Eξετάσεις Mοριακής Bιολογίας. a2z medical soloutions

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Eξετάσεις Mοριακής Bιολογίας. a2z medical soloutions"


1 Eξετάσεις Mοριακής Bιολογίας a2z medical soloutions


3 ΜΟΡΙΑΚΕΣ ΚΑΙ ΓΕΝΕΤΙΚΕΣ ΑΝΑΛΥΣΕΙΣ ΜΟΡΙΑΚΗ ΟΓΚΟΛΟΓΙΑ BRAF - μετάλλαξη V600E K-Ras ΟΓΚΟΓΟΝΙΔΙΟ (V-KI-RAS2) γονίδιο K-Ras ΟΓΚΟΓΟΝΙΔΙΟ (κωδίκια 12,13) - 10 μεταλλάξεις PML-RAR AML-ETO Inversion 16 Ηer2/neu Bcr/abl - όλα τα break points Jak-2 - μετάλλαξη V617F ΜΟΡΙΑΚΗ ΓΕΝΕΤΙΚΗ ΕΛΛΕΙΨΗ α1-αντιθρυψινησ (PI) ΝΟΣΟΣ ALZHEIMER (ApoE) ΝΟΣΟΣ ALZHEIMER, ΟΙΚΟΓΕΝΗΣ (Psen1) ΝΟΣΟΣ ALZHEIMER, ΟΙΚΟΓΕΝΗΣ (Psen2) α-θαλασσαιμια -έλεγχος 21 μεταλλάξεων β-θαλασσαιμια - έλεγχος 23 μεταλλάξεων β-θαλασσαιμια - πλήρης ανάλυση γονίδιου ΕΛΛΕΙΨΗ 21 ΥΔΡΟΞΥΛΑΣΗΣ (CYP21A) ΚΥΣΤΙΚΗ ΙΝΩΣΗ (CFTR) - 29 μεταλλάξεις 3



6 CYP1B1 (Leu432Val) GSTP1 GSTM1 ΥΠΟΔΟΧΕΑΣ ΑΝΔΡΟΓΟΝΩΝ (AR) VDR (υποδοχέας βιταμίνης D) PGR (υποδοχέας προγεστερόνης) CYP17A1 ΠΑΡΑΓΟΝΤΑΣ II (μετάλλαξη προθρομβίνης) ΠΑΡΑΓΟΝΤΑΣ ΠΗΞΗΣ ΑΙΜΑΤΟΣ V (FV - LEIDEN) ΥΠΟΔΟΧΕΑΣ ΟΙΣΤΡΟΓΟΝΩΝ ESR1 (IVS1) ΑΡΩΜΑΤΑΣΗ - CYP19A1 (C1558T) CYP1A1 (Ile462Val) CYP1B1 (Asn453Ser) COMT (Ο-μεθυλο-τρανσφεράση των κατεχολαμινών) MTΗFR - μετάλλαξη C677T MTΗFR - μετάλλαξη Α1298C (ΜΕΤΑΛΛΑΞΗ ΓΟΝΙΔΙΟΥ THΣ ΟΜΟΚΥΣΤΕΪΝΑΙΜΙΑΣ) PAI-1 (αναστολέας-1 του ενεργοποιητή του πλασμινογόνου) ΓΟΝΙΔΙΟ ΚΛΗΡΟΝΟΜΙΚΟΥ ΚΑΡΚΙΝΟΥ ΠΡΟΣΤΑΤΗ 2 (ELAC2) ΚΑΡΔΙΑΓΓΕΙΑΚΑ ΝΟΣΗΜΑΤΑ ACE (μετατρεπτικό ένζυμο της αγγειοτενσίνης) APOA1 (απολιποπρωτεΐνη A) APO B (R3500Q) 6

7 APOC3 (απολιποπρωτεΐνη C3) AGT (γονίδιο αγγειοτενσίνης) CBS (β-συνθάση κυσταθειονίνης) CETP B1/B2 (πρωτεΐνη μεταφοράς εστέρων χοληστερόλης) ENOS NOS3 (VNTR) PON1 (παραοξονάση 1) SREBPF2 ΠΑΡΑΓΟΝΤΑΣ V (Y1702C) ΠΑΡΑΓΟΝΤΑΣ XIII (F13A1) GJA4 (κονεξίνη 37) ΗUMAN PLATELET ALLOANTIGENS (ΗPA) ΓΛΥΚΟΠΡΩΤΕΪΝΗ ΑΙΜΟΠΕΤΑΛΙΩΝ (GPIa) ΙΝΤΕΓΚΡΙΝΗ ΒΗΤΑ 3 (GPIIIa) ΟΙΚΟΓΕΝΗΣ ΥΠΕΡΛΙΠΟΠΡΩΤΕΪΝΑΙΜΙΑ ΤΥΠΟΥ III LPL MMP3 (στρωμελυσίνη1) MTR MTRR NOS3 NPY (νευροπεπτίδιο y) PROTEIN G BETA 3 ß-ΙΝΩΔΟΓΟΝΟ (FGB) 7

8 ΙΟΓΕΝΕΙΣ ΗΠΑΤΙΤΙΔΕΣ ΗBV (Ηepatitis B virus) - ποιοτική ανάλυση ΗBV (Ηepatitis B virus) - ποσοτική ανάλυση ΗBV (Ηepatitis B virus) ανίχνευση + ποσοτική ανάλυση ΗBV (Ηepatitis B virus) - αντοχή στη θεραπεία ΗCV-RT (Ηepatitis C virus) - ποιοτική ανάλυση ΗCV (Ηepatitis C virus) - ποσοτική ανάλυση ΗCV (Ηepatitis C virus) ανίχνευση + ποσοτική ανάλυση ΗCV γονότυπος ΗAV (Ηepatitis A virus) - ποιοτική ανάλυση ΗAV (Ηepatitis A virus) - ποσοτική ανάλυση ΗDV (Ηepatitis D virus) - ποιοτική ανάλυση ΗDV (Ηepatitis D virus) - ποσοτική ανάλυση ΗGV (Ηepatitis G virus) - ποιοτική ανάλυση ΗGV (Ηepatitis G virus) - ποσοτική ανάλυση ΕΡΠΗΤΟΪΟΙ CMV (Cytomegalovirus) - ποιοτική ανάλυση CE/IVD CMV (Cytomegalovirus) - ποσοτική ανάλυση CE/IVD EBV (Epstein-Barr virus) - ποιοτική ανάλυση ΗΗV 6 (Ηuman Ηerpesvirus type 6) - ποιοτική ανάλυση ΗΗV 6 (Ηuman Ηerpesvirus type 6) - ποσοτική ανάλυση 8

