TEMA 6.- BIOMOLÉCULAS ORGÁNICAS IV: ÁCIDOS NUCLEICOS

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "TEMA 6.- BIOMOLÉCULAS ORGÁNICAS IV: ÁCIDOS NUCLEICOS"

Transcript

1 TEMA 6.- BIMLÉCULAS RGÁNICAS IV: ÁCIDS NUCLEICS A.- Características generales de los Ácidos Nucleicos B.- Nucleótidos y derivados nucleotídicos El esqueleto covalente de los ácidos nucleicos: el enlace fosfodiéster C.- Estructura y función del DNA Reconstrucción histórica del descubrimiento de la estructura del DNA El modelo de la doble hélice de Watson y Crick Estructura y funciones de los RNAs RNA mensajero RNA de transferencia RNA ribosómico tros tipos de RNA

2 La molécula de DNA de E. coli es centenares de veces más larga que la propia célula bacteriana Si lo ampliásemos un millón de veces tendría una anchura de 2 mm y una longitud de 1570 metros

3 Los monómeros de los Ácidos nucleicos se denominan genéricamente nucleótidos y están formados por Base nitrogenada Base púrica o pirimidínica Fosfato Una pentosa: ribosa, o dexosirribosa

4 La pentosa es la β D ribosa La numeración de los carbonos es la siguiente: D-Ribosa Forma lineal β D-Ribosa

5 Los nucleótidos del DNA tienen β D 2 desoxirribosa 1 2 H desoxi D-Ribosa Forma lineal 3 β D 2 Desoxirribosa 2 H

6 B.- Nucleótidos y derivados nucleotídicos Las bases nitrogenadas son de dos tipos Derivadas de la pirimidina, o bases pirimidínicas. Derivadas de la Purina, o bases púricas. Pirimidina Purina

7 Bases Púricas Adenina Guanina Bases nitrogenadas Bases Pirimidínicas Citosina Timina Sólo en ADN Uracilo Sólo en ARN

8 Las bases nitrogenadas se unen a la pentosa en el carbono 1 Las bases púricas lo hacen mediante el N 9 y las pirimidínicas el N 1 Pirimidina Purina El enlace se denomina N-Glucosídico

9 Extremo 5 P H Enlace fosfoéster H Enlace N-Glucosídico Extremo 3 H En el Carbono 5 se une el grupo fosfato El enlace es de tipo fosfoéster El Nucleótido representado es el ADENSIN 5 MNFSFAT: AMP Todos los nucleótidos tienen un extremo 5 fosfato y otro 3 hidroxilo

10 AMP Adenosín 5 monofosfato GMP Guanidín 5 monofosfato UMP Uridín 5 monofosfato CMP Citidín 5 monofosfato Nucleósido: Adenosina Nucleósido: Guanosina Nucleósido: Uridina Nucleósido: Citidina Estos 4 nucleótidos son los monómeros del ARN

11 damp Dexosiadenosín 5 monofosfato dgmp Dexosiguanidín 5 monofosfato dtmp Dexositimidín 5 monofosfato dcmp Dexosicitidín 5 monofosfato Nucleósido: dexosiadenosina Nucleósido: Dexosiguanosina Nucleósido: Dexositimidina Nucleósido: Dexosicitidina Estos 4 dexosinucleótidos son los monómeros del ADN

12 Además de ser los monómeros de los Ácidos nucleicos, los nucleótidos y sus derivados tienen otras funciones muy importantes en la célula Intermediaros energéticos: ATP y GTP ATP: Adenosín trifosfato

13 Coenzimas, como el Coenzima A, el NAD y el FAD Coenzima A, un transportador de grupos Acilo Relacionada con la vitamina B 3

14 Coenzimas, como el Coenzima A, el NAD y el FAD FAD: Flavín adenín dinucleótido Un coenzima de xidación-reducción Vitamina B 2 NAD: Nicotín adenín dinucleótido Un coenzima de xidación-reducción Vitamina B 5

15 Segundo mensajero intracelular: AMPc Adenina 3 5 Monofosfato cíclico de adenosina

16 Neuromodulador: Adenosina HCH 2

17 El esqueleto covalente de los ácidos nucleicos: el enlace fosfodiéster Extremo 5 P Extremo 3 H N NH Extremo 5 P - P Extremo 3 H - H H H N H H H N NH 2

18 El esqueleto covalente de los ácidos nucleicos: el enlace fosfodiéster NH Extremo 5 P H P Enlace fosfodiéster H 2 H H H H P Extremo 3 H N H N H H N H H H H H H N NH NH 2 DINUCLEÓTID

19 El esqueleto covalente de los ácidos nucleicos: el enlace fosfodiéster Enlace fosfodiéster Extremo 5 fosfato Extremo 3 H Esqueleto Fosfato-Ribosa

20 TEMA 6.- BIMLÉCULAS RGÁNICAS IV: ÁCIDS NUCLEICS: bases raras Inosina

TEMA 1: LA MATERIA DE LA VIDA

TEMA 1: LA MATERIA DE LA VIDA TEMA 1: LA MATERIA DE LA VIDA La vida y sus niveles de organización. Bioelementos y biomoléculas. Biomoléculas inorgánicas: agua y sales minerales. Biomoléculas orgánicas: glúcidos, lípidos, proteínas

Διαβάστε περισσότερα

TRIGONOMETRIA. hipotenusa L 2. hipotenusa

TRIGONOMETRIA. hipotenusa L 2. hipotenusa TRIGONOMETRIA. Calcular las razones trigonométricas de 0º, º y 60º. Para calcular las razones trigonométricas de º, nos ayudamos de un triángulo rectángulo isósceles como el de la figura. cateto opuesto

Διαβάστε περισσότερα

Lípidos. Clasificación

Lípidos. Clasificación Lípidos Son compuestos encontrados en organismos vivos, generalmente solubles en solventes orgánicos e insolubles en agua. Clasificación Propiedades físicas aceites grasas Estructura simples complejos

Διαβάστε περισσότερα

την..., επειδή... Se usa cuando se cree que el punto de vista del otro es válido, pero no se concuerda completamente

την..., επειδή... Se usa cuando se cree que el punto de vista del otro es válido, pero no se concuerda completamente - Concordar En términos generales, coincido con X por Se usa cuando se concuerda con el punto de vista de otro Uno tiende a concordar con X ya Se usa cuando se concuerda con el punto de vista de otro Comprendo

Διαβάστε περισσότερα

Académico Introducción

Académico Introducción - Σε αυτήν την εργασία/διατριβή θα αναλύσω/εξετάσω/διερευνήσω/αξιολογήσω... general para un ensayo/tesis Για να απαντήσουμε αυτή την ερώτηση, θα επικεντρωθούμε πρώτα... Para introducir un área específica

Διαβάστε περισσότερα

Bioquímica Estructural y Metabólica. TEMA 12. Ciclo de Krebs

Bioquímica Estructural y Metabólica. TEMA 12. Ciclo de Krebs TEMA 12. Ciclo del ácido cítrico (ciclo de los ácidos tricarboxílicos o de Krebs). Importancia del ciclo de Krebs como encrucijada metabólica. Formación del ace7l- coenzima- A: el complejo piruvato deshidrogenasa.

Διαβάστε περισσότερα

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ

ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΓΕΝΙΚΗΣ ΠΑΙΔΕΙΑΣ Β ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ ΜΕ ANIMATIONS ΚΑΙ ΣΧΕΔΙΑΓΡΑΜΜΑΤΑ Παν. Πάλλα - ΕΚΦΕ Ν. ΣΜΥΡΝΗΣ 1 ΜΙΑ ΕΙΚΟΝΑ ΧΙΛΙΕΣ ΛΕΞΕΙΣ Η παρουσίαση ακολουθεί τη σειρά των περιεχομένων του βιβλίου Βιολογίας

Διαβάστε περισσότερα

Filipenses 2:5-11. Filipenses

Filipenses 2:5-11. Filipenses Filipenses 2:5-11 Filipenses La ciudad de Filipos fue nombrada en honor de Felipe II de Macedonia, padre de Alejandro. Con una pequeña colonia judía aparentemente no tenía una sinagoga. El apóstol fundó

Διαβάστε περισσότερα

90 LIBERTAS SEGUNDA ÉPOCA. Introducción: La necesidad de una Reforma Institucional

90 LIBERTAS SEGUNDA ÉPOCA. Introducción: La necesidad de una Reforma Institucional 1 3 - - Abstract - - - 90 LIBERTAS SEGUNDA ÉPOCA Introducción: La necesidad de una Reforma Institucional - - - - - - - - - UNA PROPUESTA DE REFORMA MONETARIA PARA ARGENTINA 91 1 políticas establecidas

Διαβάστε περισσότερα

Inmigración Estudiar. Estudiar - Universidad. Indicar que quieres matricularte. Indicar que quieres matricularte en una asignatura.

