Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 TEMA 6.- BIMLÉCULAS RGÁNICAS IV: ÁCIDS NUCLEICS A.- Características generales de los Ácidos Nucleicos B.- Nucleótidos y derivados nucleotídicos El esqueleto covalente de los ácidos nucleicos: el enlace fosfodiéster C.- Estructura y función del DNA Reconstrucción histórica del descubrimiento de la estructura del DNA El modelo de la doble hélice de Watson y Crick Estructura y funciones de los RNAs RNA mensajero RNA de transferencia RNA ribosómico tros tipos de RNA

2 La molécula de DNA de E. coli es centenares de veces más larga que la propia célula bacteriana Si lo ampliásemos un millón de veces tendría una anchura de 2 mm y una longitud de 1570 metros

3 Los monómeros de los Ácidos nucleicos se denominan genéricamente nucleótidos y están formados por Base nitrogenada Base púrica o pirimidínica Fosfato Una pentosa: ribosa, o dexosirribosa

4 La pentosa es la β D ribosa La numeración de los carbonos es la siguiente: D-Ribosa Forma lineal β D-Ribosa

5 Los nucleótidos del DNA tienen β D 2 desoxirribosa 1 2 H desoxi D-Ribosa Forma lineal 3 β D 2 Desoxirribosa 2 H

6 B.- Nucleótidos y derivados nucleotídicos Las bases nitrogenadas son de dos tipos Derivadas de la pirimidina, o bases pirimidínicas. Derivadas de la Purina, o bases púricas. Pirimidina Purina

7 Bases Púricas Adenina Guanina Bases nitrogenadas Bases Pirimidínicas Citosina Timina Sólo en ADN Uracilo Sólo en ARN

8 Las bases nitrogenadas se unen a la pentosa en el carbono 1 Las bases púricas lo hacen mediante el N 9 y las pirimidínicas el N 1 Pirimidina Purina El enlace se denomina N-Glucosídico

9 Extremo 5 P H Enlace fosfoéster H Enlace N-Glucosídico Extremo 3 H En el Carbono 5 se une el grupo fosfato El enlace es de tipo fosfoéster El Nucleótido representado es el ADENSIN 5 MNFSFAT: AMP Todos los nucleótidos tienen un extremo 5 fosfato y otro 3 hidroxilo

10 AMP Adenosín 5 monofosfato GMP Guanidín 5 monofosfato UMP Uridín 5 monofosfato CMP Citidín 5 monofosfato Nucleósido: Adenosina Nucleósido: Guanosina Nucleósido: Uridina Nucleósido: Citidina Estos 4 nucleótidos son los monómeros del ARN

11 damp Dexosiadenosín 5 monofosfato dgmp Dexosiguanidín 5 monofosfato dtmp Dexositimidín 5 monofosfato dcmp Dexosicitidín 5 monofosfato Nucleósido: dexosiadenosina Nucleósido: Dexosiguanosina Nucleósido: Dexositimidina Nucleósido: Dexosicitidina Estos 4 dexosinucleótidos son los monómeros del ADN

12 Además de ser los monómeros de los Ácidos nucleicos, los nucleótidos y sus derivados tienen otras funciones muy importantes en la célula Intermediaros energéticos: ATP y GTP ATP: Adenosín trifosfato

13 Coenzimas, como el Coenzima A, el NAD y el FAD Coenzima A, un transportador de grupos Acilo Relacionada con la vitamina B 3

14 Coenzimas, como el Coenzima A, el NAD y el FAD FAD: Flavín adenín dinucleótido Un coenzima de xidación-reducción Vitamina B 2 NAD: Nicotín adenín dinucleótido Un coenzima de xidación-reducción Vitamina B 5

15 Segundo mensajero intracelular: AMPc Adenina 3 5 Monofosfato cíclico de adenosina

16 Neuromodulador: Adenosina HCH 2

17 El esqueleto covalente de los ácidos nucleicos: el enlace fosfodiéster Extremo 5 P Extremo 3 H N NH Extremo 5 P - P Extremo 3 H - H H H N H H H N NH 2

18 El esqueleto covalente de los ácidos nucleicos: el enlace fosfodiéster NH Extremo 5 P H P Enlace fosfodiéster H 2 H H H H P Extremo 3 H N H N H H N H H H H H H N NH NH 2 DINUCLEÓTID

19 El esqueleto covalente de los ácidos nucleicos: el enlace fosfodiéster Enlace fosfodiéster Extremo 5 fosfato Extremo 3 H Esqueleto Fosfato-Ribosa