9 ΗΗV 7 (Ηuman Ηerpesvirus type 8) - ποιοτική ανάλυση ΗΗV 8 (Ηuman Ηerpesvirus type 8) - ποιοτική ανάλυση ΗΗV 8 (Ηuman Ηerpesvirus type 8) - ποσοτική ανάλυση ΗSV 1/2 (Ηerpes simplex virus types ½) - ανίχνευση ΗSV 1 (Ηerpes simplex virus type 1) - ποιοτική ανάλυση ΗSV 2 (Ηerpes simplex virus type 2) - ποιοτική ανάλυση VZV (Varicella Zoster virus) - ποιοτική ανάλυση VZV (Varicella Zoster virus) - ποσοτική ανάλυση ΙΟΣ ΛΟΙΜΩΔΟΥΣ ΜΟΝΟΠΥΡΗΝΩΣΗΣ (ΕΡΠΗΤΑΣ 4) ποσοτική ανάλυση ΠΑΡΒΟΪΟΣ Β19 - ποσοτική ανάλυση ΑΛΛΕΣ ΛΟΙΜΩΞΕΙΣ Candida albicans Chlamydia trahomatis Gardnerella vaginalis ΗPV PCR (Ηuman papilloma virus) - ποιοτική ανάλυση ΗPV PCR (Ηuman papilloma virus) - ποσοτική ανάλυση ΗPV (Ηuman papilloma virus) γονότυπος Trichomonas vaginalis Ureaplasma urealitycum ΙΟΣ ΓΡΙΠΠΗΣ Η1N1 - ποιοτική ανάλυση Bordetella pertussis - ποιοτική ανάλυση Chlamydia pneumoniae - ποιοτική ανάλυση 9

10 Ηelicobacter pylori Ηelicobacter pylori - αντοχή στη θεραπεία Neisseria gonorrhae (Ναϊσσέρια γονορροϊκή) ΙΟΣ ΕΡΥΘΡΑΣ (Rubella) ποιοτική ανάλυση Staphylococcus. saprophyticus (σταφυλόκοκκος σαπροφυτικός) Streptococcus agalactiae - streptococci beta - beta hemolyticus Toxoplasma gondii ΛΕΓΙΟΝΕΛΛΑ (Legionella pneymophila) - ανίχνευση Leishmania ΜΥΚΟΒΑΚΤΗΡΙΔΙΟ ΦΥΜΑΤΙΩΣΗΣ ανίχνευση CE/IVD ΑΤΥΠΑ ΜΥΚΟΒΑΚΤΗΡΙΔΙΑ - ανίχνευση Mycoplasma genitalium Mycoplasma hominis Mycoplasma pneumoniae ΤΑΥΤΟΧΡΟΝΗ ΑΝΙΧΝΕΥΣΗ ΜΥΚΟΠΛΑΣΜΑ ΧΛΑΜΥΔΙΑ OYΡΕΑΠΛΑΣΜΑ ΚΛΑΣΣΙΚΗ ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗ ΚΑΡΥΟΤΥΠΟΣ ΠΕΡΙΦΕΡΙΚΟΥ ΑΙΜΑΤΟΣ ΚΑΡΥΟΤΥΠΟΣ ΖΕΥΓΟΥΣ ΙΣΤΟΣΥΜΒΑΤΟΤΗΤΑ ΗLA ΚΟΙΛΙΟΚΑΚΗ ΗLA B27 10

11 ΜΟΡΙΑΚΗ ΤΥΠΟΠΟΙΗΣΗ ΗLA-A ΜΟΡΙΑΚΗ ΤΥΠΟΠΟΙΗΣΗ ΗLA-B ΜΟΡΙΑΚΗ ΤΥΠΟΠΟΙΗΣΗ ΗLA-C ΜΟΡΙΑΚΗ ΤΥΠΟΠΟΙΗΣΗ ΗLA-DR ΜΟΡΙΑΚΗ ΤΥΠΟΠΟΙΗΣΗ ΗLA-DQ ΜΟΡΙΑΚΗ ΤΥΠΟΠΟΙΗΣΗ ΗLA-DP ΠΑΚΕΤΑ ΜΟΡΙΑΚΩΝ ΚΑΙ ΓΕΝΕΤΙΚΩΝ ΑΝΑΛΥΣΕΩΝ ΠΑΚΕΤΟ ΘΡΟΜΒΟΦΙΛΙΑΣ-1: Παράγοντας V-Leiden, Παράγοντας V (Y1702C), Παράγοντας II (προθρομβίνη), MTΗFR (C677T, A1298C), ß-ινωδογόνο, PAI-1, Παράγοντας XIII, ΗPA-1, ACE, ApoE, ApoB, AGT (σύνολο 13 μεταλλάξεων) ΠΑΚΕΤΟ ΘΡΟΜΒΟΦΙΛΙΑΣ - 2: Παράγοντας V-Leiden, Παράγοντας II (προθρομβίνη), MTΗFR (C677T) ΠΑΚΕΤΟ ΘΡΟΜΒΟΦΙΛΙΑΣ - 3: Παράγοντας V-Leiden, Παράγοντας II (προθρομβίνη), MTΗFR (C677T, A1298C) ΠΑΚΕΤΟ ΘΡΟΜΒΟΦΙΛΙΑΣ - 4: Παράγοντας V-Leiden, Παράγοντας II (προθρομβίνη), Παράγοντας V (Y1702C) ΠΑΚΕΤΟ ΘΡΟΜΒΟΦΙΛΙΑΣ - 5: Παράγοντας V-Leiden, Παράγοντας V (Η1299R), Παράγοντας II (προθρομβίνη), MTΗFR (C677T, A1298C), ß-ινωδογόνο, PAI-1, Παράγοντας XIII, ΗPA-1, ACE, ApoE, ApoB ΠΑΚΕΤΟ ΘΡΟΜΒΟΦΙΛΙΑΣ -ΥΠΕΡΤΑΣΗΣ: Παράγοντας V-Leiden, Παράγοντας V (Y1702C), Παράγοντας II (προθρομβίνη), MTΗFR C677T, MTΗFR A1298C, AGT, ACE ΠΑΡΑΓΟΝΤΑΣ ΙΙ (προθρομβίνη), ΠΑΡΑΓΟΝΤΑΣ V-LEIDEN MTΗFR - μετάλλαξη C677T, μετάλλαξη A1298C ΠΑΚΕΤΟ ΕΞΕΤΑΣΕΩΝ ΑΝΔΡΙΚΗΣ ΥΠΟΓΟΝΙΜΟΤΗΤΑΣ (Κυστική ίνωση 33 μεταλλάξεις, poli5t, μικροελλείψεις χρωμοσώματος Υ) ΠΑΚΕΤΟ ΟΣΤΕΟΠΟΡΩΣΗΣ (COL1A1-VDR-ESR-1) 11

