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ευαισθησία Forward: ACGCTGGGGATCTGCGAGG Reverse: TGCTTCTGTGCGTGTACAGG Όλες οι αντιδράσεις πραγματοποιήθηκαν στις ίδιες συνθήκες PCR. Οι συνθήκες που χρησιμοποιήθηκαν είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 30, υβριδοποίησης των εκκινητών στους 56 ο C για 40 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην ακόλουθη εικόνα: Ανθεκτικότητα Ευαισθησία Το R συμβολίζει τα δείγματα που φέρουν το αλληλόμορφο που σχετίζεται με ανθεκτικότητα. Η αρίθμηση 1 3 αντιστοιχεί στην αρίθμηση των αντιδράσεων. Ελέγχθηκαν 180 δείγματα pipiens. Όλα τα άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. 11

12 5. Πρωτόκολλο: Ανίχνευση αλληλομόρφων του γονιδίου kdr του Culex pipiens pipiens με χρήση διαγνωστικού ελέγχου βασισμένου στην PCR με σκοπό την ανίχνευση ανθεκτικότητας ή μη. Πραγματοποιήθηκε ενίσχυση τμήματος του γονιδίου kdr που κωδικοποιεί για ένα τασοεξαρτώμενο κανάλι νατρίου σε 2 αντιδράσεις. Οι εκκινητές που χρησιμοποιήθηκαν για την κάθε αντίδραση είναι οι κάτωθι: Αντίδραση 1: ενίσχυση ενός τμήματος bp (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) κι ενός τμήματος bp, η οποία πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ευαισθησία. Forward 1: GTGGAACTTCACCGACTTC Forward 2: CCACCGTAGTGATAGGAAATTTA Reverse: GCAAGGCTAAGAAAAGGTTAAG Αντίδραση 2: ενίσχυση ενός τμήματος bp (χρησιμοποιείται ως εσωτερικός έλεγχος της αντίδρασης) κι ενός τμήματος bp, όπου πραγματοποιείται μόνο αν υπάρχει το αλληλόμορφο που σχετίζεται με ανθεκτικότητα. Forward 1: GTGGAACTTCACCGACTTC Forward 2: CCACCGTAGTGATAGGAAATTTT Reverse: GCAAGGCTAAGAAAAGGTTAAG Όλες οι αντιδράσεις πραγματοποιήθηκαν στις ίδιες συνθήκες PCR. Οι συνθήκες που χρησιμοποιήθηκαν είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 45 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Τα αποτελέσματα φαίνονται στην ακόλουθη εικόνα: 12

13 Το R συμβολίζει τα δείγματα που φέρουν το αλληλόμορφο που σχετίζεται με ανθεκτικότητα και το S αυτά που φέρουν το αλληλόμορφο που σχετίζεται με ευαισθησία. Η αρίθμηση 1 14 αντιστοιχεί στον αριθμό των δειγμάτων. Στο πάνω μέρος του πηκτώματος φαίνονται οι αντιδράσεις 1 και στο κάτω μέρος του πηκτώματος οι αντιδράσεις 2. Η κάθε στήλη αντιστοιχεί σε ένα δείγμα. Τα πρώτα 7 δείγματα είναι pipiens ενώ τα υπόλοιπα είναι molestus. Φαίνεται πως αυτή η τεχνική δεν εφαρμόζεται στα molestus. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. 6. Πρωτόκολλο: Ανίχνευση υβριδίων pipiens X molestus Η μέθοδος βασίζεται στην PCR με τη χρήση ενός forward και δύο reverse εκκινητών ειδικών για τις μορφές pipiens και molestus, οι οποίοι ενισχύουν την παρακείμενη περιοχή του μικροδορυφορικού τόπου CQ11. Ο διαχωρισμός βασίζεται στο μέγεθος 13

14 του προϊόντος της PCR: περίπου 200 bp για τη μορφή pipiens, 250 bp για τη μορφή molestus, και οι δύο ζώνες για τα υβρίδια pipiens/molestus. Πρότυπη εικόνα primers: pipcq11r, molcq11r, CQ11F2 για τα υβρίδια pipiensmolestus Πραγματοποιήθηκε ενίσχυση του μικροδορυφόρου CQ11 στα 120 άτομα pipiens με τη χρήση των κάτωθι εκκινητών: Forward: GATCCTAGCAAGCGAGAAC Reverse 1: CATGTTGAGCTTCGGTGAA Reverse 2: CCCTCCAGTAAGGTATCAAC Οι συνθήκες που πραγματοποιήθηκε η PCR είναι: Αρχική αποδιάταξη στους 95 ο C για 4, 35 κύκλοι αποδιάταξης στους 95 ο C για 40, υβριδοποίησης των εκκινητών στους 54 ο C για 45 και επέκτασης στους 72 ο C για 45 και τελική επέκταση στους 72 ο C για 10. Τα δείγματα ηλεκτροφορήθηκαν σε πήκτωμα αγαρόζης 1,5%. Ενδεικτικά, στην εικόνα φαίνονται 6 άτομα pipiens. 14