TEMA 1: LA MATERIA DE LA VIDA TEMA 1: LA MATERIA DE LA VIDA La vida y sus niveles de organización. Bioelementos y biomoléculas. Biomoléculas inorgánicas: agua y sales minerales. Biomoléculas orgánicas: glúcidos, lípidos, proteínas

Διαβάστε περισσότερα

TRIGONOMETRIA. hipotenusa L 2. hipotenusa

TRIGONOMETRIA. hipotenusa L 2. hipotenusa TRIGONOMETRIA. Calcular las razones trigonométricas de 0º, º y 60º. Para calcular las razones trigonométricas de º, nos ayudamos de un triángulo rectángulo isósceles como el de la figura. cateto opuesto

Διαβάστε περισσότερα

Tema 7. Glúcidos. Grados de oxidación del Carbono. BIOQUÍMICA-1º de Medicina Dpto. Biología Molecular Isabel Andrés. Alqueno.

Tema 7. Glúcidos. Grados de oxidación del Carbono. BIOQUÍMICA-1º de Medicina Dpto. Biología Molecular Isabel Andrés. Alqueno. Tema 7. Glúcidos. Funciones biológicas. Monosacáridos: nomenclatura y estereoisomería. Pentosas y hexosas. Disacáridos. Enlace glucídico. Polisacáridos de reserva: glucógeno y almidón. Polisacáridos estructurales:

Διαβάστε περισσότερα

Tema 4.- Biomoléculas orgánicas II: Lípidos.

Tema 4.- Biomoléculas orgánicas II: Lípidos. Tema 4.- Biomoléculas orgánicas II: Lípidos. A.- Concepto de Lípido. Clasificación. B.- Lípidos complejos o saponificables. -Los ácidos grasos: estructura química, reacciones de esterificación y saponificación.

Διαβάστε περισσότερα

TEMA 3. Lípidos. Bioq. Juan Pablo Rodríguez

TEMA 3. Lípidos. Bioq. Juan Pablo Rodríguez TEMA 3 Lípidos Bioq. Juan Pablo Rodríguez Lípidos - Definición Bajo el término Lípidos se agrupan un gran número de compuestos, de estructura química variada, que tienen la propiedad común de ser solubles

Διαβάστε περισσότερα

Lípidos. Clasificación

Lípidos. Clasificación Lípidos Son compuestos encontrados en organismos vivos, generalmente solubles en solventes orgánicos e insolubles en agua. Clasificación Propiedades físicas aceites grasas Estructura simples complejos

Διαβάστε περισσότερα

-NH 3. Degradación de aminoácidos. 1) Eliminación del NH 3. 2) Degradación de esqueletos carbonados. Ac. grasos c. cetónicos glucosa.

-NH 3. Degradación de aminoácidos. 1) Eliminación del NH 3. 2) Degradación de esqueletos carbonados. Ac. grasos c. cetónicos glucosa. Degradación de aminoácidos 1) Eliminación del NH 3 interfiere polarización/despolariación nerviosa compite transportadores metales alcalinos -NH 3 + 2) Degradación de esqueletos carbonados Ac. grasos c.

Διαβάστε περισσότερα

την..., επειδή... Se usa cuando se cree que el punto de vista del otro es válido, pero no se concuerda completamente

την..., επειδή... Se usa cuando se cree que el punto de vista del otro es válido, pero no se concuerda completamente - Concordar En términos generales, coincido con X por Se usa cuando se concuerda con el punto de vista de otro Uno tiende a concordar con X ya Se usa cuando se concuerda con el punto de vista de otro Comprendo

Διαβάστε περισσότερα

Ventiladores helicoidales murales o tubulares, versión PL equipados con hélice de plástico y versión AL equipados con hélice de aluminio.

Ventiladores helicoidales murales o tubulares, versión PL equipados con hélice de plástico y versión AL equipados con hélice de aluminio. HCH HCT HCH HCT Ventiladores helicoidales murales o tubulares, de gran robustez Ventiladores helicoidales murales o tubulares, versión PL equipados con hélice de plástico y versión AL equipados con hélice

Διαβάστε περισσότερα

Académico Introducción

Académico Introducción - Σε αυτήν την εργασία/διατριβή θα αναλύσω/εξετάσω/διερευνήσω/αξιολογήσω... general para un ensayo/tesis Για να απαντήσουμε αυτή την ερώτηση, θα επικεντρωθούμε πρώτα... Para introducir un área específica

Διαβάστε περισσότερα


METABOLISMO DE LIPIDOS METABLISM DE LIPIDS atabolismo de ácidos grasos.. xidación de ácidos grasos insaturados. Anabolismo. Biosíntesis de ácidos grasos. Biosíntesis de acilglicéridos. Biosíntesis de fosfolípidos. β-xidain MVILIZAIÓN