Inmigración Estudiar. Estudiar - Universidad. Indicar que quieres matricularte. Indicar que quieres matricularte en una asignatura. - Universidad Me gustaría matricularme en la universidad. Indicar que quieres matricularte Me quiero matricular. Indicar que quieres matricularte en una asignatura en un grado en un posgrado en un doctorado

Διαβάστε περισσότερα

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΥΛΙΚΟ ΓΙΑ ΤΑ ΚΕΝΤΡΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ

ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΥΛΙΚΟ ΓΙΑ ΤΑ ΚΕΝΤΡΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΕΛΛΗΝΙΚΟ ΑΝΟΙΚΤΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΥΛΙΚΟ ΓΙΑ ΤΑ ΚΕΝΤΡΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΘΕΜΑΤΙΚΟΣ ΑΞΟΝΑΣ: ΓΛΩΣΣΑ ΚΑΙ ΕΠΙΚΟΙΝΩΝΙΑ ΘΕΜΑΤΙΚΗ ΕΝΟΤΗΤΑ: Ισπανικά για τον τουρισμό(α1-α2) Συγγραφέας: Δημήτρης Ε. Φιλιππής

Διαβάστε περισσότερα

La experiencia de la Mesa contra el Racismo

La experiencia de la Mesa contra el Racismo La experiencia de la Mesa contra el Racismo Informe Di icultad para identi icarse como discriminado Subsistencia de mecanismos individuales para enfrentar el racismo Las propuestas de las organizaciones

Διαβάστε περισσότερα

Tema de aoristo. Morfología y semántica

Tema de aoristo. Morfología y semántica Tema de aoristo Morfología y semántica El verbo politemático Cada verbo griego tiene 4 temas principales. La diferencia semántica entre ellos es el aspecto, no el tiempo. Semántica de los temas verbales

Διαβάστε περισσότερα

IV FESTIVAL LEA. Concurso entre escuelas de aprendizaje del español

IV FESTIVAL LEA. Concurso entre escuelas de aprendizaje del español IV FESTIVAL LEA El IV Festival Iberoamericano Literatura En Atenas, organizado por la revista Cultural Sol Latino, el Instituto Cervantes de Atenas y la Fundación María Tsakos, dura este año dos semanas:

Διαβάστε περισσότερα

FL/STEM Σχεδιασμός/Πρότυπο μαθήματος (χημεία) 2015/2016. Μάθημα (τίτλος) Οξυγόνο. Παραγωγή οξυγόνου Επίπεδο επάρκειας γλώσσας < Α1 Α2 Β1 Β2 C1

FL/STEM Σχεδιασμός/Πρότυπο μαθήματος (χημεία) 2015/2016. Μάθημα (τίτλος) Οξυγόνο. Παραγωγή οξυγόνου Επίπεδο επάρκειας γλώσσας < Α1 Α2 Β1 Β2 C1 Μάθημα (τίτλος) Οξυγόνο. Παραγωγή οξυγόνου Επίπεδο επάρκειας γλώσσας < Α1 Α2 Β1 Β2 C1 Τάξη/βαθμίδα: 6η Αριθμός μαθητών στην τάξη: 8 Περιεχόμενο μαθήματος: Οξυγόνο. Θέμα: Άνθρωπος και φύση Ουσίες Προϋποθέσεις

Διαβάστε περισσότερα

Academic Opening Opening - Introduction Greek Spanish En este ensayo/tesis analizaré/investigaré/evaluaré...

Academic Opening Opening - Introduction Greek Spanish En este ensayo/tesis analizaré/investigaré/evaluaré... - Introduction Σε αυτήν την εργασία/διατριβή θα αναλύσω/εξετάσω/διερευνήσω/αξιολογήσω... General opening for an essay/thesis En este ensayo/tesis analizaré/investigaré/evaluaré... Για να απαντήσουμε αυτή

Διαβάστε περισσότερα

ΑΡΧΗ 1 ης ΣΕΛΙΔΑΣ KΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΙΔΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΠΑΡΑΣΚΕΥΗ 24 ΙΟΥΝΙΟΥ 2005 ΚΟΙΝΗ ΕΞΕΤΑΣΗ ΟΛΩΝ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΑ ΙΣΠΑΝΙΚΑ

ΑΡΧΗ 1 ης ΣΕΛΙΔΑΣ KΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΙΔΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΠΑΡΑΣΚΕΥΗ 24 ΙΟΥΝΙΟΥ 2005 ΚΟΙΝΗ ΕΞΕΤΑΣΗ ΟΛΩΝ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΑ ΙΣΠΑΝΙΚΑ ΑΡΧΗ 1 ης ΣΕΛΙΔΑΣ KΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΙΔΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΠΑΡΑΣΚΕΥΗ 24 ΙΟΥΝΙΟΥ 2005 ΚΟΙΝΗ ΕΞΕΤΑΣΗ ΟΛΩΝ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΑ ΙΣΠΑΝΙΚΑ Α. Να αποδώσετε στο τετράδιό σας στην ελληνική γλώσσα το παρακάτω κείμενο,

Διαβάστε περισσότερα

Nro. 01 Septiembre de 2011

Nro. 01 Septiembre de 2011 SOL Cultura La Tolita, de 400 ac. a 600 dc. En su representación se sintetiza toda la mitología ancestral del Ecuador. Trabajado en oro laminado y repujado. Museo Nacional Banco Central del Ecuador Dirección

Διαβάστε περισσότερα

Το ίκτυο Βιβλιοθηκών του Τµήµατος Κοινωνικού Έργου της Caja Madrid. La Red de Bibliotecas de Obra Social Caja Madrid

Το ίκτυο Βιβλιοθηκών του Τµήµατος Κοινωνικού Έργου της Caja Madrid. La Red de Bibliotecas de Obra Social Caja Madrid Το ίκτυο Βιβλιοθηκών του Τµήµατος Κοινωνικού Έργου της Caja Madrid La Red de Bibliotecas de Obra Social Caja Madrid Το ίκτυο Βιβλιοθηκών αποτελεί τµήµα ενός Χρηµατοπιστωτικού Φορέα που προορίζει ποσοστό

Διαβάστε περισσότερα

Escenas de episodios anteriores

Escenas de episodios anteriores Clase 09/10/2013 Tomado y editado de los apuntes de Pedro Sánchez Terraf Escenas de episodios anteriores objetivo: estudiar formalmente el concepto de demostración matemática. caso de estudio: lenguaje

Διαβάστε περισσότερα

KYTTAPO. κυτταρική µεµβράνη (το διαχωρίζουν από το περιβάλλον & από τα άλλα κύτταρα)

KYTTAPO. κυτταρική µεµβράνη (το διαχωρίζουν από το περιβάλλον & από τα άλλα κύτταρα) KYTTAPO Tα κύτταρα έχουν κοινά χαρακτηριστικά - κυτταρική µεµβράνη (το διαχωρίζουν από το περιβάλλον & από τα άλλα κύτταρα) πρωτεϊνών διάλυµα ηλεκτρολυτών (κυτοσόλιο) υδατανθράκων σχήµα & ρευστότητα καθορίζονται

Διαβάστε περισσότερα

Black and White, an innovation in wooden flooring.