12 a2z medical soloutions Ποσειδώνος 47, 18344, Μοσχάτο Τ F



Διαβάστε περισσότερα

Λαμβάνετε Plavix ή Sintrom; cardiotest. Πρόληψη Καρδιαγγειακών Νοσημάτων. Ένα δείγμα σιέλου μπορεί να σώσει ζωές

Λαμβάνετε Plavix ή Sintrom; cardiotest. Πρόληψη Καρδιαγγειακών Νοσημάτων. Ένα δείγμα σιέλου μπορεί να σώσει ζωές Πρόληψη Καρδιαγγειακών Νοσημάτων Λαμβάνετε Plavix ή Sintrom; Το FDA προειδοποιεί: ελέγξτε άμεσα τη φαρμακογενετική σας ταυτότητα Ένα δείγμα σιέλου μπορεί να σώσει ζωές cardiotest Αθηρωμάτωση-Θρομβοεμβολισμός

Διαβάστε περισσότερα

Γενετικοί δείκτες χαμηλής οστικής πυκνότητας σε άτομα με κυστική ίνωση

Γενετικοί δείκτες χαμηλής οστικής πυκνότητας σε άτομα με κυστική ίνωση Γενετική Γενετικοί δείκτες χαμηλής οστικής πυκνότητας σε άτομα με κυστική ίνωση Δρ Aleksandra Norek Βοηθός Τμήμα Ιατρικής Γενετικής Ινστιτούτο Υγείας Μητέρας και Παιδιού Βαρσοβία, Πολωνία Το μέσο προσδόκιμο

Διαβάστε περισσότερα

Κατηγορία Εξετάσεων. Σελ.

Κατηγορία Εξετάσεων. Σελ. Κατηγορία Εξετάσεων Σελ. 1. ΤΜΗΜΑ ΜΟΡΙΑΚΗΣ ΠΑΘΟΛΟΓΙΑΣ/ΓΕΝΕΤΙΚΗΣ 1.1. Μοριακή Ανίχνευση Μολυσματικών Παραγόντων 1.2. Κληρονομικές Παθήσεις Γενετικοί Δείκτες 1.3. Ειδικά Πακέτα Μοριακών Εξετάσεων 1.4. Ειδικές

Διαβάστε περισσότερα

Parabensfree.gr. Πως κληρονομείται Αυτοσωμικό υπολειπόμενο

Parabensfree.gr. Πως κληρονομείται Αυτοσωμικό υπολειπόμενο Parabensfree.gr Τι είναι η κυστική ίνωση Η κυστική ίνωση είναι μια ασθένεια που οφείλεται σε μεταβολές μιας πρωτεΐνης που ρυθμίζει τη μεταφορά των αλάτων (ιόντων χλωρίου και νατρίου) στις μεμβράνες των

Διαβάστε περισσότερα

Ιατρικές εξετάσεις, Γενικές Οδηγίες και Προληπτικές Αναλύσεις Με βάση την Ηλικία

Ιατρικές εξετάσεις, Γενικές Οδηγίες και Προληπτικές Αναλύσεις Με βάση την Ηλικία Ιατρικές εξετάσεις, Γενικές Οδηγίες και Προληπτικές Αναλύσεις Με βάση την Ηλικία ΠΡΩΤΗ ΦΟΡΑ ΓΟΝΕΙΣ NEW PARENT AWARENESS Συζητάτε λεπτομερώς τα διάφορα προβλήματα που σας απασχολούν με τον παιδίατρό σας

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Τενέδου 2 152 35 Βριλήσσια, Αθήνα Τηλ.: (210) 682 8200 Fax: (210) 682 8202 E- mail: info@biogenomica.gr www.biogenomica.gr

Τενέδου 2 152 35 Βριλήσσια, Αθήνα Τηλ.: (210) 682 8200 Fax: (210) 682 8202 E- mail: info@biogenomica.gr www.biogenomica.gr Τιμοκατάλογος 2013 Τενέδου 2 152 35 Βριλήσσια, Αθήνα Τηλ.: (210) 682 8200 Fax: (210) 682 8202 E- mail: info@biogenomica.gr www.biogenomica.gr BioGenomica S.A. Υπηρεσίες Γενετικών Αναλύσεων - 1 - 1. Φαρμακογενετική

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά

Προγεννητικός Μοριακός Καρυότυπος. Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Προγεννητικός Μοριακός Καρυότυπος Η τεχνολογία αιχμής στη διάθεσή σας για πιο υγιή μωρά Η νέα εποχή στον Προγεννητικό Έλεγχο: Μοριακός Καρυότυπος - array CGH - Συγκριτικός γενωμικός υβριδισμός με μικροσυστοιχίες

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα

ιευθύντρια Μικροβιολογικού

ιευθύντρια Μικροβιολογικού Η συμβολή του Μικροβιολογικού Εργαστηρίου στη ιάγνωση και θεραπευτική αντιμετώπιση των λοιμώξεων ανοσοκατασταλμένων ασθενών Α θ η ν ά Α υ λ ά μ η ιευθύντρια Μικροβιολογικού Εργαστηρίου Γ.Ν.Α. Λαϊκό Τα

Διαβάστε περισσότερα

Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς

Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς ISBN (electr.) 978-9963-9849-0-9 ISBN (print.) 978-9963-9849-1-6 Όλα τα δικαιώματα είναι δεσμευμένα. Κανένα μέρος

Διαβάστε περισσότερα

μοριακή μικροβιολογία / ιολογία κυτταρογενετική - μοριακή κυτταρογενετική γενετικά νοσήματα - γενετικές αναλύσεις