Διαβάστε περισσότερα


SOLUCIONES DE LAS ACTIVIDADES Págs. 101 a 119 Página 0. a) b) π 4 π x 0 4 π π / 0 π / x 0º 0 x π π. 0 rad 0 π π rad 0 4 π 0 π rad 0 π 0 π / 4. rad 4º 4 π π 0 π / rad 0º π π 0 π / rad 0º π 4. De izquierda a derecha: 4 80 π rad π / rad 0 Página 0. tg

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Filipenses 2:5-11. Filipenses

Filipenses 2:5-11. Filipenses Filipenses 2:5-11 Filipenses La ciudad de Filipos fue nombrada en honor de Felipe II de Macedonia, padre de Alejandro. Con una pequeña colonia judía aparentemente no tenía una sinagoga. El apóstol fundó

Διαβάστε περισσότερα

1 La teoría de Jeans. t + (n v) = 0 (1) b) Navier-Stokes (conservación del impulso) c) Poisson

1 La teoría de Jeans. t + (n v) = 0 (1) b) Navier-Stokes (conservación del impulso) c) Poisson 1 La teoría de Jeans El caso ás siple de evolución de fluctuaciones es el de un fluído no relativista. las ecuaciones básicas son: a conservación del núero de partículas n t + (n v = 0 (1 b Navier-Stokes

Διαβάστε περισσότερα


Catálogodegrandespotencias www.dimotor.com Catálogogranspotencias Índice Motores grans potencias 3 Motores asíncronos trifásicos Baja Tensión y Alta tensión.... 3 Serie Y2 Baja tensión 4 Motores asíncronos trifásicos Baja Tensión

Διαβάστε περισσότερα

Bioquímica Estructural y Metabólica. TEMA 12. Ciclo de Krebs

Bioquímica Estructural y Metabólica. TEMA 12. Ciclo de Krebs TEMA 12. Ciclo del ácido cítrico (ciclo de los ácidos tricarboxílicos o de Krebs). Importancia del ciclo de Krebs como encrucijada metabólica. Formación del ace7l- coenzima- A: el complejo piruvato deshidrogenasa.

Διαβάστε περισσότερα

90 LIBERTAS SEGUNDA ÉPOCA. Introducción: La necesidad de una Reforma Institucional

90 LIBERTAS SEGUNDA ÉPOCA. Introducción: La necesidad de una Reforma Institucional 1 3 - - Abstract - - - 90 LIBERTAS SEGUNDA ÉPOCA Introducción: La necesidad de una Reforma Institucional - - - - - - - - - UNA PROPUESTA DE REFORMA MONETARIA PARA ARGENTINA 91 1 políticas establecidas

Διαβάστε περισσότερα

(CH 2 O) n H 2 O. ADP + P i NADP + Luz. Triosas fosfato. Clorofila CO 2 + H 2 O O 2 ATP + NADPH. Reacciones luminosas. Reacciones del carbono

(CH 2 O) n H 2 O. ADP + P i NADP + Luz. Triosas fosfato. Clorofila CO 2 + H 2 O O 2 ATP + NADPH. Reacciones luminosas. Reacciones del carbono 2 ADP NADP ( 2 ) n Luz lorofila Triosas 2 ATP NADP 2 2 Reacciones luminosas Reacciones del carbono Ribulosa-1,5- bis Inicio del ciclo 2 2 ADP arboxilación Regeneración 3-Fosfoglicerato ATP ATP Gliceraldehído-3-

Διαβάστε περισσότερα

Bioquímica Estructural y Metabólica. TEMA 18. Síntesis de aminoácidos, hemo y nucleó<dos

Bioquímica Estructural y Metabólica. TEMA 18. Síntesis de aminoácidos, hemo y nucleó<dos . Biosíntesis de los aminoácidos no esenciales. Aminoácidos como precursores de otras aminas biológicas. Síntesis y degradación del grupo hemo. Síntesis de novo de los nucleó

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Inmigración Estudiar. Estudiar - Universidad. Indicar que quieres matricularte. Indicar que quieres matricularte en una asignatura.