Black and White, an innovation in wooden flooring. a m s t e r d a m v i e n n a l o n d o n p a r i s m o s c o w d u b l i n m i l a n c o p e n h a g e n g e n e v a a t h e n s b a r c e l o n a r e y k j a v i c k i e v GB PT ES IT GR Black and White,

Διαβάστε περισσότερα

Στοιχεία Βιολογίας και Αρχές Βιοδιάβρωσης

Στοιχεία Βιολογίας και Αρχές Βιοδιάβρωσης Στοιχεία Βιολογίας και Αρχές Βιοδιάβρωσης ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ Ορισμός της Βιολογίας Ορισμός έμβιων-άβιων Χαρακτηριστικά γνωρίσµατα των ζωντανών οργανισµών - Διάκριση από τα συστήµατα που χαρακτηρίζονται από

Διαβάστε περισσότερα

Ταξίδι Γενικά. Γενικά - Τα απαραίτητα. Γενικά - Συνομιλία. Παράκληση για βοήθεια. Ερώτηση σε πρόσωπο αν μιλά αγγλικά

Ταξίδι Γενικά. Γενικά - Τα απαραίτητα. Γενικά - Συνομιλία. Παράκληση για βοήθεια. Ερώτηση σε πρόσωπο αν μιλά αγγλικά - Τα απαραίτητα Podría ayudarme? Παράκληση για βοήθεια Habla inglés? Ερώτηση σε πρόσωπο αν μιλά αγγλικά Habla_[idioma]_? Ερώτηση σε πρόσωπο αν μιλά ορισμένη γλώσσα No hablo_[idioma]_. Διασαφήνιση ότι δεν

Διαβάστε περισσότερα

Αντιδράσεις οξειδωτικού μέρους. Μη οξειδωτικές αντιδράσεις ΔΡΟΜΟΣ ΤΩΝ ΦΩΣΦΟΤΙΚΩΝ ΠΕΝΤΟΖΩΝ. 6-Ρ γλυκόζη. 5-Ρ ριβουλόζη

Αντιδράσεις οξειδωτικού μέρους. Μη οξειδωτικές αντιδράσεις ΔΡΟΜΟΣ ΤΩΝ ΦΩΣΦΟΤΙΚΩΝ ΠΕΝΤΟΖΩΝ. 6-Ρ γλυκόζη. 5-Ρ ριβουλόζη Αντιδράσεις οξειδωτικού μέρους 6-Ρ γλυκόζη 5-Ρ ριβουλόζη ΔΡΟΜΟΣ ΤΩΝ ΦΩΣΦΟΤΙΚΩΝ ΠΕΝΤΟΖΩΝ 5-Ρ ριβόζη (C 5 ) 5-Ρ ξυλουλόζη (C 5 ) GAP (C 3 ) 7-Ρ σεδοεπτουλόζη (C 7 ) 6-Ρ φρουκτόζη(c 6 ) 4-Ρ ερυθρόζη (C 5

Διαβάστε περισσότερα

M14/1/AYMGR/HP1/GRE/TZ0/XX

M14/1/AYMGR/HP1/GRE/TZ0/XX M14/1/AYMGR/HP1/GRE/TZ0/XX 22142045 MODERN GREEK A: LANGUAGE AND LITERATURE HIGHER LEVEL PAPER 1 GREC MODERNE A : LANGUE ET LITTÉRATURE NIVEAU SUPÉRIEUR ÉPREUVE 1 GRIEGO MODERNO A: LENGUA Y LITERATURA

Διαβάστε περισσότερα

FUNCIONES Y FÓRMULAS TRIGONOMÉTRICAS

FUNCIONES Y FÓRMULAS TRIGONOMÉTRICAS 5 FUNCIONES Y FÓRMULAS TRIGONOMÉTRICAS Página PARA EMPEZAR, REFLEXIONA Y RESUELVE. Aunque el método para resolver las siguientes preguntas se sistematiza en la página siguiente, puedes resolverlas ahora:

Διαβάστε περισσότερα

Για να ρωτήσετε αν κάποιος μπορεί να σας βοηθήσει να γεμίσετε μια φόρμα

Για να ρωτήσετε αν κάποιος μπορεί να σας βοηθήσει να γεμίσετε μια φόρμα - Γενικά Dónde tengo que pedir el formulario/impreso para? Για να ρωτήσετε που μπορείτε να βρείτε μια φόρμα Dónde tengo que pedir el formulario/impreso para? Cuál es la fecha de expedición de su (documento)?

Διαβάστε περισσότερα

Μεταβολισμός Βασικές Έννοιες

Μεταβολισμός Βασικές Έννοιες Μεταβολισμός Βασικές Έννοιες Αντικείμενο 1) το κύτταρο αντλεί ενέργεια (αναγωγική ισχύ) από το περιβάλλον του; 2) το κύτταρο συνθέτει τις δομικές μονάδες και τα μακρομόρια Περισσότερες από χίλιες αντιδράσεις

Διαβάστε περισσότερα

Tipologie installative - Installation types Type d installation - Installationstypen Tipos de instalación - Τυπολογίες εγκατάστασης

Tipologie installative - Installation types Type d installation - Installationstypen Tipos de instalación - Τυπολογίες εγκατάστασης AMPADE MOOCROMATICHE VIMAR DIMMERABII A 0 V~ - VIMAR 0 V~ DIMMABE MOOCHROME AMP AMPE MOOCHROME VIMAR VARIATEUR 0 V~ - DIMMERFÄHIGE MOOCHROMATICHE AMPE VO VIMAR MIT 0 V~ ÁMPARA MOOCROMÁTICA VIMAR REGUABE

Διαβάστε περισσότερα

Tipologie installative - Installation types Types d installation - Die einbauanweisungen Tipos de instalación - Τυπολογίες εγκατάστασης

Tipologie installative - Installation types Types d installation - Die einbauanweisungen Tipos de instalación - Τυπολογίες εγκατάστασης Types d installation Die einbauanweisungen Tipos de instalación Τυπολογίες εγκατάστασης AMPADE MOOCROMATICHE VIMAR DIMMERABII A 0 V~ MOOCHROME DIMMABE AMP VIMAR 0 V~ AMPE MOOCHROME VIMAR DIMMABE 0 V~ EUCHTE

Διαβάστε περισσότερα

ΠΡΟΣ: ΚΟΙΝ.: συγκρότηση Επιτροπής για την επιλογή ελευθέρων βοηθηµάτων Ισπανικής γλώσσας

ΠΡΟΣ: ΚΟΙΝ.: συγκρότηση Επιτροπής για την επιλογή ελευθέρων βοηθηµάτων Ισπανικής γλώσσας ΕΛΛΗΝΙΚΗ ΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙ ΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ, ΠΟΛΙΤΙΣΜΟΥ ΚΑΙ ΑΘΛΗΤΙΣΜΟΥ ----- ΕΝΙΑΙΟΣ ΙΟΙΚΗΤΙΚΟΣ ΤΟΜΕΑΣ Π/ΘΜΙΑΣ & /ΘΜΙΑΣ ΕΚΠΑΙ ΕΥΣΗΣ /ΝΣΗ ΣΠΟΥ ΩΝ /ΘΜΙΑΣ ΕΚΠ/ΣΗΣ ΤΜΗΜΑ Α Βαθµός Ασφαλείας: Να διατηρηθεί

Διαβάστε περισσότερα

DECLINACIÓN ATEMÁTICA (TERCERA DECLINACIÓN) Desinencias

DECLINACIÓN ATEMÁTICA (TERCERA DECLINACIÓN) Desinencias DECLINACIÓN ATEMÁTICA (TERCERA DECLINACIÓN) Desinencias M y F N M y F N N ς /alargamiento cero ες α V ς /alargamiento cero ες α A ν / α cero ας α G ος ων D ι σι (ν) Clasificación de los temas: - Temas

Διαβάστε περισσότερα

FORMULARIO DE ELASTICIDAD

FORMULARIO DE ELASTICIDAD U. D. Resistencia de Mateiales, Elasticidad Plasticidad Depatamento de Mecánica de Medios Continuos Teoía de Estuctuas E.T.S. Ingenieos de Caminos, Canales Puetos Univesidad Politécnica de Madid FORMULARIO

Διαβάστε περισσότερα

ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ Επιτροπή Γεωργίας και Ανάπτυξης της Υπαίθρου ΣΧΕ ΙΟ ΓΝΩΜΟ ΟΤΗΣΗΣ. της Επιτροπής Γεωργίας και Ανάπτυξης της Υπαίθρου

ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ Επιτροπή Γεωργίας και Ανάπτυξης της Υπαίθρου ΣΧΕ ΙΟ ΓΝΩΜΟ ΟΤΗΣΗΣ. της Επιτροπής Γεωργίας και Ανάπτυξης της Υπαίθρου ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ 2009-2014 Επιτροπή Γεωργίας και Ανάπτυξης της Υπαίθρου 21.10.2011 2011/0092(CNS) ΣΧΕ ΙΟ ΓΝΩΜΟ ΟΤΗΣΗΣ της Επιτροπής Γεωργίας και Ανάπτυξης της Υπαίθρου προς την Επιτροπή Οικονοµικής

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

Γλυκόζη. Ανασκόπηση μεταβολισμού υδατανθρακών ΗΠΑΡ. ΤΡΟΦΗ Γλυκόζη. Κυκλοφορία. Κυτταρόπλασμα ΓΛΥΚΟΓΟΝΟ. Οδός Φωσφ. Πεντοζών.