μοριακή μικροβιολογία / ιολογία κυτταρογενετική - μοριακή κυτταρογενετική γενετικά νοσήματα - γενετικές αναλύσεις μοριακή μικροβιολογία / ιολογία κυτταρογενετική - μοριακή κυτταρογενετική γενετικά νοσήματα - γενετικές αναλύσεις νευρολογικά/νευρομυικά γενετικά νοσήματα παράγοντες προδιάθεσης θρομβοφιλίας και καρδειαγγειακών

Διαβάστε περισσότερα


KΕΝΤΡΟ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗΣ KΕΝΤΡΟ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ & ΚΥΤΤΑΡΟΓΕΝΕΤΙΚΗΣ η υπεροχή, η πρωτοπορία και η αξιοπιστία βρίσκονται στο DNA μας αντί εισαγωγής Η δημιουργία και η διεύθυνση ενός από τα κορυφαία Κέντρα Μοριακής Βιολογίας και

Διαβάστε περισσότερα

Biohe enika. προγεννητικός έλεγχος. Τμήμα Γενετικής και Μοριακής Διαγνωστικής ΕΤΑΙΡΕΙΑ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ

Biohe enika. προγεννητικός έλεγχος. Τμήμα Γενετικής και Μοριακής Διαγνωστικής ΕΤΑΙΡΕΙΑ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ Biohe enika ΕΤΑΙΡΕΙΑ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ προγεννητικός έλεγχος Τμήμα Γενετικής και Μοριακής Διαγνωστικής Η γέννηση ενός υγιούς παιδιού αποτελεί όνειρο και επιδίωξη κάθε νέου ζευγαριού. Η ιατρική σήμερα διαθέτει

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Ελπίδες και παγίδες στις ΓΕΝΕΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ

Ελπίδες και παγίδες στις ΓΕΝΕΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Ελπίδες και παγίδες στις ΓΕΝΕΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ ΙΩΑΝΝΑ ΣΟΥΦΛΕΡΗ Η γενετική επιστήμη και η ιατρική κοινότητα μας προσφέρουν αυτή τη στιγμή περί τις 9.000 διαφορετικές γενετικές εξετάσεις! Οπως αντιλαμβάνεσθε,

Διαβάστε περισσότερα

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας»

«β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Εργαστήριο Κυτταρογενετικής ΕΚΕΦΕ «Δημόκριτος» «β-μεσογειακή αναιμία: το πιο συχνό μονογονιδιακό νόσημα στη χώρα μας» Ζαχάκη Σοφία - Ουρανία Βιολόγος, MSc, PhD β μεσογειακή αναιμία Η θαλασσαιμία ή νόσος

Διαβάστε περισσότερα

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις

Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις Κληρονοµικά νοσήµατα και καταστάσεις που οφείλονται σε γονιδιακές µεταλλάξεις ΤΡΟΠΟΣ ΚΛΗΡΟΝΟΜΗΣΗΣ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΚΛΗΡΟΝΟΜΙΚΩΝ ΝΟΣΩΝ ΑΥΤΟΣΩΜΙΚΗ ΕΠΙΚΡΑΤΗΣ ΑΥΤΟΣΩΜΙΚΗ ΥΠΟΛΕΙΠΟΜΕΝΗ ΦΥΛΟΣΥΝ ΕΤΗ ΥΠΟΛΕΙΠΟΜΕΝΗ

Διαβάστε περισσότερα

Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς

Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς ISBN (electr.) 978-9963-9849-0-9 ISBN (print.) 978-9963-9849-1-6 Όλα τα δικαιώματα είναι δεσμευμένα. Κανένα μέρος

Διαβάστε περισσότερα

γονείς; neo screen Προγεννητικός Έλεγχος Σκέφτεστε να γίνετε Τα παιδιά αξίζουν μία ζωή γεμάτη υγεία, ελεύθερη από γενετικές ασθένειες Μοριακός

γονείς; neo screen Προγεννητικός Έλεγχος Σκέφτεστε να γίνετε Τα παιδιά αξίζουν μία ζωή γεμάτη υγεία, ελεύθερη από γενετικές ασθένειες Μοριακός Σκέφτεστε γονείς; να γίνετε Τα παιδιά αξίζουν μία ζωή γεμάτη υγεία, ελεύθερη από γενετικές ασθένειες Μοριακός Προγεννητικός Έλεγχος neo screen ΕΡΓΑΣΤΗΡΙΟ ΠΡΟΓΕΝΝΗΤΙΚΟΥ ΚΑΙ ΝΕΟΓΝΙΚΟΥ ΕΛΕΓΧΟΥ Κυστική Ίνωση

Διαβάστε περισσότερα

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές.

Α1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ. υποκινητές δ. 5 αμετάφραστες περιοχές. ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β ) ΠΑΡΑΣΚΕΥΗ 22 ΜΑΪΟΥ 2015 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας

Διαβάστε περισσότερα


ΤΡΙΓΛΥΚΕΡΙΔΙΑ ΓΛΥΚΟΖΥΛΙΩΜΕΝΗ ΑΙΜΟΣΦΑΙΡΙΝΗ ΜΙΚΡ/ALB ΤΥΧΑΙΑΣ ΟΥΡΗΣΗΣ. Μη- HDL-C ΚΡΕΑΤΙΝΙΝΗ υσλιπιδαιµία 90 υσλιπιδαιµια ιαβητικού 72 ΙΝΣΟΥΛΙΝΗ TSH Lp (a) FT4 Μη- HDL-C TGs/ HDL-C Δείκτης αντίστασης στη δράση της ινσουλίνης(homa-ir) Αξιολόγηση των αποτελεσμάτων του θυρεοειδούς και έλεγχος των

Διαβάστε περισσότερα

ΒΙΟΤΕΧΝΟΛΟΓΙΑ. Αριάδνη Μαύρου Καθηγήτρια Γενετικής Ιατρικής Σχολής Πανεπιστημίου Αθηνών

ΒΙΟΤΕΧΝΟΛΟΓΙΑ. Αριάδνη Μαύρου Καθηγήτρια Γενετικής Ιατρικής Σχολής Πανεπιστημίου Αθηνών ΒΙΟΤΕΧΝΟΛΟΓΙΑ Αριάδνη Μαύρου Καθηγήτρια Γενετικής Ιατρικής Σχολής Πανεπιστημίου Αθηνών Τι είναι η βιοτεχνολογία Βιοτεχνολογία = Βιολογία + Τεχνολογία Χρησιμοποίηση της Γενετικής για τροποποίηση ζωντανών