Inmigración Estudiar. Estudiar - Universidad. Indicar que quieres matricularte. Indicar que quieres matricularte en una asignatura. - Universidad Me gustaría matricularme en la universidad. Indicar que quieres matricularte Me quiero matricular. Indicar que quieres matricularte en una asignatura en un grado en un posgrado en un doctorado

Διαβάστε περισσότερα

Una visión alberiana del tema. Abstract *** El marco teórico. democracia, república y emprendedores; alberdiano

Una visión alberiana del tema. Abstract *** El marco teórico. democracia, república y emprendedores; alberdiano Abstract Una visión alberiana del tema - democracia, república y emprendedores; - - alberdiano El marco teórico *** - 26 LIBERTAS SEGUNDA ÉPOCA - - - - - - - - revolución industrial EMPRENDEDORES, REPÚBLICA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Problemas resueltos del teorema de Bolzano

Problemas resueltos del teorema de Bolzano Problemas resueltos del teorema de Bolzano 1 S e a la fun ción: S e puede af irm a r que f (x) está acotada en el interva lo [1, 4 ]? P or no se r c ont i nua f (x ) e n x = 1, la f unció n no e s c ont

Διαβάστε περισσότερα

Κυρ. Ιωάννου Οδ. Δωριέων 34 Τ.Κ 8068, Λάρνακα. Adam Smith 8 Crossfield Road Selly Oak Birmingham West Midlands B29 1WQ

Κυρ. Ιωάννου Οδ. Δωριέων 34 Τ.Κ 8068, Λάρνακα. Adam Smith 8 Crossfield Road Selly Oak Birmingham West Midlands B29 1WQ - Dirección Κυρ. Ιωάννου Οδ. Δωριέων 34 Τ.Κ 8068, Λάρνακα Formato de dirección de México: Colonia Código postal + Estado, Ciudad. Jeremy Rhodes 212 Silverback Drive California Springs CA 92926 Formato

Διαβάστε περισσότερα

La experiencia de la Mesa contra el Racismo

La experiencia de la Mesa contra el Racismo La experiencia de la Mesa contra el Racismo Informe Di icultad para identi icarse como discriminado Subsistencia de mecanismos individuales para enfrentar el racismo Las propuestas de las organizaciones

Διαβάστε περισσότερα

Tema de aoristo. Morfología y semántica

Tema de aoristo. Morfología y semántica Tema de aoristo Morfología y semántica El verbo politemático Cada verbo griego tiene 4 temas principales. La diferencia semántica entre ellos es el aspecto, no el tiempo. Semántica de los temas verbales

Διαβάστε περισσότερα

Το παρόν σχέδιο μαθήματος δημιουργήθηκε από την κα. Radost Mazganova, καθηγήτρια Ισπανικών και την κα. Yordanka Yordanova, καθηγήτρια χημείας

Το παρόν σχέδιο μαθήματος δημιουργήθηκε από την κα. Radost Mazganova, καθηγήτρια Ισπανικών και την κα. Yordanka Yordanova, καθηγήτρια χημείας Μάθημα (τίτλος) Καθαρές ουσίες και μείγματα Επίπεδο γλωσσικής επάρκειας Α1 Α2 Β1 Β2 C1 Τάξη/βαθμίδα: πέμπτη Αριθμός μαθητών στην τάξη: 15 Θέμα: Άνθρωπος και φύση / Ουσίες και οι ιδιότητές τους Προϋποθέσεις

Διαβάστε περισσότερα

IV FESTIVAL LEA. Concurso entre escuelas de aprendizaje del español

IV FESTIVAL LEA. Concurso entre escuelas de aprendizaje del español IV FESTIVAL LEA El IV Festival Iberoamericano Literatura En Atenas, organizado por la revista Cultural Sol Latino, el Instituto Cervantes de Atenas y la Fundación María Tsakos, dura este año dos semanas:

Διαβάστε περισσότερα

FL/STEM Σχεδιασμός/Πρότυπο μαθήματος (χημεία) 2015/2016. Μάθημα (τίτλος) Οξυγόνο. Παραγωγή οξυγόνου Επίπεδο επάρκειας γλώσσας < Α1 Α2 Β1 Β2 C1

FL/STEM Σχεδιασμός/Πρότυπο μαθήματος (χημεία) 2015/2016. Μάθημα (τίτλος) Οξυγόνο. Παραγωγή οξυγόνου Επίπεδο επάρκειας γλώσσας < Α1 Α2 Β1 Β2 C1 Μάθημα (τίτλος) Οξυγόνο. Παραγωγή οξυγόνου Επίπεδο επάρκειας γλώσσας < Α1 Α2 Β1 Β2 C1 Τάξη/βαθμίδα: 6η Αριθμός μαθητών στην τάξη: 8 Περιεχόμενο μαθήματος: Οξυγόνο. Θέμα: Άνθρωπος και φύση Ουσίες Προϋποθέσεις