15 Από την ανάλυση δεν προέκυψε η ανίχνευση υβριδίων ανάμεσα στις δυο μορφές 15

16 Συμπεράσματα Συζήτηση Στα δείγματα που αναλύθηκαν ανιχνεύτηκαν 35% pipiens και 48% molestus Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens. Από τα 180 δείγματα pipiens που γονοτυπήθηκαν, τα 24 ήταν ετερόζυγα για το αλληλόμορφο που σχετίζεται με ανθεκτικότητα, ενώ τα υπόλοιπα 156 άτομα ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία σε εντομοκτόνα. Ανίχνευση της μετάλλαξης F290V του ace-1 στα Culex pipiens. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. Ανίχνευση αλληλομόρφων του γονιδίου kdr του Culex pipiens pipiens. Από τα 180 δείγματα pipiens που ελέγχθηκαν, 31 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ευαισθησία, 30 δείγματα ήταν ετερόζυγα και 119 ήταν ομόζυγα για το αλληλόμορφο που σχετίζεται με την ανθεκτικότητα. Ανίχνευση υβριδίων pipiens X molestus. Από την ανάλυση δεν προέκυψε η ανίχνευση υβριδίων ανάμεσα στις δυο μορφές 16

17 Βιβλιογραφία Diamond MS. West Nile Encephalitis Virus Infection: Viral Pathogenesis and the Host Immune Response. Springer, New York, NY Gomes B, Kioulos E, Papa A, Almeida APG, Vontas J, Pinto J. Distribution and hybridization of Culex pipiens forms in Greece during the West Nile virus outbreak of Infection, Genetics and Evolution 2013; 16: Hebert PDN, Stoeckle MY., Zemlak TS, Francis CM. Identification of birds through DNA barcodes. Public Library of Science, Biology 2004; 2: Kang D., Sim C. Identification of Culex complex species using SNP markers based on high-resolution melting analysis. Mol. Ecol. Resources 2013; 13: Kent RJ, Harrington LC, Norris DE. Genetic differences between Culex pipiens f. molestus and Culex pipiens pipiens (Diptera: Culicidae) in New York. Journal of Medical Entomology. 2007; 44, Marrelli MT, Floeter-Winter LM, Malafronte RS, Tadei WP, Lourenco-De-Oliveira R, Flores-Mendoza C, Marinotti O. Amazonian malaria vector anopheline relationships interpreted from ITS2 rdna sequences. Medical and Veterinary Entomology. 2005; 19: Savage HM, Aggarwal D, Apperson CS, Katholi CR, Gordon E, Hassan HK, Anderson M, Charnetzky D, McMillen L, Unnasch EA, Unnasch TR. Host choice and West Nile virus infection rates in blood-fed mosquitoes, including members of the Culex pipiens complex, from Memphis and Shelby County, Tennessee, Vector-Borne Zoonotic Dis. 2007; 7: Weill M, Fort P, Berthomieu A, Dubois MP, Pasteur N, Raymond M. A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is nonhomologous to the ace gene in Drosophila. Proc R Soc Lond. B. Biol. Sci. 2002; 269:

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία

Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΕΡΓΑΣΤΗΡΙΟ ΥΓΙΕΙΝΗΣ ΚΑΙ ΕΠΙΔΗΜΙΟΛΟΓΙΑΣ Πρόδρομα αποτελέσματα του ΕΣΠΑ για τον ιό του Δυτικού Νείλου και την ελονοσία Μάρκα Ανδριανή Ιατρός,

Διαβάστε περισσότερα

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1

Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ Θεωρία - Εφαρμογές ΓΕΝΕΤΙΚΗ ΒΕΛΤΙΩΣΗ ΦΥΤΩΝ - ΜΟΡΙΑΚΟΙ ΔΕΙΚΤΕΣ 1 ΕΙΣΑΓΩΓΗ ΣΤΟΥΣ ΜΟΡΙΑΚΟΥΣ Έπιλογή με βάση: ΔΕΙΚΤΕΣ Φαινοτυπικοί δείκτες Γενετικοί δείκτες Μοριακοί δείκτες (Πρωτεϊνικοί &

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.1 Έκθεση ερευνητικού έργου Υπεύθυνος φορέας: Πανεπιστήμιο Λάρισα,

Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Τετάρτη 4 Ιουνίου 2014 ΘΕΜΑ Α Α1.δ Α2.γ Α3.β Α4.γ Α5.β ΘΕΜΑ Β Β1. 4,2,1,6,3,5 Β2. α. DNA πολυμεράση β. πριμόσωμα γ.

Διαβάστε περισσότερα

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ

ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ ΛΥΣΗ ΤΗΣ ΑΣΚΗΣΗΣ ΕΠΑΝΑΛΗΨΗΣ 1. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης των κωδικονίων του mrna με αμινοξέα στην πολυπεπτιδική αλυσίδα. Σύμφωνα με αυτόν η 3 μετάφραση όλων των mrna αρχίζει

Διαβάστε περισσότερα

Εργαλεία Μοριακής Γενετικής

Εργαλεία Μοριακής Γενετικής Εργαλεία Μοριακής Γενετικής Αρχές Μοριακής κλωνοποίησης Τα περιοριστικά ένζυμα: αναγνωρίζουν αλληλουχίες (θέσεις περιορισμού). 2 τύποι ενζύμων: -Τύπος I = Κόβουν κοντά στη θέση περιορισμού -σπάνια χρησιμοποιούνται.