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Λίγα λόγια για τις αιματολογικές νεοπλασίες

Λίγα λόγια για τις αιματολογικές νεοπλασίες Λίγα λόγια για τις αιματολογικές νεοπλασίες Αιματολογικές νεοπλασίες είναι τα είδη καρκίνου που επηρεάζουν το αίμα, το μυελό των οστών και τους λεμφαδένες. Δεδομένου ότι και τα τρία είναι άρρηκτα συνδεδεμένα

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα

Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς

Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς ISBN (electr.) 978-9963-9849-0-9 ISBN (print.) 978-9963-9849-1-6 Όλα τα δικαιώματα είναι δεσμευμένα. Κανένα μέρος

Διαβάστε περισσότερα

Περιβαλλοντικά Καρκινογόνα Κυρίως τρεις τύποι: Χηµικά (µόλυνση, κάπνισµα, αµίαντος) Φυσικά (ιονίζουσα ακτινοβολία, µή- ιονίζουσα???) Βιολογικά (ιοί π.χ.. HPV) Καρκίνος παχέος εντέρου ΓΕΝΕΤΙΚΟΣ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑΤΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ

ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ Α Α1. β Α2. δ Α3. α Α4. α Α5. γ ΘΕΜΑ B B1. Η συχνότητα των ετερόζυγων ατόμων με δρεπανοκυτταρική αναιμία ή β- θαλασσαιμία είναι αυξημένη σε περιοχές όπως οι χώρες της Μεσογείου, της Δυτικής και Ανατολικής

Διαβάστε περισσότερα

Ιογενείς λοιμώξεις Μυκητιάσεις. Κωνσταντίνος Μακαρίτσης Επίκουρος Καθηγητής Παθολογίας Πανεπιστημίου Θεσσαλίας

Ιογενείς λοιμώξεις Μυκητιάσεις. Κωνσταντίνος Μακαρίτσης Επίκουρος Καθηγητής Παθολογίας Πανεπιστημίου Θεσσαλίας Ιογενείς λοιμώξεις Μυκητιάσεις Κωνσταντίνος Μακαρίτσης Επίκουρος Καθηγητής Παθολογίας Πανεπιστημίου Θεσσαλίας ΙΟΓΕΝΕΙΣ ΛΟΙΜΩΞΕΙΣ - ΙΟΙ ΙΟΓΕΝΕΙΣ ΛΟΙΜΩΞΕΙΣ - ΙΟΙ Οι ιοί έχουν ένα κεντρικό πυρήνα (core) από

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης Φροντιστήρια δυαδικό 1 ΦΡΟΝΤΙΣΤΗΡΙΑ δυαδικό Τα θέματα επεξεργάστηκαν οι καθηγητές των Φροντιστηρίων «δυαδικό» Μελλίδης Κ. Πασσιά Α. Θέμα Α Γενικές εξετάσεις 2015 Βιολογία Γ λυκείου Θετικής κατεύθυνσης

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα


12. ΚΑΘ ΕΞΙΝ ΑΠΟΒΟΛΕΣ 12. ΚΑΘ ΕΞΙΝ ΑΠΟΒΟΛΕΣ Καθ έξιν αποβολές ορίζονται ως η απώλεια τριών ή περισσοτέρων διαδοχικών κυήσεων. Καθ έξιν αποβολές είναι μια ετερογενής κατάσταση που έχει πολλά πιθανά αίτια, ενώ πολλοί παράγοντες

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης.

Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης. Εργαστηριακές Δοκιμασίες που πραγματοποιούνται στο Π.Ε.Δ.Υ Κρήτης. Είδος δείγματος Εξεταζόμενη παράμετρος Μέθοδος Πρότυπο Διαπιστευμένη Αρίθμηση μικροοργανισμών ενσωμάτωσης σε στερεό ΕΛΟΤ ΕΝ ISO 6222 καταμέτρηση

Διαβάστε περισσότερα


ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΙΑΤΡΙΚΗΣ Εργαστηριακή αξιολόγηση της αξιοπιστίας του strep testστη διάγνωση και τον καθορισμό της κατάλληλης αντιβιοτικής αγωγής σε ασθενείς με οξεία πυώδη αμυγδαλίτιδα

Διαβάστε περισσότερα

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013)

ToxPlus. Spin-off εταιρία του Εργαστηρίου Τοξικολογίας Πανεπιστημίου Κρήτης. Επιδοτούμενη από το ΕΣΠΑ (2007 2013) KENTΡΟ ΤΟΞΙΚΟΛΟΓΙΑΣ Α.Ε. Επιστημονικό και Τεχνολογικό Πάρκο Κρήτης Step C, N. Πλαστήρα 100, Βασιλικά Βουτών, Τ.Κ. 700 13 Ηράκλειο, Κρήτη www.toxplus.gr ToxPlus Spin-off εταιρία του Εργαστηρίου Τοξικολογίας

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 8 ΚΕΦΑΛΑΙΟ 8 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Σεξουαλικά µεταδιδόµενα νοσήµατα και AIDS στους εφήβους. Χαράλαµπος Ανταχόπουλος 3 η Παιδιατρική Κλινική ΑΠΘ

Σεξουαλικά µεταδιδόµενα νοσήµατα και AIDS στους εφήβους. Χαράλαµπος Ανταχόπουλος 3 η Παιδιατρική Κλινική ΑΠΘ Σεξουαλικά µεταδιδόµενα νοσήµατα και AIDS στους εφήβους Χαράλαµπος Ανταχόπουλος 3 η Παιδιατρική Κλινική ΑΠΘ Εφηβική ηλικία και σεξουαλικά µεταδιδόµενα νοσήµατα (STDs) Έναρξη σεξουαλικής ζωής Έλλειψη προφυλάξεων

Διαβάστε περισσότερα

Το γόνατο ως στόχος ρευματικών νοσημάτων

Το γόνατο ως στόχος ρευματικών νοσημάτων Το γόνατο ως στόχος ρευματικών νοσημάτων Χ. Μ. ΜουτσόπουΛος Αντεπιστέλλον μέλος της Ακαδημίας Αθηνών, Καθηγητής Ιατρικής Σχολής Πανεπιστημίου Αθηνών α ρευματικά νοσήματα είναι ασθένειες που προσβάλλουν