Διαβάστε περισσότερα

Nro. 01 Septiembre de 2011

Nro. 01 Septiembre de 2011 SOL Cultura La Tolita, de 400 ac. a 600 dc. En su representación se sintetiza toda la mitología ancestral del Ecuador. Trabajado en oro laminado y repujado. Museo Nacional Banco Central del Ecuador Dirección

Διαβάστε περισσότερα

Το ίκτυο Βιβλιοθηκών του Τµήµατος Κοινωνικού Έργου της Caja Madrid. La Red de Bibliotecas de Obra Social Caja Madrid

Το ίκτυο Βιβλιοθηκών του Τµήµατος Κοινωνικού Έργου της Caja Madrid. La Red de Bibliotecas de Obra Social Caja Madrid Το ίκτυο Βιβλιοθηκών του Τµήµατος Κοινωνικού Έργου της Caja Madrid La Red de Bibliotecas de Obra Social Caja Madrid Το ίκτυο Βιβλιοθηκών αποτελεί τµήµα ενός Χρηµατοπιστωτικού Φορέα που προορίζει ποσοστό

Διαβάστε περισσότερα

Escenas de episodios anteriores

Escenas de episodios anteriores Clase 09/10/2013 Tomado y editado de los apuntes de Pedro Sánchez Terraf Escenas de episodios anteriores objetivo: estudiar formalmente el concepto de demostración matemática. caso de estudio: lenguaje

Διαβάστε περισσότερα

KYTTAPO. κυτταρική µεµβράνη (το διαχωρίζουν από το περιβάλλον & από τα άλλα κύτταρα)

KYTTAPO. κυτταρική µεµβράνη (το διαχωρίζουν από το περιβάλλον & από τα άλλα κύτταρα) KYTTAPO Tα κύτταρα έχουν κοινά χαρακτηριστικά - κυτταρική µεµβράνη (το διαχωρίζουν από το περιβάλλον & από τα άλλα κύτταρα) πρωτεϊνών διάλυµα ηλεκτρολυτών (κυτοσόλιο) υδατανθράκων σχήµα & ρευστότητα καθορίζονται

Διαβάστε περισσότερα

Academic Opening Opening - Introduction Greek Spanish En este ensayo/tesis analizaré/investigaré/evaluaré...

Academic Opening Opening - Introduction Greek Spanish En este ensayo/tesis analizaré/investigaré/evaluaré... - Introduction Σε αυτήν την εργασία/διατριβή θα αναλύσω/εξετάσω/διερευνήσω/αξιολογήσω... General opening for an essay/thesis En este ensayo/tesis analizaré/investigaré/evaluaré... Για να απαντήσουμε αυτή

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Στοιχεία Βιολογίας και Αρχές Βιοδιάβρωσης

Στοιχεία Βιολογίας και Αρχές Βιοδιάβρωσης Στοιχεία Βιολογίας και Αρχές Βιοδιάβρωσης ΒΑΣΙΚΕΣ ΕΝΝΟΙΕΣ Ορισμός της Βιολογίας Ορισμός έμβιων-άβιων Χαρακτηριστικά γνωρίσµατα των ζωντανών οργανισµών - Διάκριση από τα συστήµατα που χαρακτηρίζονται από

Διαβάστε περισσότερα

PRUEBA INICIAL DE CLASIFICACIÓN CURSO Documento para adjuntar a la Solicitud de plaza

PRUEBA INICIAL DE CLASIFICACIÓN CURSO Documento para adjuntar a la Solicitud de plaza PRUEBA INICIAL DE CLASIFICACIÓN CURSO 2017-18 Documento para adjuntar a la Solicitud de plaza Yo con DNI, número de teléfono y dirección de correo electrónico, solicitante del idioma, nivel, declaro bajo

Διαβάστε περισσότερα

Ταξίδι Γενικά. Γενικά - Τα απαραίτητα. Γενικά - Συνομιλία. Παράκληση για βοήθεια. Ερώτηση σε πρόσωπο αν μιλά αγγλικά

Ταξίδι Γενικά. Γενικά - Τα απαραίτητα. Γενικά - Συνομιλία. Παράκληση για βοήθεια. Ερώτηση σε πρόσωπο αν μιλά αγγλικά - Τα απαραίτητα Podría ayudarme? Παράκληση για βοήθεια Habla inglés? Ερώτηση σε πρόσωπο αν μιλά αγγλικά Habla_[idioma]_? Ερώτηση σε πρόσωπο αν μιλά ορισμένη γλώσσα No hablo_[idioma]_. Διασαφήνιση ότι δεν

Διαβάστε περισσότερα

Black and White, an innovation in wooden flooring.