Διαβάστε περισσότερα

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση

ΘΕΜΑ Α. Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β 3-2 - 5-1 - 6-4. α-dna πολυμεράση β-πριμόσημα γ- DNA δεσμάση δ- DNA ελικάση ε- RNA πολυμεράση ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) Τετάρτη, 4 Ιουνίου 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1 δ Α2 γ Α3 β Α4 γ Α5 β ΘΕΜΑ Β

Διαβάστε περισσότερα

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης

Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης Τσορλίνη Χριστοφορίδου Ελένη Βακτηριολογικό Τμήμα Τμήμα Μυκοβακτηριδίου Γεν. Νοσοκομείο «Γ. Παπανικολάου» Θεσσαλονίκης ΕΙΣΑΓΩΓΗ Σύμφωνα με την ΠΟΥ το 1/3 περίπου του παγκόσμιου πληθυσμού είναι μολυσμένο

Διαβάστε περισσότερα

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β

ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5

Α2. Το αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του α. mrna β. snrna γ. trna δ. rrna Μονάδες 5 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ

ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ ΧΡΗΣΗ ΜΟΡΙΑΚΩΝ ΜΕΘΟΔΩΝ ΣΕ ΕΡΓΑΣΤΗΡΙΟ ΕΛΕΓΧΟΥ ΠΟΙΟΤΗΤΑΣ ΝΕΡΟΥ Μανδηλαρά Γεωργία Βιολόγος PhD, Επιστημονικός Συνεργάτης Εθνική Σχολή Δημόσιας Υγείας Τμήμα Μικροβιολογίας Υδατογενείς λοιμώξεις: χρήση νερού

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Γενετική της ιατήρησης επαπειλούμενων ειδών

Γενετική της ιατήρησης επαπειλούμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών

Διαβάστε περισσότερα

Κατα ολέµησηκουνου ιών

Κατα ολέµησηκουνου ιών Κατα ολέµησηκουνου ιών Κουνού ιακαιάνθρω ος: µια δύσκολη συµβίωση Α. Μιχαηλάκης Εργαστήριο Γεωργικής Εντοµολογίας, Τµήµα Εντοµολογίας και Γ. Ζωολογίας, Μπενάκειο Φυτοπαθολογικό Ινστιτούτο Βιολογικός κύκλος

Διαβάστε περισσότερα

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία

Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των. μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία Ο ρόλος και η σημασία των μοριακών τεχνικών στον έλεγχο των μικροβιολογικών παραμέτρων σε περιβαλλοντικά δείγματα για την προστασία της Δημόσιας Υγείας Α. Βανταράκης Εργαστήριο Υγιεινής, Ιατρική Σχολή,

Διαβάστε περισσότερα

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences

TreeTOPS. ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα. Teacher s Guide. ELLS European Learning Laboratory for the Life Sciences TreeTOPS ένα εισαγωγικό παιχνίδι για τα φυλογενετικά δέντρα Teacher s Guide ELLS European Learning Laboratory for the Life Sciences 1 Γενικός σκοπός Το συγκεκριμένο παιχνίδι έχει ως στόχο να εισάγει τους

Διαβάστε περισσότερα

Έκθεση πεπραγμένων φυσικού αντικειμένου

Έκθεση πεπραγμένων φυσικού αντικειμένου Ειδικό Πρόγραμμα Ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία Ενίσχυση της επιτήρησης στην ελληνική επικράτεια Αρ. Πρωτ.: 12 Ημερομηνία: 15/01/2013 Έκθεση πεπραγμένων φυσικού αντικειμένου 2 ου

Διαβάστε περισσότερα

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ

ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ ΑΙΜΟΠΑΘΟΛΟΓΟΑΝΑΤΟΜΙΑ Η συµβολή της µοριακής ανάλυσης Eλισάβετ Οικονοµάκη Βιολόγος Αιµοπαθολογοανατοµικό Εργαστήριο ΠΓΝΑ > ΜΟΡΙΑΚΕΣ ΜΕΘΟ ΟΙ (Μη µορφολογικές) Αλυσιδωτή Αντίδραση Πολυµεράσης

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β. Β1. 4-2-1-6-3-5 Β2. α) DNA πολυμεράσες β) πριμόσωμα γ) DNA δεσμάσεις δ) DNA ελικάσες ε) RNA πολυμεράσες Β3. σελ 98:

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Τετάρτη, 22 Μαΐου 2013 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως

Διαβάστε περισσότερα

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ

ÍÅÏ ÄÕÍÁÌÉÊÏ ÓÔÁÕÑÏÕÐÏËÇ 1 ΘΕΜΑ 1 o Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Α. Για τις ερωτήσεις 1 5 να γράψετε στο τετράδιό σας τον αριθµό της ερώτησης και δίπλα του το γράµµα, που αντιστοιχεί στη σωστή απάντηση. 1.

Διαβάστε περισσότερα

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ ΤΗΣ Γ' ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΟΙ ΛΥΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΑΠΟ ΤΟΝ ΚΑΘΗΓΗΤΗ κύριο ΤΡΙΓΚΑ ΓΕΩΡΓΙΟ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ του ΦΡΟΝΤΙΣΤΗΡΙΟΥ www.orion.edu.gr ΘΕΜΑ A A1. γ A2. β A3.