Διαβάστε περισσότερα

Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς

Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς Το παρόν έγγραφο είναι καταχωρημένο στην Κυπριακή Βιβλιοθήκη με τους διεθνείς αριθμούς ISBN (electr.) 978-9963-9849-0-9 ISBN (print.) 978-9963-9849-1-6 Όλα τα δικαιώματα είναι δεσμευμένα. Κανένα μέρος

Διαβάστε περισσότερα

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία

Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΣΥΓΧΡΟΝΕΣ ΜΕΘΟΔΟΛΟΓΙΕΣ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ - ΓΕΝΕΤΙΚΗΣ Σύγχρονες μεθοδολογίες μοριακής βιολογίας και γενετικής στη γυναικολογία ΠΑΠΑΝΙΚΟΛΑΟΥ ΕΛΕΝΗ, Ph.D. Λέκτορας Εργαστήριο Βιολογίας, Ιατρική Σχολή Αθηνών

Διαβάστε περισσότερα

Θρομβοπενίες και θρομβασθένειες. Α. Μούγιου Αιματολόγος ΠΓΝΠ 7-3-2014

Θρομβοπενίες και θρομβασθένειες. Α. Μούγιου Αιματολόγος ΠΓΝΠ 7-3-2014 Θρομβοπενίες και θρομβασθένειες Α. Μούγιου Αιματολόγος ΠΓΝΠ 7-3-2014 Αιμοπετάλια Φυσιολογικός αριθμός: 150-400.000/μL Ζουν περίπου 4 μέρες To μικρότερο (2-3 μ) απύρηνο κύτταρο του περιφερικού αίματος Παράγονται

Διαβάστε περισσότερα


ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ. Δρ.Δ.Λάγγας Αθήνα 2008 ΣΥΓΧΡΟΝΗ ΓΕΝΕΤΙΚΗ ΚΑΙ ΔΗΜΟΣΙΑ ΥΓΕΙΑ ΤΟΥ ΠΑΙΔΙΟΥ Δρ.Δ.Λάγγας Αθήνα 2008 Ορισμοί Γενετική: μελέτη της κληρονομικότητας και των παραλλαγών της Ιατρική γενετική: η γενετική του ανθρώπινου είδους Κλινική γενετική:

Διαβάστε περισσότερα


ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ ΚΕΦ. 6 ο ΕΡΩΤΗΣΕΙΣ ΚΡΙΣΕΩΣ 1. Μπορούν τα γονίδια που ελέγχουν τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης να χαρακτηριστούν ως πολλαπλά αλληλόμορφα; Τα γονίδια που ελέγχουν την α-αλυσίδα της αιμοσφαιρίνης

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα


ΔΙΑΓΝΩΣΤΙΚΑ ΚΕΝΤΡΑ - ΕΡΓΑΣΤΗΡΙΑ ΚΑΙ ΚΛΙΝΙΚΕΣ ΛΑΡΙΣΑΣ ΔΙΑΓΝΩΣΤΙΚΑ ΚΕΝΤΡΑ - ΕΡΓΑΣΤΗΡΙΑ ΚΑΙ ΚΛΙΝΙΚΕΣ ΛΑΡΙΣΑΣ Τιμές, που έχουμε συμφωνήσει με διαγνωστικά κέντρα υγείας και κλινικές Λάρισας και Θεσσαλίας, αποκλειστικά για τα μέλη του EXODOS CLUB κατόχους της

Διαβάστε περισσότερα

Υγεία και πρόληψη ΓΕΝΙΚΟ CHECK UP ΕΞΕΤΑΣΕΙΣ. Αυτό το πακέτο περιλαμβάνει όλες τις αναγκαίες γενικές εξετάσεις. Συνιστάται να γίνεται κάθε χρόνο.

Υγεία και πρόληψη ΓΕΝΙΚΟ CHECK UP ΕΞΕΤΑΣΕΙΣ. Αυτό το πακέτο περιλαμβάνει όλες τις αναγκαίες γενικές εξετάσεις. Συνιστάται να γίνεται κάθε χρόνο. ΓΕΝΙΚΟ CHECK UP 0030109006 Αυτό το πακέτο περιλαμβάνει όλες τις αναγκαίες γενικές εξετάσεις. Συνιστάται να γίνεται κάθε χρόνο. ΓΕΝΙΚΗ ΑΙΜΑΤΟΣ ESR ΓΕΝΙΚΗ ΟΥΡΩΝ ΣΑΚΧΑΡΟ ΟΥΡΙΑ ΚΡΕΑΤΙNIΝΗ ΟΥΡΙΚΟ ΟΞΥ ΧΟΛΗΣΤΕΡΙΝΗ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1 ο Α. Να γράψετε τον αριθμό της καθεμιάς από τις παρακάτω προτάσεις 1-5 και δίπλα του τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη.

Διαβάστε περισσότερα

Εισαγωγή στην Ανοσολογία

Εισαγωγή στην Ανοσολογία Εισαγωγή στην Ανοσολογία ρ. Γιώργος Κρασιάς Ινστιτούτο Νευρολογίας και Γενετικής Κύπρου Τµήµα Μοριακής Ιολογίας Τι είναι το Ανοσοποιητικό Σύστηµα (ΑΣ)? Το ΑΣ (Immune System) είναι ένα σύστηµα άµυνας του

Διαβάστε περισσότερα

Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα

Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα Στοιχεία Mοριακής ιαγνωστικής των Γενετικών Νόσων: Τέσσερα Παραδείγµατα Εύθραυστο Χ, Κυστική Ίνωση, Μυΐκη υστροφία Duchenne, Οικογενής Καρκίνος Μαστού-Ωοθηκών Λάµπρος Μαυρόγιαννης Οπως η Συµβατική Εργαστηριακή

Διαβάστε περισσότερα

Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση

Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση Λίγα λόγια για τους καρκίνους, τη γενετική τους βάση και διερεύνηση Ο καρκίνος είναι μια ιδιαίτερα ετερογενής νόσος, που προκύπτει από συσσώρευση μεταλλάξεων του DNA. Η αιτιολογία του καρκίνου είναι πολυπαραγοντική,