Black and White, an innovation in wooden flooring. a m s t e r d a m v i e n n a l o n d o n p a r i s m o s c o w d u b l i n m i l a n c o p e n h a g e n g e n e v a a t h e n s b a r c e l o n a r e y k j a v i c k i e v GB PT ES IT GR Black and White,

Διαβάστε περισσότερα

Αντιδράσεις οξειδωτικού μέρους. Μη οξειδωτικές αντιδράσεις ΔΡΟΜΟΣ ΤΩΝ ΦΩΣΦΟΤΙΚΩΝ ΠΕΝΤΟΖΩΝ. 6-Ρ γλυκόζη. 5-Ρ ριβουλόζη

Αντιδράσεις οξειδωτικού μέρους. Μη οξειδωτικές αντιδράσεις ΔΡΟΜΟΣ ΤΩΝ ΦΩΣΦΟΤΙΚΩΝ ΠΕΝΤΟΖΩΝ. 6-Ρ γλυκόζη. 5-Ρ ριβουλόζη Αντιδράσεις οξειδωτικού μέρους 6-Ρ γλυκόζη 5-Ρ ριβουλόζη ΔΡΟΜΟΣ ΤΩΝ ΦΩΣΦΟΤΙΚΩΝ ΠΕΝΤΟΖΩΝ 5-Ρ ριβόζη (C 5 ) 5-Ρ ξυλουλόζη (C 5 ) GAP (C 3 ) 7-Ρ σεδοεπτουλόζη (C 7 ) 6-Ρ φρουκτόζη(c 6 ) 4-Ρ ερυθρόζη (C 5

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Για να ρωτήσετε αν κάποιος μπορεί να σας βοηθήσει να γεμίσετε μια φόρμα

Για να ρωτήσετε αν κάποιος μπορεί να σας βοηθήσει να γεμίσετε μια φόρμα - Γενικά Dónde tengo que pedir el formulario/impreso para? Για να ρωτήσετε που μπορείτε να βρείτε μια φόρμα Dónde tengo que pedir el formulario/impreso para? Cuál es la fecha de expedición de su (documento)?

Διαβάστε περισσότερα

-νω. - νω. -σκω. - σκω

-νω. - νω. -σκω. - σκω TEMA DE PRESENTE -1- PRESENTES TEMÁTICOS ATEMÁTICOS RADICALES SUFIJADOS RADICALES SUFIJADOS SIN -νω SIN -ν -µι -ν -µαι CON - νω -σκω CON -νη-µι -ν -µαι - σκω - A) Temáticos radicales sin reduplicación

Διαβάστε περισσότερα

Tipologie installative - Installation types Type d installation - Installationstypen Tipos de instalación - Τυπολογίες εγκατάστασης

Tipologie installative - Installation types Type d installation - Installationstypen Tipos de instalación - Τυπολογίες εγκατάστασης AMPADE MOOCROMATICHE VIMAR DIMMERABII A 0 V~ - VIMAR 0 V~ DIMMABE MOOCHROME AMP AMPE MOOCHROME VIMAR VARIATEUR 0 V~ - DIMMERFÄHIGE MOOCHROMATICHE AMPE VO VIMAR MIT 0 V~ ÁMPARA MOOCROMÁTICA VIMAR REGUABE

Διαβάστε περισσότερα

Tipologie installative - Installation types Types d installation - Die einbauanweisungen Tipos de instalación - Τυπολογίες εγκατάστασης

Tipologie installative - Installation types Types d installation - Die einbauanweisungen Tipos de instalación - Τυπολογίες εγκατάστασης Types d installation Die einbauanweisungen Tipos de instalación Τυπολογίες εγκατάστασης AMPADE MOOCROMATICHE VIMAR DIMMERABII A 0 V~ MOOCHROME DIMMABE AMP VIMAR 0 V~ AMPE MOOCHROME VIMAR DIMMABE 0 V~ EUCHTE

Διαβάστε περισσότερα

Μεταβολισμός Βασικές Έννοιες

Μεταβολισμός Βασικές Έννοιες Μεταβολισμός Βασικές Έννοιες Αντικείμενο 1) το κύτταρο αντλεί ενέργεια (αναγωγική ισχύ) από το περιβάλλον του; 2) το κύτταρο συνθέτει τις δομικές μονάδες και τα μακρομόρια Περισσότερες από χίλιες αντιδράσεις

Διαβάστε περισσότερα

Ταξίδι Υγεία. Υγεία - Έκτακτο περιστατικό. Υγεία - Στο γιατρό. Necesito ir al hospital. Παράκληση για μεταφορά στο νοσοκομείο. Me siento mal.