Γλυκόζη. Ανασκόπηση μεταβολισμού υδατανθρακών ΗΠΑΡ. ΤΡΟΦΗ Γλυκόζη. Κυκλοφορία. Κυτταρόπλασμα ΓΛΥΚΟΓΟΝΟ. Οδός Φωσφ. Πεντοζών. ΓΛΥΚΟΛΥΣΗ ΙΙ Ανασκόπηση μεταβολισμού υδατανθρακών ΗΠΑΡ ΤΡΟΦΗ Γλυκόζη Κυκλοφορία ΓΛΥΚΟΓΟΝΟ Γλυκόζη ΗΠΑΡ Κυτταρόπλασμα ΗΠΑΡ (Οξέωση) NADH ΟΞΕΙΔ. ΦΩΣΦ. ATP CO 2 Φρουκτόζη Γαλακτόζη 2ATP+2NADH Αναερόβια Γαλακτικό

Διαβάστε περισσότερα

ÁCIDOS CARBOXÍLICOS. Son ácidos orgánicos caracterizados por la presencia del grupo carboxilo. Hidrógeno ácido COOH COOH. carbonilo.

ÁCIDOS CARBOXÍLICOS. Son ácidos orgánicos caracterizados por la presencia del grupo carboxilo. Hidrógeno ácido COOH COOH. carbonilo. ÁIDS ABXÍLIS Son ácidos orgánicos caracterizados por la presencia del grupo carboxilo Ar carbonilo hidroxilo grupo carboxilo idrógeno ácido NMENLATUA DE LS ÁIDS ABXÍLIS (I) 1. Ácidos carboxílicos alifáticos

Διαβάστε περισσότερα

Métodos Estadísticos en la Ingeniería

Métodos Estadísticos en la Ingeniería Métodos Estadísticos e la Igeiería INTERVALOS DE CONFIANZA Itervalo de cofiaza para la media µ de ua distribució ormal co variaza coocida: X ± z α/ µ = X = X i N µ X... X m.a.s. de X Nµ Itervalo de cofiaza

Διαβάστε περισσότερα

Taller de cultura TALLER DE LITERATURA

Taller de cultura TALLER DE LITERATURA Taller de cultura TALLER DE LITERATURA Literatura Argentina del s. XX Lo fantástico como elemento inherente a la literatura argentina del s. XX Qué es la literatura fantástica argentina? «Ya Buenos Aires,

Διαβάστε περισσότερα

ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ

ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ 1999 2004 Επιτροπή Περιβάλλοντος, ηµόσιας Υγείας και Πολιτικής των Καταναλωτών 22 Ιουλίου 2002 PE 319.337/12-16 ΤΡΟΠΟΛΟΓΙΕΣ 12-16 Σχέδιο σύστασης για τη δεύτερη ανάγνωση (PE 319.337)

Διαβάστε περισσότερα

1ª y 2ª DECLINACIONES. PRESENTE INDICATIVO ACTIVO. CASOS. ORACIONES SIMPLES Y COMPUESTAS COORDINADAS.

1ª y 2ª DECLINACIONES. PRESENTE INDICATIVO ACTIVO. CASOS. ORACIONES SIMPLES Y COMPUESTAS COORDINADAS. TEMA 3: 1ª y 2ª DECLINACIONES. PRESENTE INDICATIVO ACTIVO. CASOS. ORACIONES SIMPLES Y COMPUESTAS COORDINADAS. a) Morfología nominal: 1ª (femeninos) y 2ª declinaciones (masculinos). b) Morfología verbal:

Διαβάστε περισσότερα

KIT DE DRENAJE DE CONDENSADOS

KIT DE DRENAJE DE CONDENSADOS KIT DE DRENAJE DE CONDENSADOS Estas instrucciones forman parte integrante del manual que acompaña el aparato en el cual está instalado este Kit. Este manual se refiere a ADVERTENCIAS GENERALES y REGLAS

Διαβάστε περισσότερα

ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΙΣΠΑΝΙΚΗ ΓΛΩΣΣΑ

ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΙΣΠΑΝΙΚΗ ΓΛΩΣΣΑ ΑΡΧΗ ΣΕΛΙ ΑΣ 1 ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ, ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΚΕΝΤΡΙΚΗ ΕΠΙΤΡΟΠΗ ΕΞΕΤΑΣΕΩΝ ΕΙΔΙΚΩΝ ΜΑΘΗΜΑΤΩΝ ΕΛΛΗΝΩΝ ΕΞΩΤΕΡΙΚΟΥ ΕΞΕΤΑΣΗ ΤΩΝ ΥΠΟΨΗΦΙΩΝ ΣΤΗΝ ΙΣΠΑΝΙΚΗ ΓΛΩΣΣΑ Πέμπτη, 15 Σεπτεμβρίου 2011

Διαβάστε περισσότερα

Εμπορική αλληλογραφία Επιστολή

Εμπορική αλληλογραφία Επιστολή - Διεύθυνση Sr. J. Rhodes Rhodes & Rhodes Corp. 212 Silverback Drive California Springs CA 92926 Sr. J. Rhodes Rhodes & Rhodes Corp. 212 Silverback Drive California Springs CA 92926 Αμερικανική γραφή διεύθυνσης:

Διαβάστε περισσότερα

ΠΑΓΚΟΣΜΙΑ ΗΜΕΡΑ ΑΣΟΠΟΝΙΑΣ. ασοπονία και αγορά προϊόντων ξύλου

ΠΑΓΚΟΣΜΙΑ ΗΜΕΡΑ ΑΣΟΠΟΝΙΑΣ. ασοπονία και αγορά προϊόντων ξύλου LOGO ΕΡΓΑΣΤΗΡΙΟ ΕΦΑΡΜΟΣΜΕΝΟΥ ΜΑΡΚΕΤΙΝΓΚ ΙΟΙΚΗΣΗΣ & ΟΙΚΟΝΟΜΙΑΣ ΠΑΓΚΟΣΜΙΑ ΗΜΕΡΑ ΑΣΟΠΟΝΙΑΣ ασοπονία και αγορά προϊόντων ξύλου ρ. ΠΑΠΑ ΟΠΟΥΛΟΣ ΙΩΑΝΝΗΣ Αναπληρωτής Καθηγητής ΤΕΙ Λάρισας E-mail: papad@teilar.gr

Διαβάστε περισσότερα

ΕΙΣΑΓΩΓΗ INTRODUCCIÓN

ΕΙΣΑΓΩΓΗ INTRODUCCIÓN ΕΝΗΜΕΡΩΣΗ ΚΑΙ ΔΙΑΒΟΥΛΕΥΣΗ ΣΤΑ ΕΥΡΩΠΑΙΚΑ ΣΥΜΒΟΥΛΙΑ ΕΡΓΑΖΟΜΕΝΩΝ (ΕΣΕ) KAI Η ΚΟΙΝΟΤΙΚΗ ΟΔΗΓΙΑ 2009/38 INFORMACIÓN Y CONSULTA EN LOS COMITÉS DE EMPRESA EUROPEOS (CEE) Y LA DIRECTIVA COMUNITARIA 2009/38 Αθανάσιος

Διαβάστε περισσότερα

LESET Let ssaveenergytogether (Ας Εξοικονομήσουμε Μαζί Ενέργεια) (GR)

LESET Let ssaveenergytogether (Ας Εξοικονομήσουμε Μαζί Ενέργεια) (GR) LESET Let ssaveenergytogether (Ας Εξοικονομήσουμε Μαζί Ενέργεια) (GR) Información general Resumen Το LESET έργο ήταν πολύ επιτυχημένο. Οι συμμετέχοντες, μαθητές μεταξύ 15 και 16 ετών, από 5 διαφορετικές