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr

Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ Αλέξης Ν. Πολύδωρος Αναπλ. Καθηγητής Μοριακής Βελτίωσης Εργαστήριο Γενετικής και Βελτίωσης Φυτών ΑΠΘ email: palexios@agro.auth.gr Παρουσιάσεις μαθήματος http://users.auth.gr/~palexios/

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ ÏÅÖÅ 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o 1 Β 2 3 Γ 4 5 Β. ΘΕΜΑ 2 o ΑΠΑΝΤΗΣΕΙΣ Α. Όπως στο σχολικό, σελίδα 20: «Κάθε φυσιολογικό µεταφασικό ως προς τη θέση του κεντροµεριδίου» και σελίδα «Κατά

Διαβάστε περισσότερα

Ασθένειες απότα. Κουνούπια στην Ελλάδα Ηκατάσταση. σήµερα. ρ. Γεώργιος Κολιόπουλος

Ασθένειες απότα. Κουνούπια στην Ελλάδα Ηκατάσταση. σήµερα. ρ. Γεώργιος Κολιόπουλος Ασθένειες απότα Κουνούπια στην Ελλάδα Ηκατάσταση σήµερα ρ. Γεώργιος Κολιόπουλος Εργαστήριο Εντοµοκτόνων Υγειονοµικής Σηµασίας Τµήµα Ελέγχου Γεωργικών Φαρµάκων & Φυτοφαρµακευτικής Μπενάκειο Φυτοπαθολογικό

Διαβάστε περισσότερα

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β.

ΕΞΕΤΑΣΕΙΣ. σύγχρονο. Θέμα Α. Α.1. δ. Α.2. γ. Α.3. β. Α.4. γ. Α.5. β. Θέμα Β. Θέμα Α. Α.1. δ Α.2. γ Α.3. β Α.4. γ Α.5. β Θέμα Β. TETAPTH 4 OYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: Β.1. 4 2 1-6 3-5 B.2. α.) ) DNA πολυμεράσες β.) ) πριμόσωμα γ.) ) DNA δεσμάση δ.) ) DNA ελικάσες ε.) ) RNA

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΕΜΠΤΗ 11 ΙΟΥΝΙΟΥ 2015 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25)

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση. (Μονάδες 25) ΤΣΙΜΙΣΚΗ &ΚΑΡΟΛΟΥ ΝΤΗΛ ΓΩΝΙΑ THΛ: 270727 222594 ΑΡΤΑΚΗΣ 12 - Κ. ΤΟΥΜΠΑ THΛ: 919113 949422 ΕΠΩΝΥΜΟ:... ΟΝΟΜΑ:... ΤΜΗΜΑ:... ΗΜΕΡΟΜΗΝΙΑ:... ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 16-2-2014 ΘΕΜΑ 1 ο Α. Να βάλετε σε

Διαβάστε περισσότερα

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Ο.Ε.Φ.Ε. 2004 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την ορθή πρόταση: ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1. Το κωδικόνιο του mrna που κωδικοποιεί το αµινοξύ µεθειονίνη είναι α. 5 GUA

Διαβάστε περισσότερα

Έκθεση πεπραγμένων φυσικού αντικειμένου

Έκθεση πεπραγμένων φυσικού αντικειμένου Ειδικό Πρόγραμμα Ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία Ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) Αρ. Πρωτ.: 114 Ημερομηνία: 24/7/2014 Έκθεση πεπραγμένων φυσικού αντικειμένου

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ γραπτή εξέταση στo μάθημα ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: ΠΑΣΣΙΑ Α. Θ Ε Μ Α A 1. Να επιλέξετε τη σωστή απάντηση: Α1. Κάθε μεταφορικό RNA

Διαβάστε περισσότερα

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο

Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο E M E D N L C SCIENCES BIOMEDICAL E N T E R Kέντρο Μέντελ για Βιοιατρικές Επιστήμες Συχνότητα Human Papilloma Virus (HPV) στη Κύπρο Βασίλειος Τάνος MD PhD www.mendelcenter.org Picture taken from leaflet

Διαβάστε περισσότερα

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ

Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικά Θέµατα ΟΕΦΕ 2005 1 ε π α ν α λ η π τ ι κ ά θ έ µ α τ α 2 0 0 5 Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο A: 1-Α, 2-, 3-Γ, 4-Β, 5-Β ΜΟΝΑ ΕΣ 15 (3Χ5) Β. 1. Σωστή, 2. Λανθασµένη,

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση.

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5) ΘΕΜΑ Α Να γράψετε στο τετράδιό

Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 22/5/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5)

ÈÅÌÁÔÁ 2008 ÏÅÖÅ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o. ΘΕΜΑ 2 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΜΟΝΑ ΕΣ 15 (3Χ5) 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1 o Α: 1-, 2-Β, 3-Α, 4-Β, 5-Α ΑΠΑΝΤΗΣΕΙΣ Β: 1- Λάθος, 2- Σωστή, 3- Λάθος, 4- Σωστή, 5- Λάθος ΘΕΜΑ 2 o ΜΟΝΑ ΕΣ 15 (3Χ5) ΜΟΝΑ ΕΣ 10 (2Χ5) 1. Καρυότυπος είναι

Διαβάστε περισσότερα

ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ Αρ. 29

ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ Αρ. 29 ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕΕΛΠΝΟ) Ενημερωτικό Δελτίο Κέντρο Ελέγχου και Πρόληψης Νοσημάτων Αγράφων 3-5, Μαρούσι, 15123, 210 5212000 Ιούλιος 2013 Αρ. 29/ Έτος 3ο ISSN 1792-9016 ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 Ο Α. Να βάλετε σε κύκλο το γράμμα που αντιστοιχεί στη σωστή απάντηση ή στη φράση που συμπληρώνει σωστά την πρόταση. 1. H β- θαλασσαιμία είναι