Ταξίδι Υγεία. Υγεία - Έκτακτο περιστατικό. Υγεία - Στο γιατρό. Necesito ir al hospital. Παράκληση για μεταφορά στο νοσοκομείο. Me siento mal. - Έκτακτο περιστατικό Necesito ir al hospital. Παράκληση για μεταφορά στο νοσοκομείο Me siento mal. Necesito ver a un doctor inmediatamente! Παράκληση για άμεση γιατρική φροντίδα Ayuda! Έκκληση για άμεση

Διαβάστε περισσότερα

ΠΡΟΣ: ΚΟΙΝ.: συγκρότηση Επιτροπής για την επιλογή ελευθέρων βοηθηµάτων Ισπανικής γλώσσας


Διαβάστε περισσότερα


FORMULARIO DE ELASTICIDAD U. D. Resistencia de Mateiales, Elasticidad Plasticidad Depatamento de Mecánica de Medios Continuos Teoía de Estuctuas E.T.S. Ingenieos de Caminos, Canales Puetos Univesidad Politécnica de Madid FORMULARIO

Διαβάστε περισσότερα


DECLINACIÓN ATEMÁTICA (TERCERA DECLINACIÓN) Desinencias DECLINACIÓN ATEMÁTICA (TERCERA DECLINACIÓN) Desinencias M y F N M y F N N ς /alargamiento cero ες α V ς /alargamiento cero ες α A ν / α cero ας α G ος ων D ι σι (ν) Clasificación de los temas: - Temas

Διαβάστε περισσότερα

Académico Introducción

Académico Introducción - Σε αυτήν την εργασία/διατριβή θα αναλύσω/εξετάσω/διερευνήσω/αξιολογήσω... general para un ensayo/tesis In this essay/paper/thesis I shall examine/investigate/evaluate/analyze Για να απαντήσουμε αυτή

Διαβάστε περισσότερα

Negocios Carta. Carta - Dirección

Negocios Carta. Carta - Dirección - Dirección Mr. J. Rhodes Rhodes & Rhodes Corp. 212 Silverback Drive California Springs CA 92926 Mr. J. Rhodes Rhodes & Rhodes Corp. 212 Silverback Drive California Springs CA 92926 Formato de dirección

Διαβάστε περισσότερα

ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ Επιτροπή Γεωργίας και Ανάπτυξης της Υπαίθρου ΣΧΕ ΙΟ ΓΝΩΜΟ ΟΤΗΣΗΣ. της Επιτροπής Γεωργίας και Ανάπτυξης της Υπαίθρου

ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ Επιτροπή Γεωργίας και Ανάπτυξης της Υπαίθρου ΣΧΕ ΙΟ ΓΝΩΜΟ ΟΤΗΣΗΣ. της Επιτροπής Γεωργίας και Ανάπτυξης της Υπαίθρου ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ 2009-2014 Επιτροπή Γεωργίας και Ανάπτυξης της Υπαίθρου 21.10.2011 2011/0092(CNS) ΣΧΕ ΙΟ ΓΝΩΜΟ ΟΤΗΣΗΣ της Επιτροπής Γεωργίας και Ανάπτυξης της Υπαίθρου προς την Επιτροπή Οικονοµικής

Διαβάστε περισσότερα

Γλυκόζη. Ανασκόπηση μεταβολισμού υδατανθρακών ΗΠΑΡ. ΤΡΟΦΗ Γλυκόζη. Κυκλοφορία. Κυτταρόπλασμα ΓΛΥΚΟΓΟΝΟ. Οδός Φωσφ. Πεντοζών.

Γλυκόζη. Ανασκόπηση μεταβολισμού υδατανθρακών ΗΠΑΡ. ΤΡΟΦΗ Γλυκόζη. Κυκλοφορία. Κυτταρόπλασμα ΓΛΥΚΟΓΟΝΟ. Οδός Φωσφ. Πεντοζών. ΓΛΥΚΟΛΥΣΗ ΙΙ Ανασκόπηση μεταβολισμού υδατανθρακών ΗΠΑΡ ΤΡΟΦΗ Γλυκόζη Κυκλοφορία ΓΛΥΚΟΓΟΝΟ Γλυκόζη ΗΠΑΡ Κυτταρόπλασμα ΗΠΑΡ (Οξέωση) NADH ΟΞΕΙΔ. ΦΩΣΦ. ATP CO 2 Φρουκτόζη Γαλακτόζη 2ATP+2NADH Αναερόβια Γαλακτικό

Διαβάστε περισσότερα

Métodos Estadísticos en la Ingeniería

Métodos Estadísticos en la Ingeniería Métodos Estadísticos e la Igeiería INTERVALOS DE CONFIANZA Itervalo de cofiaza para la media µ de ua distribució ormal co variaza coocida: X ± z α/ µ = X = X i N µ X... X m.a.s. de X Nµ Itervalo de cofiaza