Διαβάστε περισσότερα

Εταιρική Ταυτότητα Οδηγός Εξετάσεων

Εταιρική Ταυτότητα Οδηγός Εξετάσεων Εταιρική Ταυτότητα Οδηγός Εξετάσεων 35 χρόνια στην υπηρεσία του ανθρώπου... 35 δυνατά σημεία... 1. 35 χρόνια εμπειρίας στη διαγνωστική γενετική (1976-2013) 2. Άρτια καταρτισμένο επιστημονικό προσωπικό

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΜΠΑΜΠΑΤΣΙΑΣ ΛΑΜΠΡΟΣ ΧΕΙΡΟΥΡΓΟΣ ΓΥΝΑΙΚΟΛΟΓΟΣ-ΜΑΙΕΥΤΗΡΑΣ ΚΑΘ` ΕΞΙΝ ΑΠΟΒΟΛΕΣ (πληροφορίες για το κοινό σύμφωνα με το Βρετανικό κολλέγιο μαιευτήρωνγυναικολόγων) για περισσότερες πληροφορίες η γυναίκα πρέπει να συμβουλεύεται το γυναικολόγο της. ΓΕΝΙΚΑ Αποβολή είναι

Διαβάστε περισσότερα

Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ

Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ Γρηγόριος Τιμόλογος M.Med.Sc. Γενικός Διευθυντής Κέντρο Μοριακής Βιολογίας και Γενετικής ΚΑΡΥΟ Φαρμακογενωμική Κλϊδοσ τησ γενετικόσ Προβλϋπει την ανταπόκριςη του αςθενό ςε φαρμακευτικϋσ αγωγϋσ μελετώντασ

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Ο ρόλος της ΕΘΟ. στην αναγέννηση. & την επανόρθωση

Ο ρόλος της ΕΘΟ. στην αναγέννηση. & την επανόρθωση Ο ρόλος της ΕΘΟ στην αναγέννηση & την επανόρθωση Νοvo E & Parola M. Fibrogenesis & Tissue Repair 2008, 1:5 Χρόνια παγκρεατίτιδα Ιστολογία παγκρεατικού καρκινώµατος Αδενοκαρκίνωµα εξ εκφορητικών

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία

Διαβάστε περισσότερα

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368)

ΕΞΕΤΑΣΤΕΑ ΥΛΗ Γενετική, σελ. 339 369 (εκτός ύλης: 16.7 Χιασματυπία ή διασκελισμός, σελ. 365-368) ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα

Λέξεις κλειδιά στη γενετική

Λέξεις κλειδιά στη γενετική ΓΕΝΕΤΙΚΗ: Από τον Gregor Mendel. στους Watson and Crick. Γενετική είναι ο κλάδος της βιολογίας που μελετά επιστημονικά τους κληρονομικούς χαρακτήρες. Χαρακτηριστικά που δεν κληρονομούνται αλλά αναπτύσσονται

Διαβάστε περισσότερα


ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης ΑΝΙΧΝΕΥΤΙΚΕΣ ΕΞΕΤΑΣΕΙΣ- ΠΡΟΓΕΝΝΗΤΙΚΟΣ ΕΛΕΓΧΟΣ Δρ. Ε.Τρακάκης Οι ανιχνευτικές εξετάσεις (screening test) έχουν ευρεία εφαρμογή και μεγάλη πρακτική χρησιμότητα στον προγεννητικό έλεγχο. Ο προγεννητικός έλεγχος

Διαβάστε περισσότερα


ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ Μεσογείων 6, Αμπελόκηποι 115 27 ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ [1]/[6] ΑΝΔΡΙΚΗ ΥΠΟΓΟΝΙΜΟΤΗΤΑ Εισαγωγή Περίπου το 15% των ζευγαριών δεν είναι σε θέση να συλλάβουν μετά από ένα χρόνο ελεύθερων σεξουαλικών επαφών.

Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 6 ΚΕΦΑΛΑΙΟ 6 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη

Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ. Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη Γυμνάσιο Κερατέας ΚΑΡΚΙΝΟΣ & ΜΕΤΑΛΛΑΞΕΙΣ Αναστασία Σουλαχάκη Κωνσταντίνα Πρίφτη 2013 ΠΕΡΙΕΧΟΜΕΝΑ : Ορολογία και λίγα λόγια για τον καρκίνο Χαρακτηριστικά του καρκίνου Μεταλλάξεις Μεταλλάξεις και καρκίνος

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα

Πρόληψη Κληρονομικών Νοσημάτων - Γενετική Συμβουλευτική

Πρόληψη Κληρονομικών Νοσημάτων - Γενετική Συμβουλευτική Πρόληψη Κληρονομικών Νοσημάτων - Γενετική Συμβουλευτική Εργαστήριο Υγιεινής Επιδημιολογίας και Ιατρικής Σε συνεργασία με το: Εργαστήριο Ιατρικής Γενετικής ΕΚΠΑ Επίπτωση Γενετικών Νοσημάτων 50% αποβολών

Διαβάστε περισσότερα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα

Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα Προεμφυτευτική γενετική διάγνωση (P.G.D) σε χρωμοσωμικές ανωμαλίες και κληρονομικά νοσήματα MAΡΙΑ ΠΑΠΑΛΟΥΚΑ Κλινική Εμβρυολόγος Μονάδα Αναπαραγωγικής Ιατρικής Περιεχόμενα Ορισμός Ιστορική Αναδρομή Γενετική

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦ. 6 ο ΜΕΤΑΛΛΑΞΕΙΣ Μεταλλάξεις είναι οι αλλαγές στην αλληλουχία των νουκλεοτιδίων που συμβαίνουν στο γενετικό υλικό ενός οργανισμού τόσο σε γονιδιακό επίπεδο (γονιδιακές μεταλλάξεις)

Διαβάστε περισσότερα

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του

Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του 1 Σύμφωνα με τον παγκόσμιο οργανισμό υγείας, κάθε χρόνο υπάρχουν 1.38 εκατομμύρια καινούρια περιστατικά και περίπου 458 000 θάνατοι από τον καρκίνο του μαστού. Ο καρκίνος του μαστού είναι με μεγάλη διαφορά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU)

Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU) Η φαινυλκετονουρία,γνωστή και ως PKU έχει αναγνωριστει για πρώτη φορά από τον γιατρό Asbjørn Følling στη Νορβηγία το 1934. Η φαινυλκετονουρία (PKU) μπορεί να ορισθεί ως μια σπάνια μεταβολική διαταραχή

Διαβάστε περισσότερα

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης.