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. Β Α2. Γ Α3. Α Α4. Α5. Γ ΘΕΜΑ Β ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ 22 ΜΑΪΟΥ 2015 ΑΠΑΝΤΗΣΕΙΣ B1. Α (Σωµατικά κύτταρα στην αρχή της µεσόφασης): 1, 4, 5, 6 Β (Γαµέτες): 2, 3, 7, 8 Β2. (Κάθε

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.22 Έκθεση αποτελεσμάτων ανίχνευσης του ιού του Δυτικού Νείλου και

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή φράση, η οποία συμπληρώνει σωστά

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΙΑΓΩΝΙΣΜΑ Θέµα 1 ο 1. Τα άτοµα που είναι ετερόζυγα για τη β-θαλασσαιµία: α. Εµφανίζουν ήπια αναιµία β. Έχουν ευαισθησία στην ελονοσία γ. Συνθέτουν µεγάλη ποσότητα HbF δ.

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001

Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 Βιολογία Θετικής Κατεύθυνσης Γ' Λυκείου 2001 ΕΚΦΩΝΗΣΕΙΣ Ζήτηµα 1ο Α1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα τους είναι: α.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ

ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2005 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων

Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Βάσεις δεδομένων χαρτογράφησης γονιδιωμάτων Vasilis Promponas Bioinformatics Research Laboratory Department of Biological Sciences University of Cyprus http://en.wikipedia.org/wiki/image:cyprus_topo.png

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ

ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη

ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ. Eφη. Πετεινάκη ΟΙ ΜΟΡΙΑΚΕΣ ΤΕΧΝΙΚΕΣ ΣΤΗΝ ΙΑΤΡΙΚΗ ΜΙΚΡΟΒΙΟΛΟΓΙΑ Eφη Πετεινάκη ΠΡΟΒΛΗΜΑΤΑ ΡΟΥΤΙΝΑΣ ΕΝΟΣ ΚΛΙΝΙΚΟΥ ΜΙΚΡΟΒΙΟΛΟΓΙΚΟΥ ΕΡΓΑΣΤΗΡΙΟΥ ταυτοποίηση κάποιων βακτηρίων ο έλεγχος ευαισθησίας διάγνωση λοιμώξεων από μικροοργανισμούς

Διαβάστε περισσότερα

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280)

Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια (MIS 365280) «Ειδικό πρόγραμμα ελέγχου για τον ιό του Δυτικού Νείλου και την ελονοσία, ενίσχυση της επιτήρησης στην ελληνική επικράτεια» Παραδοτέο Π1.16 Αποτύπωση της χωρικής διασποράς των διαφορετικών ειδών κουνουπιών

Διαβάστε περισσότερα

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ

Εργαστηριακή Διάγνωση της HIV λοίμωξης. Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Εργαστηριακή Διάγνωση της HIV λοίμωξης Δρ. Μαρία Κοτσιανοπούλου Βιολόγος Υπεύθυνη Εργαστηριού Κέντρου Αναφοράς AIDS, ΕΣΔΥ Διάγνωση της HIV λοίμωξης Από το 1985 και μέχρι σήμερα η διαγνωστική διαδικασία

Διαβάστε περισσότερα

ΕΒΔΟΜΑΔΙΑΙΑ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ 24 Οκτ. 2011 ΛΟΙΜΩΞΗ ΑΠΟ ΤΟΝ ΙΟ ΤΟΥ ΔΥΤΙΚΟΥ ΝΕΙΛΟΥ ΣΤΗΝ ΕΛΛΑΔΑ

ΕΒΔΟΜΑΔΙΑΙΑ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ 24 Οκτ. 2011 ΛΟΙΜΩΞΗ ΑΠΟ ΤΟΝ ΙΟ ΤΟΥ ΔΥΤΙΚΟΥ ΝΕΙΛΟΥ ΣΤΗΝ ΕΛΛΑΔΑ ΚΕΝΤΡΟ ΕΛΕΓΧΟΥ & ΠΡΟΛΗΨΗΣ ΝΟΣΗΜΑΤΩΝ (ΚΕ.ΕΛ.Π.ΝΟ.) ΥΠΟΥΡΓΕΙΟ ΥΓΕΙΑΣ & ΚΟΙΝΩΝΙΚΗΣ ΑΛΛΗΛΕΓΓΥΗΣ ΕΒΔΟΜΑΔΙΑΙΑ ΕΚΘΕΣΗ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗΣ ΕΠΙΤΗΡΗΣΗΣ 24 Οκτ. 2011 ΛΟΙΜΩΞΗ ΑΠΟ ΤΟΝ ΙΟ ΤΟΥ ΔΥΤΙΚΟΥ ΝΕΙΛΟΥ ΣΤΗΝ ΕΛΛΑΔΑ

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2004 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη φράση

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ

ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου

ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ. Παύλος Αντωνίου ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΕΠΛ 450 ΥΠΟΛΟΓΙΣΤΙΚΗ ΒΙΟΛΟΓΙΑ Παύλος Αντωνίου Με μια ματιά: Εισαγωγή στη Βιολογία Ευθυγράμμιση Ακολουθιών Αναζήτηση ομοίων ακολουθιών από βάσεις δεδομενων Φυλογενετική πρόβλεψη Πρόβλεψη

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ Γ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της

Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της ΚΕΦ. 2 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ Ποιες είναι οι ομοιότητες και οι διαφορές μεταξύ της αντιγραφής και της μεταγραφής; Διαφορές Αντιγραφή Μεταγραφή 1. Διατηρείται και μεταβιβάζεται η 1. Μεταβιβάζεται η γενετική

Διαβάστε περισσότερα

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων

Βαθμός Ασφαλείας Πάτρα 18-11-2014 Αριθμ. Πρωτ. 54276. Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ (Τ.Ε.Ι.) ΔΥΤΙΚΗΣ ΕΛΛΑΔΑΣ Τμήμα Ερευνητικών Προγραμμάτων Μονάδα Διενέργειας Διαγωνισμών &Διαχείρισης Συμβάσεων Μεγ.