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ. + HCO 3 c c c (1) - +

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ. + HCO 3 c c c (1) - + ΕΠΑΝΑΛΗΠΤΙΕΣ ΠΑΝΕΛΛΑΔΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΟΥ ΛΥΕΙΟΥ ΤΕΤΑΡΤΗ 1 ΙΟΥΝΙΟΥ 01 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΒΙΟΧΗΜΕΙΑ ΤΕΧΝΟΛΟΓΙΗΣ ΑΤΕΥΘΥΝΣΗΣ (ΥΛΟΣ ΤΕΧΝΟΛΟΓΙΑΣ ΑΙ ΠΑΡΑΓΩΓΗΣ) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΘΕΜΑ

Διαβάστε περισσότερα

ΚΑΙΝΟΤΟΜΙΑ ΚΑΙ ΑΠΛΟΤΗΤΑ. Innovación y simplicidad

ΚΑΙΝΟΤΟΜΙΑ ΚΑΙ ΑΠΛΟΤΗΤΑ. Innovación y simplicidad pro ima pro ima Innovación y simplicidad PROXIMA es la última innovación de Serrature Meroni, un producto diseñado tanto para aquellos que ya disponen de un pomo PremiApri Meroni en su puerta, como para

Διαβάστε περισσότερα

%!$ ' ( ' () * + + * + * + . / -

%!$ ' ( ' () * + + * + * + . / - !"#$ %!$ & ' ' ) * + + * + * +,. -!" ) * + + * + * - ' - +, -,* - ' - + = * 0 ' & + #' $ θ θ% &'!θ #! θ + θ&θ!" ) *'+,1* θ +' * θ+ ' ' = 1 - ' - ') * - ' - +, - * - + * θ + ' - + * θ + + * - ' - + ' 3.!

Διαβάστε περισσότερα

bab.la Φράσεις: Προσωπική Αλληλογραφία Ευχές ελληνικά-ισπανικά

bab.la Φράσεις: Προσωπική Αλληλογραφία Ευχές ελληνικά-ισπανικά Ευχές : Γάμος Συγχαρητήρια. Σας ευχόμαστε όλη την ευτυχία του κόσμου. Felicitaciones. Les deseamos a ambos toda la felicidad del mundo. νιόπαντρο ζευγάρι Θερμά συγχαρητήρια για τους δυο σας αυτήν την ημέρα

Διαβάστε περισσότερα

Η ΓΕΩΡΓΙΑ ΤΩΝ ΚΑΝΑΡΙΩΝ ΝΗΣΙΩΝ

Η ΓΕΩΡΓΙΑ ΤΩΝ ΚΑΝΑΡΙΩΝ ΝΗΣΙΩΝ ΓΕΝΙΚΗ ΔΙΕΥΘΥΝΣΗ ΕΣΩΤΕΡΙΚΩΝ ΠΟΛΙΤΙΚΩΝ ΤΗΣ ΕΝΩΣΗΣ ΘΕΜΑΤΙΚΟ ΤΜΗΜΑ Β: ΔΙΑΡΘΡΩΤΙΚΕΣ ΠΟΛΙΤΙΚΕΣ ΚΑΙ ΣΥΝΟΧΗ ΓΕΩΡΓΙΑ ΚΑΙ ΑΝΑΠΤΥΞΗ ΤΗΣ ΥΠΑΙΘΡΟΥ Η ΓΕΩΡΓΙΑ ΤΩΝ ΚΑΝΑΡΙΩΝ ΝΗΣΙΩΝ ΥΠΟΜΝΗΜΑ Το παρόν έγγραφο εκπονήθηκε

Διαβάστε περισσότερα

ACTIVIDADES INICIALES

ACTIVIDADES INICIALES Solucionario Trigonometría ACTIVIDADES INICIALES.I. En una recta r hay tres puntos: A, B y C, que distan, sucesivamente, y cm. Por esos puntos se trazan rectas paralelas que cortan otra, s, en M, N y P.

Διαβάστε περισσότερα

LIPIDOS. Ácidos grasos saturados más comunes.

LIPIDOS. Ácidos grasos saturados más comunes. LIPIDOS Ácidos grasos saturados más comunes. 4C butírico 5 valerico 6 caproico 7 enántico 8 caprilico 9 nonanoico 10 caprico 12 laurico 14 miristico 15 pentadecanoico 16 palmitico 17 margárico 18 esteárico

Διαβάστε περισσότερα

www.absolualarme.com met la disposition du public, via www.docalarme.com, de la documentation technique dont les rιfιrences, marques et logos, sont

www.absolualarme.com met la disposition du public, via www.docalarme.com, de la documentation technique dont les rιfιrences, marques et logos, sont w. ww lua so ab me lar m.co t me la sit po dis ion du c, bli pu via lar ca do w. ww me.co m, de la ion nta t do cu me on t ed hn iqu tec les en ce s, rι fιr ma rq ue se t lo go s, so nt la pr op riι tι

Διαβάστε περισσότερα

De la Base de Datos de Torneos de Chess-Results

De la Base de Datos de Torneos de Chess-Results De la Base de Datos de Torneos de Chess-Results http://chess-results.com Διασυλλογικό Πρωτάθλημα Ε.Σ.Σ.ΠΕ.Π. 2010 Última actualización21.02.2010 19:47:18 Orden de fuerza de los equipos con resultados ronda

Διαβάστε περισσότερα

Los Determinantes y los Pronombres

Los Determinantes y los Pronombres Los Determinantes y los Pronombres Englobamos dentro de los determinantes al artículo y a todos los adjetivos determinativos (demostrativos, posesivos, numerales, indefinidos, interrogativos y exclamativos).

Διαβάστε περισσότερα

Επιτυχόντες 2001-2002

Επιτυχόντες 2001-2002 Επιτυχόντες 2001-2002 1 Λακιωτάκη Ελευθερία Ηλεκτρολόγων Μηχ. & Μηχ. Υπολογιστών Θεσσαλονίκης 2 Τραχανατζή Ειρήνη Ιατρικής Κρήτης 3 Λιόλιου Παναγιώτα Οδοντιατρικής Θεσσαλονίκης 4 Μπλαζάκης Κωνσταντίνος

Διαβάστε περισσότερα

Inmigración Documentos

Inmigración Documentos - General Dónde tengo que pedir el formulario/impreso para? Pedir un formulario Cuál es la fecha de expedición de su (documento)? Pedir la fecha de expedición de un documento Cuál es el lugar de expedición

Διαβάστε περισσότερα

ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ. Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ

ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ. Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ ΤΜΗΜΑ ΦΥΤΙΚΗΣ ΠΑΡΑΓΩΓΗΣ Ο ΡΟΛΟΣ ΤΩΝ ΜΙΚΡΩΝ RNAs (small RNAs ) ΣΤΗ ΛΕΙΤΟΥΡΓΙΑ ΤΟΥ ΦΥΤΙΚΟΥ ΚΥΤΤΑΡΟΥ Πτυχιακή εργασία του σπουδαστή Αθανάσιου Καραφλού Καλαμάτα, Μάιος 2008 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

AMORTIGUADORES DE VIBRACIÓN

AMORTIGUADORES DE VIBRACIÓN AMORTIGUADORES DE VIBRACIÓN Estas instrucciones forman parte integrante del manual que acompaña el aparato en el cual se va a instalar este accesorio. Este manual se refiere a ADVERTENCIAS GENERALES y

Διαβάστε περισσότερα

Πληροφόρηση σχετικά με το αν πρέπει να πληρώσετε ποσοστά προμήθειας όταν κάνετε ανάληψη σε μια συγκεκριμένη χώρα

Πληροφόρηση σχετικά με το αν πρέπει να πληρώσετε ποσοστά προμήθειας όταν κάνετε ανάληψη σε μια συγκεκριμένη χώρα - Γενικά Can I withdraw money in [country] without paying fees? Puedo sacar dinero en (país) sin pagar comisiones? Πληροφόρηση σχετικά με το αν πρέπει να πληρώσετε ποσοστά προμήθειας όταν κάνετε ανάληψη

Διαβάστε περισσότερα

ΕΠΙΤΡΟΠΗ ΤΩΝ ΕΥΡΩΠΑΪΚΩΝ ΚΟΙΝΟΤΗΤΩΝ

ΕΠΙΤΡΟΠΗ ΤΩΝ ΕΥΡΩΠΑΪΚΩΝ ΚΟΙΝΟΤΗΤΩΝ ΕΠΙΤΡΟΠΗ ΤΩΝ ΕΥΡΩΠΑΪΚΩΝ ΚΟΙΝΟΤΗΤΩΝ Βρυξέλλες, 5.9.2005 COM(2005) 405 τελικό ΑΝΑΚΟΙΝΩΣΗ ΤΗΣ ΕΠΙΤΡΟΠΉΣ στο Συµβούλιο, το Ευρωπαϊκό Κοινοβούλιο, την Ευρωπαϊκή Οικονοµική και Κοινωνική Επιτροπή και την Επιτροπή

Διαβάστε περισσότερα

TEMA DE PRESENTE. *βάλ-y-ω > βάλλω, *θιλέ-y-ω > θιλέω, *πρακ-y-ω > πράηηω, etc. ὀθλι-ζκ-άν-ω, etc.