Παραγωγή, απομόνωση και καθαρισμός της φαρμακευτικής πρωτεΐνης. ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΤΡΙΤΗ 1 ΙΟΥΝΙΟΥ 2004 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 1 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1o 1. δ 2. β 3. β 4. γ 5. δ ΘΕΜΑ 2o 1. Σχολικό βιβλίο, σελ.

Διαβάστε περισσότερα

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις:

Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ. Óõíåéñìüò ΕΚΦΩΝΗΣΕΙΣ. Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1 Γ' ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1 o ΒΙΟΛΟΓΙΑ ΕΚΦΩΝΗΣΕΙΣ Να επιλέξετε τη φράση που συµπληρώνει ορθά κάθε µία από τις ακόλουθες προτάσεις: 1. Το DNA ενός ανθρώπινου κυττάρου αποτελείται από 6 10 9

Διαβάστε περισσότερα

ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ. ΛΙΠΙΔΙΑ Τι είναι; - Λειτουργίες. Η. ΜΥΛΩΝΗΣ Κλινική Χημεια Λιπίδια-Λιποπρωτεϊνες - May 12, 2015 ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ

ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ. ΛΙΠΙΔΙΑ Τι είναι; - Λειτουργίες. Η. ΜΥΛΩΝΗΣ Κλινική Χημεια Λιπίδια-Λιποπρωτεϊνες - May 12, 2015 ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ ΛΙΠΙΔΙΑ - ΛΙΠΟΠΡΩΤΕΪΝΕΣ Είδη ιπιδίων Ιδιότητες Λιποπρωτείνες Ταξινόμηση Σύσταση σε ιπίδια και αποπρωτείνες Μεταβοισμός Επιθυμητές τιμές οριακές τιμές Δυσιπιδαιμίες - Υπεριποπρωτεϊναιμίες

Διαβάστε περισσότερα


ΟΜΟΣΠΟΝ ΙΑ ΕΚΠΑΙ ΕΥΤΙΚΩΝ ΦΡΟΝΤΙΣΤΩΝ ΕΛΛΑ ΟΣ (Ο.Ε.Φ.Ε.) ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ 2013 ÁÍÅËÉÎÇ ΤΑΞΗ: ΚΑΤΕΥΘΥΝΣΗ: ΜΑΘΗΜΑ: Γ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗ ΒΙΟΛΟΓΙΑ Ηµεροµηνία: Κυριακή 28 Απριλίου 2013 ιάρκεια Εξέτασης: 3 ώρες ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω

Διαβάστε περισσότερα

In vitro ανοσοδιάγνωση ασθενειών. Εργαστήριο Ανοσοπεπτιδικής Χηµείας ΕΚΕΦΕ «ηµόκριτος» ρ. Κουτραφούρη Βασιλική, ρ. Λιβανίου Ευαγγελία

In vitro ανοσοδιάγνωση ασθενειών. Εργαστήριο Ανοσοπεπτιδικής Χηµείας ΕΚΕΦΕ «ηµόκριτος» ρ. Κουτραφούρη Βασιλική, ρ. Λιβανίου Ευαγγελία In vitro ανοσοδιάγνωση ασθενειών Εργαστήριο Ανοσοπεπτιδικής Χηµείας ΕΚΕΦΕ «ηµόκριτος» ρ. Κουτραφούρη Βασιλική, ρ. Λιβανίου Ευαγγελία ιάγνωση ασθενειών 1. Κλινική Εξέταση 2. Γενικές και Ειδικές Εξετάσεις

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ. 1 ο ΔΙΑΓΩΝΙΣΜΑ ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 o ΘΕΜΑ 1 o Γ ΛΥΚΕΙΟΥ-ΘΕΤΙΚΗ ΚΑΤΕΥΘΥΝΣΗ 1 ο ΔΙΑΓΩΝΙΣΜΑ Α. Γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν σαν «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών»; Β. Σε ένα βακτήριο εισάγεται με τη μέθοδο του ανασυνδυασμένου

Διαβάστε περισσότερα

Δηλώσεις συμμετοχής: grammateia@gmail.com locus_medicus@yahoo.gr

Δηλώσεις συμμετοχής: grammateia@gmail.com locus_medicus@yahoo.gr Δηλώσεις συμμετοχής: grammateia@gmail.com locus_medicus@yahoo.gr ΠΕΜΠΤΗ 31 ΜΑΪΟΥ 2012 16:00-17:00 Διαδικασίες Ίδρυσης και Λειτουργίας Ιδιωτικών Εργαστηρίων Κώστας Τυροσβούτης, Βιολόγος, Ιδρυτής Εργαστηρίου

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ

Η Επιτροπή Παιδείας της ΠΕΒ. Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Αθήνα, 4/6/2014 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουμε τις προτεινόμενες απαντήσεις που αφορούν τα θέματα της Βιολογίας Θετικής Κατεύθυνσης των Ημερησίων Γενικών Λυκείων και ΕΠΑΛ (Ομάδα Β ).

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

Ανωμαλίες σε πρωτεΐνες-υποδοχείς

Ανωμαλίες σε πρωτεΐνες-υποδοχείς Ανωμαλίες σε πρωτεΐνες-υποδοχείς Αυτοσωματικό ημι-επικρατές (ετεροζυγώτες και ομοζυγώτες, γονιδιακή δόση) Συχνότητα 1:500 Οικογενής υπερχοληστερολαιμία Αυξημένη χοληστερόλη στο αίμα (LDL) Πρώιμη αθηροσκληρωτική

Διαβάστε περισσότερα


ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014. Ενδεικτικές απαντήσεις Θέµα Β ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΤΕΤΑΡΤΗ 4 ΙΟΥΝΙΟΥ 2014 Θέµα Α Α1. δ Α2. γ Α3. β A4. γ A5. β Ενδεικτικές απαντήσεις Θέµα Β Β1. Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυοτύπου

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιμέλεια: Ομάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Ομάδα Βιολόγων της Ώθησης 1 Παρασκευή, 22 Μα ου 2015 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α A1. Οι περιοχές του DNA που μεταφράζονται σε αμινοξέα ονομάζονται α. εσώνια β. εξώνια γ.

Διαβάστε περισσότερα