Διαβάστε περισσότερα

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ

Για το χρώµα σπέρµατος επικρατής είναι η ιδιότητα κίτρινο και η υπολειπόµενη το πράσινο. Συµβολίζουµε: Κ:Κίτρινο κ: Πράσινο Κ>κ Απαντήσεις Βιολογία Κατεύθυνσης 2011 ΘΕΜΑ Α Α1 α Α2 δ Α3 γ Α4 β Α5 β ΘΕΜΑ Β Β1 Σελ. 13 «Το 1928 γίνεται αυτό» Β2 Σελ 101 «βλάβες στους επιδιορθωτικά ένζυµα» (Χωρίς να απαιτείται θα θεωρηθεί σωστό να γίνει

Διαβάστε περισσότερα

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ

Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ Ασκήσεις 1 ου ΚΕΦΑΛΑΙΟΥ 1. Η ανάλυση δειγμάτων DNA από δύο βακτηριακές καλλιέργειες έδωσε τα εξής αποτελέσματα: στην πρώτη καλλιέργεια βρέθηκε ποσοστό αδενίνης (Α) 28% και στη δεύτερη καλλιέργεια βρέθηκε

Διαβάστε περισσότερα

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων

H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων H Χρήση του DNA και της τεχνολογίας DNA-Barcoding για την μελέτη της βιοποικιλότητας και τη διάκριση των ειδών και των τοπικών ποικιλιών οσπρίων Dr. Παναγιώτης Μαδέσης pmadesis@certh.gr Ι. Γανόπουλος,

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

ΜΟΡΙΑΚΗ ΕΞΕΛΙΞΗ. Η γονιδιακή πορεία της εξέλιξης

ΜΟΡΙΑΚΗ ΕΞΕΛΙΞΗ. Η γονιδιακή πορεία της εξέλιξης ΜΟΡΙΑΚΗ ΕΞΕΛΙΞΗ Η γονιδιακή πορεία της εξέλιξης ΜΟΡΙΑΚΗ ΕΞΕΛΙΞΗ Η μοριακή εξέλιξη περιλαμβάνει δύο μεγάλες περιοχές μελέτης: α) την εξέλιξη των μακρομορίων και β) την κατασκευή της εξελικτικής ιστορίας

Διαβάστε περισσότερα

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18

A5. Μονάδες 5 ΘΕΜΑ B B1. Μονάδες 8 B2. Μονάδες 6 B3. Μονάδες 6 B4. Μονάδες 5 ΘΕΜΑ Γ Γ1. Μονάδες 18 ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΕΙΣΑΓΩΓΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΤΟΥ ΕΞΩΤΕΡΙΚΟΥ ΚΑΙ ΤΕΚΝΩΝ ΕΛΛΗΝΩΝ ΥΠΑΛΛΗΛΩΝ ΣΤΟ ΕΞΩΤΕΡΙΚΟ ΤΕΤΑΡΤΗ 7 ΣΕΠΤΕΜΒΡΙΟΥ 2011 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ:

Διαβάστε περισσότερα

15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ

15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ 15 o Πανελλήνιο Συνέδριο Ιχθυολόγων ΠΡΑΚΤΙΚΑ Θεσσαλονίκη 10-13 Οκτωβρίου 2013 15 ο Πανελλήνιο Συνέδριο Ιχθυολόγων Θεσσαλονίκη 2013 Πρώτη έκδοση 2013 Τυπώθηκε στη Θεσσαλονίκη από τις Εκδόσεις Γιαχούδη ISBN

Διαβάστε περισσότερα

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014

ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2014 ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Παρασκευή 25 Απριλίου 2014 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

Μέρος 5 ο. Γονιδιακοί δείκτες

Μέρος 5 ο. Γονιδιακοί δείκτες Μέρος 5 ο Γονιδιακοί δείκτες R.C. Lewontin 1966 K.B. Mullis 1983 Εισαγωγή στη δασική γενετική Γονιδιακοί δείκτες Όπως είδαµε στα προηγούµενα κεφάλαια, η γενετική πληροφορία είναι οργανωµένη πάνω σε µια

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008

ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 2008 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη

Διαβάστε περισσότερα

Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla

Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Bla Η εικονική μικροσυστοιχία Μια ματιά στις επιστημονικές δημοσιεύσεις Τώρα που καταλαβαίνετε πώς δουλεύουν οι μικροσυστοιχίες (τουλάχιστον αυτό πιστεύουμε!), είναι ώρα να δούμε πως τις έχουν χρησιμοποιήσει

Διαβάστε περισσότερα

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ

ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΤΑΞΗ ΑΡΧΗ 1ΗΣ ΣΕΛΙ ΑΣ ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Σ ΕΣΠΕΡΙΝΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2003 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ: ΒΙΟΛΟΓΙΑ ΣΥΝΟΛΟ ΣΕΛΙ ΩΝ: ΤΕΣΣΕΡΙΣ (4) ΘΕΜΑ 1ο Στις ηµιτελείς προτάσεις