TEMA DE PRESENTE. *βάλ-y-ω > βάλλω, *θιλέ-y-ω > θιλέω, *πρακ-y-ω > πράηηω, etc. ὀθλι-ζκ-άν-ω, etc. TEMA DE PRESENTE. El tema de presente se considera el tema básico u originario del verbo griego. Aunque realmente esto no es exacto, pues aunque el resto de temas en muchas ocasiones, cuando se consideran

Διαβάστε περισσότερα

Γενικός ρυθμός μεταβολής οικονομικά ενεργού πληθυσμού χρονών - σύνολο

Γενικός ρυθμός μεταβολής οικονομικά ενεργού πληθυσμού χρονών - σύνολο 15-64 χρονών - σύνολο Περιγραφή δείκτη και πηγή πληροφοριών Ο γενικός ρυθμός μεταβολής οικονομικά ενεργού πληθυσμού 15-64 χρονών υπολογίζεται με τη διαίρεση της ετήσιας αύξησης του οικονομικά ενεργού πληθυσμού

Διαβάστε περισσότερα

MARKSCHEME BARÈME DE NOTATION ESQUEMA DE CALIFICACIÓN

MARKSCHEME BARÈME DE NOTATION ESQUEMA DE CALIFICACIÓN IB DIPLOMA PROGRAMME PROGRAMME DU DIPLÔME DU BI PROGRAMA DEL DIPLOMA DEL BI M06/2/ABMGR/SP1/GRE/TZ0/XX/M MARKSCHEME BARÈME DE NOTATION ESQUEMA DE CALIFICACIÓN May / mai / mayo 2006 MODERN GREEK / GREC

Διαβάστε περισσότερα

Θέμα/Αντικείμενο: Δομή και λειτουργίες των φύλλων.

Θέμα/Αντικείμενο: Δομή και λειτουργίες των φύλλων. FL/STEM Σχεδιασμός/Πρότυπο μαθήματος / Βαρσοβία 2882015 Μάθημα (τίτλος) EEstructura y características de las hojas. Επίπεδο επάρκειας γλώσσας A1 A2 B1 B2 C1 Τάξη/βαθμίδα: 5η Αριθμός μαθητών στην τάξη:

Διαβάστε περισσότερα

Τεχνικές του δράματος και Διδακτική των ζωντανών γλωσσών. Η συμβολή τους στη διαμόρφωση διαπολιτισμικής συνείδησης

Τεχνικές του δράματος και Διδακτική των ζωντανών γλωσσών. Η συμβολή τους στη διαμόρφωση διαπολιτισμικής συνείδησης Αντώνης Χασάπης 839 Αντώνης Χασάπης Εκπαιδευτικός, Μεταπτυχιακός ΠΔΜ, Ελλάδα Résumé Dans le domaine de la didactique des langues vivantes l intérêt de la recherche scientifique se tourne vers le développement

Διαβάστε περισσότερα

Ποσοστό απασχόλησης στον τριτογενή τομέα του πληθυσμού χρονών - σύνολο

Ποσοστό απασχόλησης στον τριτογενή τομέα του πληθυσμού χρονών - σύνολο Ποσοστό απασχόλησης στον τριτογενή τομέα του πληθυσμού 15-64 χρονών - σύνολο Περιγραφή δείκτη και πηγή πληροφοριών Το ποσοστό απασχόλησης στον τριτογενή τομέα του πληθυσμού 15-64 χρονών υπολογίζεται με

Διαβάστε περισσότερα

ΓΙΑΝΝΗΣ ΑΡΓΥΡΗΣ ΒΙΟΛΟΓΙΑ. Γενικής Παιδείας ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ

ΓΙΑΝΝΗΣ ΑΡΓΥΡΗΣ ΒΙΟΛΟΓΙΑ. Γενικής Παιδείας ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ ΓΙΑΝΝΗΣ ΑΡΓΥΡΗΣ ΒΙΟΛΟΓΙΑ Γενικής Παιδείας ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Αθήνα 2014 1 η ΕΝΟΤΗΤΑ ΟΜΑΔΑ ΕΡΩΤΗΣΕΩΝ ΠΟΛΛΑΠΛΗΣ ΕΠΙΛΟΓΗΣ Στις ερωτήσεις που ακολουθούν, να επιλέξετε το γράμμα που αντιστοιχεί στη σωστή απάντηση.

Διαβάστε περισσότερα

ΓΙΩΡΓΟ ΓΕΩΡΓΘ. φντομο Βιογραφικό θμείωμα. 2011 Ιαν.-2010 Ιαν.: Αναπλ. Κοςμιτορασ Φιλοςοφικισ χολισ του. Πανεπιςτθμίου Κφπρου. Μζλοσ Επιτροπισ Ζρευνασ.

ΓΙΩΡΓΟ ΓΕΩΡΓΘ. φντομο Βιογραφικό θμείωμα. 2011 Ιαν.-2010 Ιαν.: Αναπλ. Κοςμιτορασ Φιλοςοφικισ χολισ του. Πανεπιςτθμίου Κφπρου. Μζλοσ Επιτροπισ Ζρευνασ. 1 ΓΙΩΡΓΟ ΓΕΩΡΓΘ φντομο Βιογραφικό θμείωμα 2011 Ιαν.-2010 Ιαν.: Αναπλ. Κοςμιτορασ Φιλοςοφικισ χολισ του Πανεπιςτθμίου Κφπρου Μζλοσ Επιτροπισ Ζρευνασ. 2010 Απρ.: Κυκλοφορεί το δίγλωςςο βιβλίο του τουσ αντίποδεσ

Διαβάστε περισσότερα

EL ADJETIVO GRIEGO 2-1-2 2-2 3-1-3

EL ADJETIVO GRIEGO 2-1-2 2-2 3-1-3 EL ADJETIVO GRIEGO El adjetivo griego, al igual que el sustantivo, también se declina. El adjetivo griego tiene que concordar con el sustantivo en género, número y caso. En latín no podemos decir puer

Διαβάστε περισσότερα

Ποσοστό μακροχρόνιας ανεργίας (διάρκεια 12+ μήνες) οικονομικά ενεργού πληθυσμού 15+ χρονών - σύνολο

Ποσοστό μακροχρόνιας ανεργίας (διάρκεια 12+ μήνες) οικονομικά ενεργού πληθυσμού 15+ χρονών - σύνολο οικονομικά ενεργού πληθυσμού 15+ χρονών - σύνολο Περιγραφή δείκτη και πηγή πληροφοριών Το ποσοστό μακροχρόνιας ανεργίας (διάρκεια 12+ μήνες) οικονομικά ενεργού πληθυσμού 15+ χρονών υπολογίζεται με τη διαίρεση

Διαβάστε περισσότερα

ΕΥΡΩΒΑΡΟΜΕΤΡΟ 72 ΚΟΙΝΗ ΓΝΩΜΗ ΣΤΗΝ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ

ΕΥΡΩΒΑΡΟΜΕΤΡΟ 72 ΚΟΙΝΗ ΓΝΩΜΗ ΣΤΗΝ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ Standard Eurobarometer European Commission ΕΥΡΩΒΑΡΟΜΕΤΡΟ 72 ΚΟΙΝΗ ΓΝΩΜΗ ΣΤΗΝ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ ΦΘΙΝΟΠΩΡΟ 2009 Standard Eurobarometer 72 / Φθινόπωρο 2009 TNS Opinion & Social ΕΘΝΙΚΗ ΑΝΑΛΥΣΗ GREECE Η έρευνα