Διαβάστε περισσότερα

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr

Περικλέους Σταύρου 31 34100 Χαλκίδα Τ: 2221-300524 & 6937016375 F: 2221-300524 @: chalkida@diakrotima.gr W: www.diakrotima.gr Περικλέους Σταύρου 31 Προς: Μαθητές Α, Β & Γ Λυκείου / Κάθε ενδιαφερόμενο Αγαπητοί Φίλοι Όπως σίγουρα γνωρίζετε, από τον Ιούνιο του 2010 ένα νέο «ΔΙΑΚΡΟΤΗΜΑ» λειτουργεί και στη Χαλκίδα. Στο Φροντιστήριό

Διαβάστε περισσότερα

Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον

Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον 1 Μη επεμβατική προγεννητική διάγνωση (NIPD) : παρόν και μέλλον > JM COSTA Εργαστήριο Cerba Aθήνα 11 Φεβρουαρίου, 2012 2 Η NIPD προτείνεται στην κλινική πράξη ως διαδικασία ρουτίνας Ναι Όχι Η NIPD γίνεται

Διαβάστε περισσότερα

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ

ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ 1 ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 1 ΚΕΦΑΛΑΙΟ Το μόριο DNA μιας χρωματίδας μεταφασικού χωμοσώματος ενός φυσιολογικού ευκαρυωτικού κυττάρου περιέχει το 29% των νουκλεoτιδίων του με αζωτούχα βάση την T. a. Ποιο είναι

Διαβάστε περισσότερα

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008

ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008 ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ Δρ.Δ.Λάγγας Αθήνα 2008 Ορισμοί Γενετική: μελέτη της κληρονομικότητας και των παραλλαγών της Ιατρική γενετική: η γενετική του ανθρώπινου είδους Κλινική γενετική:

Διαβάστε περισσότερα

ΤΜΗΜΑ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΓΕΝΕΤΙΚΗΣ

ΤΜΗΜΑ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΓΕΝΕΤΙΚΗΣ ΤΜΗΜΑ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΓΕΝΕΤΙΚΗΣ Προς: Υπόψιν: Θέµα: Tο κοινωφελές ίδρυµα «John S. Latsis Public Benefit Foundation» κ. Ρ. Κιράνη Τελική έκθεση του έργου «Ανάπτυξη καινοτόµου φιλικής προς το περιβάλλον

Διαβάστε περισσότερα

Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν.

Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν. Μοριακή ταυτοποίηση επιλεγμένων κλώνων φυτών ρίγανης για την αντιμετώπιση παθογόνων ψαριών και ζωοπλαγκτόν. Μιχάλης Κ. Στεφανάκης, Γιώργος Τσικαλάς, Ελευθέριος Τουλουπάκης, Λαζανάκη Μαρία, Χαράλαμπος Ε.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΡΧΗ 1ΗΣ ΣΕΛΙΔΑΣ Γ ΤΑΞΗ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 25/04/2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΔΩΔΕΚΑ (12) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Να επιλέξετε τη φράση που

Διαβάστε περισσότερα

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη

TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015. Ορισμοί-Κατάταξη-Ιστολογία. Δ Ροντογιάννη TI NEOTEΡΟ ΣΤΟΥΣ ΝΕΥΡΟΕΝΔΟΚΡΙΝΕΙΣ ΟΓΚΟΥΣ ΤΟ 2015 Ορισμοί-Κατάταξη-Ιστολογία Δ Ροντογιάννη Νευροενδοκρινή νεοπλάσματα Ταξινόμηση Βιολογικοί δείκτες Μοριακή Παθολογία Νευροενδοκρινή νεοπλάσματα Ταξινόμηση

Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα.

Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. ΠΡΟΓΡΑΜΜΑ ΕΠΙΣΤΗΜΟΝΙΚΩΝ ΜΕΛΕΤΩΝ 2011 Η αναγέννηση µηδενίζει το ηλικιακό ρολόι; Εκτίµηση της κυτταρικής γήρανσης σε αναγεννηµένα όργανα. Μιχάλης Αβέρωφ (επιστ. υπεύθυνος) Ινστιτούτο Μοριακής Βιολογίας και

Διαβάστε περισσότερα

ΔΙΕΡΕΥΝΗΣΗ ΕΠΙΓΕΝΕΤΙΚΩΝ ΑΛΛΟΙΩΣΕΩΝ:ΈΝΑ ΚΥΝΗΓΙ ΘΗΣΑΥΡΟΥ

ΔΙΕΡΕΥΝΗΣΗ ΕΠΙΓΕΝΕΤΙΚΩΝ ΑΛΛΟΙΩΣΕΩΝ:ΈΝΑ ΚΥΝΗΓΙ ΘΗΣΑΥΡΟΥ ΔΙΕΡΕΥΝΗΣΗ ΕΠΙΓΕΝΕΤΙΚΩΝ ΑΛΛΟΙΩΣΕΩΝ:ΈΝΑ ΚΥΝΗΓΙ ΘΗΣΑΥΡΟΥ Σοφοκλέους Χριστάλενα, Μοριακή Βιολόγος Η επιγενετική αναφέρεται σε αλλαγές στην έκφραση των γονιδίων, σταθερές κατά τη διάρκεια της ζωής ενός οργανισμού,

Διαβάστε περισσότερα

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας

Βιοπληροφορική Ι. Παντελής Μπάγκος. Παν/µιο Στερεάς Ελλάδας Βιοπληροφορική Ι Παντελής Μπάγκος Παν/µιο Στερεάς Ελλάδας Λαµία 2006 1 Βιοπληροφορική Ι Εισαγωγή: Ορισµός της Βιοπληροφορικής, Υποδιαιρέσεις της Βιοπληροφορικής, Τα είδη των δεδοµένων στη Βιοπληροφορική.

Διαβάστε περισσότερα

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων

ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων ΤΕΙ Θεσσαλίας - Επαγγελμάτων Υγείας - Πρόνοιας (ΣΕΥΠ) Τμήμα Ιατρικών Eργαστηρίων Λάρισα 05/09/2013 Προκήρυξη Αριθμός Πρωτοκόλλου: 4292/3-7-2013 ΑΞΙΟΛΟΓΙΚΟΣ ΠΙΝΑΚΑΣ - Τομέας: Ενιαίος Μικροβιολογία (Εργαστήριο)

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο

ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

Μη επεμβατικός Προγεννητικός έλεγχος

Μη επεμβατικός Προγεννητικός έλεγχος Μη επεμβατικός Προγεννητικός έλεγχος Α. Κολιαλέξη, Βιοπαθολόγος PhD Εργαστήριο Ιατρικής Γενετικής Πανεπιστημίου Αθηνών Μη επεμβατικός ΠΕ από cffdna στο πλάσμα εγκύου Ελεύθερο Εμβρυϊκό DNA στη μητρική κυκλοφορία

Διαβάστε περισσότερα

ΠΟΙΚΙΛΟΜΟΡΦΙΑ ΣΤΑ ΓΟΝΙΔΙΑ

ΠΟΙΚΙΛΟΜΟΡΦΙΑ ΣΤΑ ΓΟΝΙΔΙΑ ΠΟΙΚΙΛΟΜΟΡΦΙΑ ΣΤΑ ΓΟΝΙΔΙΑ Κοντού Κ., Αυγερινάκη Π., Σουλτάτη Α., Ιακωβίδου Χ., Μαλέγγου Κ., Δανδίκα Μ., Αθανασιάδου Κ., Αράπη Έ., Τατάκη Σ., Μπαγκλαρίδου Λ., Μιχαηλίδου Γ., Χράντα Κ. Πρότυπο Πειραματικό

Διαβάστε περισσότερα

Προτεινόμενα θέματα 2014

Προτεινόμενα θέματα 2014 Προτεινόμενα θέματα 2014 Θέµα Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο)

ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ. ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) ΓΕΝΕΤΙΚΑ ΤΡΟΠΟΠΟΙΗΜΕΝΑ ΦΥΤΑ ΑΡΧΕΣ ΓΟΝΙ ΙΑΚΟΥ ΧΕΙΡΙΣΜΟΥ ΙΙ (ΜΑΘΗΜΑ 3ο) 1 ΦΟΡΕΙΣ πλασµίδια βακτηρίων βακτηριοφάγοι ιοί συνδυασµός πλασµιδίου βακτηριοφάγου (κοσµίδια) 2 ΦΟΡΕΙΣ Βακτηριοφάγοι Χαρακτηριστικά

Διαβάστε περισσότερα

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας

Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις. M. Ξημέρη, ειδικ. Αιματολογίας Ποικιλίες RhD - Σύγχρονη προσέγγιση κατά τις μεταγγίσεις M. Ξημέρη, ειδικ. Αιματολογίας Εισαγωγή Σύστημα RhD : - αναγνωρίστηκε το 1939 - το πιο σημαντικό κλινικά σύστημα μετά το ΑΒΟ - προκαλεί αιμολυτικές

Διαβάστε περισσότερα

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ

ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ ΟΡΟΛΟΓΙΑ 1 ΟΥ ΚΕΦΑΛΑΙΟΥ 1. In vitro 2. In vivo 3. Αναστολείς μίτωσης 4. Απλοειδές κύτταρο 5. Απλοειδής οργανισμός 6. Αριθμός ή αλληλουχία βάσεων 7. Αυτοσωμικά χρωμοσώματα 8. Βήμα έλικας 9. Γονιδίωμα κυττάρου

Διαβάστε περισσότερα

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του 1 Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του μαστού. Ο καρκίνος του μαστού είναι με μεγάλη διαφορά

Διαβάστε περισσότερα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα

Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Θέματα Γονιδιωματικής, Πρωτεομικής και Βιοτεχνολογίας Γονιδιώματα Το γονιδίωμα περιλαμβάνει τόσο τα γονίδια όσο και τις μη κωδικοποιούσες ακολουθίες DNA. Ο όρος προτάθηκε το 1920 από τον καθηγητή Hans

Διαβάστε περισσότερα

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο

Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας. ΝΕΕΣ Κοργιαλένειο Μπενάκειο Μαρία Τσοπανοµίχαλου PhD. Μοριακής Βιολογίας ΝΕΕΣ Κοργιαλένειο Μπενάκειο Καταφεύγουµε στις µοριακές τεχνικές Συλλέγουµε το δείγµα για µοριακές τεχνικές ιάσπαση ιστικών δοµών ιαχωρισµός των κυττάρων ιάσπαση

Διαβάστε περισσότερα