Διαβάστε περισσότερα

Μερίδιο εργοδοτουμένων με μερική ή / και προσωρινή απασχόληση στον εργοδοτούμενο πληθυσμό 15+ χρονών - σύνολο

Μερίδιο εργοδοτουμένων με μερική ή / και προσωρινή απασχόληση στον εργοδοτούμενο πληθυσμό 15+ χρονών - σύνολο Μερίδιο εργοδοτουμένων με μερική ή / και προσωρινή απασχόληση στον εργοδοτούμενο πληθυσμό 15+ χρονών - σύνολο Περιγραφή δείκτη και πηγή πληροφοριών Το μερίδιο εργοδοτουμένων με μερική ή/και προσωρινή απασχόληση

Διαβάστε περισσότερα

ΓΙΟΡΤΗ ΚΟΛΥΜΒΗΤΗ 13/8/2013 50Μ ΕΛΕΥΘΕΡΟ ΚΟΡΙΤΣΙΑ 9 ΕΤΩΝ

ΓΙΟΡΤΗ ΚΟΛΥΜΒΗΤΗ 13/8/2013 50Μ ΕΛΕΥΘΕΡΟ ΚΟΡΙΤΣΙΑ 9 ΕΤΩΝ 50Μ ΕΛΕΥΘΕΡΟ ΚΟΡΙΤΣΙΑ 9 ΕΤΩΝ ΚΑΡΑΤΖΙΑ ΜΥΡΤΩ ΝΑΒΕ.05.9 2 ΠΑΠΑΓΕΩΡΓΙΟΥ ΑΝΑΣΤΑΣΙΑ ΗΡΑ 3 ΓΕΩΡΓΟΥΛΗ ΚΑΛΛΙΡΟΗ ΝΕΑΠΟΛΗ 0.45.44 4 ΚΑΡΑΛΙΔΟΥ ΝΑΤΑΛΙΑ ΑΡΗΣ 0.5.58 5 ΚΩΝΣΤΑΝΤΙΝΙΔΟΥ ΧΡΥΣΑΝΘΗ ΝΟΚ 0.43.84 ΒΕΛΟΥΖΟΥ ΙΩΑΝΝΑ

Διαβάστε περισσότερα

El ciclo de Krebs es una ruta cíclica constituida por una secuencia de 8 reacciones, todas localizadas en la matriz mitocondrial.

El ciclo de Krebs es una ruta cíclica constituida por una secuencia de 8 reacciones, todas localizadas en la matriz mitocondrial. El ciclo Krebs es una ruta cíclica constituida por una secuencia 8 reacciones, todas localizadas en la matriz mitocondrial. Es el centro l metabolismo. Es una vía anfibólica Oxida la mayor parte carbohidratos,

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛΙΣΜΟΣ NΟΥΚΛΕΟΤΙΔΙΩΝ

ΜΕΤΑΒΟΛΙΣΜΟΣ NΟΥΚΛΕΟΤΙΔΙΩΝ ΜΕΤΑΒΟΛΙΣΜΟΣ NΟΥΚΛΕΟΤΙΔΙΩΝ Σύνοψη: Μεταβολισμός Noυκλεοτιδίων Δομή και ονοματολογία Πορείες περίσωσης Σύνδρομο Lesch-Nyhan Πορείες σύνθεσης de novo και ρύθμιση Νουκλεοτίδια πυριμιδίνης Νουκλεοτίδια πoυρίνης

Διαβάστε περισσότερα

Análisis de las Enneadas de Plotino. Gonzalo Hernández Sanjorge A Parte Rei 20

Análisis de las Enneadas de Plotino. Gonzalo Hernández Sanjorge A Parte Rei 20 Análisis de las Enneadas de Plotino, Tratado Cuarto de la Enneada Primera Acerca de la felicidad1 Gonzalo Hernández Sanjorge La felicidad vinculada al vivir bien: la sensación y la razón. Identificar qué

Διαβάστε περισσότερα

35-50 1969 ΑΝΘΕΜΙΟ ΜΕ ΛΟΥΛΟΥΔΙ

35-50 1969 ΑΝΘΕΜΙΟ ΜΕ ΛΟΥΛΟΥΔΙ 52. Ακροκέραμα 1956 1957 1958 1959 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1956 Ακροκέραμο γωνιακό παραθύρου νεοκλασικού αριστερό. Ύψος 20εκ. 240-280 1957 Ακροκέραμο μετωπικό παραθύρου νεοκλασικού.διαστ.

Διαβάστε περισσότερα

ΕΞΑΡΤΗΜΑΤΑ 06 ΡΥΜΟΥΛΚΑΣ 160 Κ Α Τ Α Λ Ο Γ Ο Σ 2 0 1 5 A R C A D I A T E R R A Κ Α Τ Α Λ Ο Γ Ο Σ 2 0 1 5 A R C A D I A T E R R A

ΕΞΑΡΤΗΜΑΤΑ 06 ΡΥΜΟΥΛΚΑΣ 160 Κ Α Τ Α Λ Ο Γ Ο Σ 2 0 1 5 A R C A D I A T E R R A Κ Α Τ Α Λ Ο Γ Ο Σ 2 0 1 5 A R C A D I A T E R R A 06 ΕΞΑΡΤΗΜΑΤΑ ΡΥΜΟΥΛΚΑΣ 160 ΕΞΑΡΤΗΜΑΤΑ ΡΥΜΟΥΛΚΑΣ 06 Ζαντολάστιχα γεωργικών μηχανημάτων με μέγιστη ταχύτητα 40Κm ΚΩΔΙΚΟΣ ΔΙΑΣΤΑΣΕΙΣ ΥΨΟΣ ΜΠΟΥΖ. ΛΙΝΑ ΚΙΛΑ ΧΩΡΙΣ ΦΠΑ ΜΕ ΦΠΑ 06-100 155/70-13 540 4 4 387 61.14

Διαβάστε περισσότερα

GR-Kifisia: Servicios topográficos 2009/S ANUNCIO DE CONCURSO DE PROYECTOS

GR-Kifisia: Servicios topográficos 2009/S ANUNCIO DE CONCURSO DE PROYECTOS DO/S S178 256314-2009-ES Comunidades Europeas Servicios Anuncio de concurso de proyectos 1/1 GR-Kifisia: Servicios topográficos 2009/S 178-256314 ANUNCIO DE CONCURSO DE PROYECTOS APARTADO I: PODER ADJUDICADOR/ENTIDAD

Διαβάστε περισσότερα

ΠΑΡΑΡΤΗΜΑ ΙΙ ΔΗΜΟΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Πόλη: ΑΛΕΞΑΝΔΡΟΥΠΟΛΗ Ταχ. κώδικας: Χώρα: Ελλάδα 681 00 ΕΛΛΑΔΑ-GR Σημείο(-α) επαφής: Τεχνική Υπηρεσία

ΠΑΡΑΡΤΗΜΑ ΙΙ ΔΗΜΟΣ ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ. Πόλη: ΑΛΕΞΑΝΔΡΟΥΠΟΛΗ Ταχ. κώδικας: Χώρα: Ελλάδα 681 00 ΕΛΛΑΔΑ-GR Σημείο(-α) επαφής: Τεχνική Υπηρεσία ΠΑΡΑΡΤΗΜΑ ΙΙ ΕΥΡΩΠΑΪΚΗ ΕΝΩΣΗ Δημοσίευση στο συμπλήρωμα της Επίσημης Εφημερίδας της Ευρωπαϊκής Ένωσης 2, rue Mercier, L-2985 Luxembourg Φαξ: (352) 29 29 42 670 Ηλεκτρονικό ταχυδρομείο: mp-ojs@opoce.cec.eu.int

Διαβάστε περισσότερα

BIOSÍNTESIS DE ÁCIDOS GRASOS

BIOSÍNTESIS DE ÁCIDOS GRASOS BISÍNTESIS DE ÁCIDS GRASS La biosíntesis de ácidos grasos se lleva a cabo en el citosol de todas las células, pero principalmente en el hígado, tejido adiposo y glándulas mamarias de los animales superiores.

Διαβάστε περισσότερα

Curso A MATERIA VIVA. Tema 1. Bioloxía 2º Bacharelato

Curso A MATERIA VIVA. Tema 1. Bioloxía 2º Bacharelato Curso 2014 2015 A MATERA VVA Bioloxía 2º Bacharelato Temario CUGA Clasificación dos compoñentes químicos. Tipos de enlaces químicos presentes na materia viva: covalente, iónico, pontes de hidróxeno, forzas

Διαβάστε περισσότερα

PAU XUÑO 2014 BIOLOXÍA

PAU XUÑO 2014 BIOLOXÍA PAU XUÑO 2014 Código: 21 BIOLOXÍA Estrutura da proba: a proba componse de dúas opcións: A e B. Só se poderá contestar a unha das dúas opcións, desenvolvendo integramente o seu contido. Puntuación: a cualificación

Διαβάστε περισσότερα

πûùôú ÙˆÓ ÃˆÚˆÓ ÙË ÙÈÓÈÎ ÌÂÚÈÎ

πûùôú ÙˆÓ ÃˆÚˆÓ ÙË ÙÈÓÈÎ ÌÂÚÈÎ πûùôú ÙˆÓ ÃˆÚˆÓ ÙË ÙÈÓÈÎ ÌÂÚÈÎ A. VARGAS Á ÂÈÚ ÈÔ ªÂÏ ÙË Copyright 2001 Για την Eλλάδα και όλο τον κόσµο EΛΛHNIKO ANOIKTO ΠANEΠIΣTHMIO Oδός Παπαφλέσσα & Yψηλάντη, 262 22 Πάτρα Tηλ: (061) 314 094, 314 206,

Διαβάστε περισσότερα

Vocabulario unidad 4: La casa

Vocabulario unidad 4: La casa Αγγελία, η: anuncio Ανακαινισμένος, η, ο: renovado Ανεμιστήρα, η: ventilador Άνετος, η, ο: cómodo Αποθήκη, η: almacén, trastero Απορροφητήρας, ο: extractor Αριθμός, ο: número Ασανσέρ, το: ascensor Αυλή,

Διαβάστε περισσότερα

Ref.:235/CON Rome, 8 September English (click here) Français (cliquez ici) Español (haga click aqui) Italiano (clicca qui) Ελληνική (κλικ εδώ)

Ref.:235/CON Rome, 8 September English (click here) Français (cliquez ici) Español (haga click aqui) Italiano (clicca qui) Ελληνική (κλικ εδώ) Ref.:235/CON Rome, 8 September 2016 English (click here) Français (cliquez ici) Español (haga click aqui) Italiano (clicca qui) Ελληνική (κλικ εδώ) Prot.: 235/CON Roma, 8 Settembre 2016 Ordine del giorno

Διαβάστε περισσότερα

Α. Η ΜΕΛΙΣΣΟΚΟΜΙΑ ΣΤΗΝ ΕΛΛΑΔΑ

Α. Η ΜΕΛΙΣΣΟΚΟΜΙΑ ΣΤΗΝ ΕΛΛΑΔΑ ΓΕΩΠΟΝΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΑΘΗΝΩΝ ΕΡΓΑΣΤΗΡΙΟ ΣΗΡΟΤΡΟΦΙΑΣ ΚΑΙ ΜΕΛΙΣΣΟΚΟΜΙΑΣ Πασχάλης Χαριζάνης Α. Η ΜΕΛΙΣΣΟΚΟΜΙΑ ΣΤΗΝ ΕΛΛΑΔΑ 1. Κερί Σύμφωνα με την Εθνική Στατιστική Υπηρεσία της Ελλάδος η παραγωγή κεριού για

Διαβάστε περισσότερα

2.-Relaciona grupos sintácticos que están en el mismo caso: γυπός πυραμίδων αἰθíοπες γῦπες μύρμηκι μάστιξι αἶγας κῆρυξ

2.-Relaciona grupos sintácticos que están en el mismo caso: γυπός πυραμίδων αἰθíοπες γῦπες μύρμηκι μάστιξι αἶγας κῆρυξ Ejercicios 3º declinación. Temas consonantes: (Temas en oclusivas) 1.-Siguiendo el modelo de la tercera declinación, completa el siguiente cuadro con la palabra: αἴξ, αἰγός 2.-Relaciona grupos sintácticos

Διαβάστε περισσότερα

23.12.2006 Επίσημη Εφημερίδα της Ευρωπαϊκής Ένωσης EL ΠΑΡΑΡΤΗΜΑ V ΑNAΠAPAΓΩΓH TΩN KOINOTIKΩN ΣYMBOΛΩN KAI ENΔEIΞEΩN 1. KOINOTIKA ΣYMBOΛA, EΓXPΩMA -Ή AΣΠPOMAYPA Έγχρωμα χρησιμοποιούνται σε χρώματα Pantone

Διαβάστε περισσότερα

MΑΘΗΜΑΤΑ ΚΑΤΑΡΤΙΣΗΣ ΓΙΑ ΚΑΘΗΓΗΤΕΣ ΙΣΠΑΝΙΚΩΝ

MΑΘΗΜΑΤΑ ΚΑΤΑΡΤΙΣΗΣ ΓΙΑ ΚΑΘΗΓΗΤΕΣ ΙΣΠΑΝΙΚΩΝ Κινηματογράφος και θέατρο: Η ιστορία τους, οι διευθυντές και οι σημαντικές ταινίες. Αρχιτεκτονική, ζωγραφική, γλυπτική και φωτογραφία: Η ιστορία τους, οι συγγραφείς Ιnstituto Cervantes: Εξασφάλιση Στην

Διαβάστε περισσότερα

Ταξίδι Γενικά. Γενικά - Τα απαραίτητα. Γενικά - Συνομιλία. Παράκληση για βοήθεια. Ερώτηση σε πρόσωπο αν μιλά αγγλικά

Ταξίδι Γενικά. Γενικά - Τα απαραίτητα. Γενικά - Συνομιλία. Παράκληση για βοήθεια. Ερώτηση σε πρόσωπο αν μιλά αγγλικά - Τα απαραίτητα Podría ayudarme? Παράκληση για βοήθεια Habla inglés? Ερώτηση σε πρόσωπο αν μιλά αγγλικά Habla_[idioma]_? Ερώτηση σε πρόσωπο αν μιλά ορισμένη γλώσσα No hablo_[idioma]_. Διασαφήνιση ότι δεν

Διαβάστε περισσότερα

Preguntas V e F (selectividade):

Preguntas V e F (selectividade): Preguntas V e F (selectividade): 2002 F- As vacinas proporcionan inmunidade artificial pasiva. F- Algúns xenes teñen intróns, exóns e axóns. F- A difusión pasiva non require transportadores. V- Os polisomas

Διαβάστε περισσότερα

Βιομόρια, δομή κυττάρου, διαμερισματοποίηση. Ν. Κ. Μοσχονάς n_moschonas@med.upatras.gr Εργ. Γεν. Βιολογίας, Τμ. Ιατρικής Παν/μιο Πάτρας

Βιομόρια, δομή κυττάρου, διαμερισματοποίηση. Ν. Κ. Μοσχονάς n_moschonas@med.upatras.gr Εργ. Γεν. Βιολογίας, Τμ. Ιατρικής Παν/μιο Πάτρας Βιομόρια, δομή κυττάρου, διαμερισματοποίηση Ν. Κ. Μοσχονάς n_moschonas@med.upatras.gr Εργ. Γεν. Βιολογίας, Τμ. Ιατρικής Παν/μιο Πάτρας Ποια είναι τα χαρακτηριστικά της ζωής; Θρέψη Αναπαραγωγή Εξέλιξη Ερεθιστικότητα

Διαβάστε περισσότερα

EL TRIPTICO (Aνάλυση ενός καθοριστικού φαινόμενου στην εξέλιξη της κιθάρας του φλαμένκο.) (του Στάθη Γαλάτη)

EL TRIPTICO (Aνάλυση ενός καθοριστικού φαινόμενου στην εξέλιξη της κιθάρας του φλαμένκο.) (του Στάθη Γαλάτη) EL TRIPTICO (Aνάλυση ενός καθοριστικού φαινόμενου στην εξέλιξη της κιθάρας του φλαμένκο.) (του Στάθη Γαλάτη) Μετά τα μικρά πορτραίτα που προσπαθήσαμε να σκιαγραφήσουμε στις προηγούμενες δημοσιεύσεις, με

Διαβάστε περισσότερα