Διαβάστε περισσότερα

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς

Δοµή και ιδιότητες του DNA. 09/04/2014 1 Μοριακή Βιολογία Κεφ. 1 Καθηγητής Δρ. Κ. Ε. Βοργιάς Δοµή και ιδιότητες του DNA 09/04/2014 1 Ορίζεται η γραµµική αλληλουχία των 4 βάσεων damp, dcmp, dgmp, dtmp που είναι συνδεδεµένες µε 3-5 φωσφοδιεστερικό δεσµό. AGCTCGCGTCGCTCACTCTCTGCAT! TCGAGCGCAGCGAGTGAGAGACGTA!

Διαβάστε περισσότερα

ÁCIDOS CARBOXÍLICOS. Son ácidos orgánicos caracterizados por la presencia del grupo carboxilo. Hidrógeno ácido COOH COOH. carbonilo.

ÁCIDOS CARBOXÍLICOS. Son ácidos orgánicos caracterizados por la presencia del grupo carboxilo. Hidrógeno ácido COOH COOH. carbonilo. ÁIDS ABXÍLIS Son ácidos orgánicos caracterizados por la presencia del grupo carboxilo Ar carbonilo hidroxilo grupo carboxilo idrógeno ácido NMENLATUA DE LS ÁIDS ABXÍLIS (I) 1. Ácidos carboxílicos alifáticos

Διαβάστε περισσότερα


ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ ΕΥΡΩΠΑΪΚΟ ΚΟΙΝΟΒΟΥΛΙΟ 1999 2004 Επιτροπή Περιβάλλοντος, ηµόσιας Υγείας και Πολιτικής των Καταναλωτών 22 Ιουλίου 2002 PE 319.337/12-16 ΤΡΟΠΟΛΟΓΙΕΣ 12-16 Σχέδιο σύστασης για τη δεύτερη ανάγνωση (PE 319.337)

Διαβάστε περισσότερα

De la Base de Datos de Torneos de Chess-Results

De la Base de Datos de Torneos de Chess-Results De la Base de Datos de Torneos de Chess-Results http://chess-results.com ΟΜΑΔΙΚΟ ΚΥΠΕΛΛΟ ΑΤΤΙΚΗΣ «ΣΠΥΡΟΣ ΜΠΙΚΟΣ» 2013 Γ' ΟΜΙΛΟΣ Última actualización22.12.2013 19:27:10 Orden de fuerza de los equipos con

Διαβάστε περισσότερα


KIT DE DRENAJE DE CONDENSADOS KIT DE DRENAJE DE CONDENSADOS Estas instrucciones forman parte integrante del manual que acompaña el aparato en el cual está instalado este Kit. Este manual se refiere a ADVERTENCIAS GENERALES y REGLAS

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Εμπορική αλληλογραφία Επιστολή

Εμπορική αλληλογραφία Επιστολή - Διεύθυνση Sr. J. Rhodes Rhodes & Rhodes Corp. 212 Silverback Drive California Springs CA 92926 Sr. J. Rhodes Rhodes & Rhodes Corp. 212 Silverback Drive California Springs CA 92926 Αμερικανική γραφή διεύθυνσης:

Διαβάστε περισσότερα

ΠΑΓΚΟΣΜΙΑ ΗΜΕΡΑ ΑΣΟΠΟΝΙΑΣ. ασοπονία και αγορά προϊόντων ξύλου

ΠΑΓΚΟΣΜΙΑ ΗΜΕΡΑ ΑΣΟΠΟΝΙΑΣ. ασοπονία και αγορά προϊόντων ξύλου LOGO ΕΡΓΑΣΤΗΡΙΟ ΕΦΑΡΜΟΣΜΕΝΟΥ ΜΑΡΚΕΤΙΝΓΚ ΙΟΙΚΗΣΗΣ & ΟΙΚΟΝΟΜΙΑΣ ΠΑΓΚΟΣΜΙΑ ΗΜΕΡΑ ΑΣΟΠΟΝΙΑΣ ασοπονία και αγορά προϊόντων ξύλου ρ. ΠΑΠΑ ΟΠΟΥΛΟΣ ΙΩΑΝΝΗΣ Αναπληρωτής Καθηγητής ΤΕΙ Λάρισας E-mail: papad@teilar.gr

Διαβάστε περισσότερα

Taller de cultura TALLER DE LITERATURA

Taller de cultura TALLER DE LITERATURA Taller de cultura TALLER DE LITERATURA Literatura Argentina del s. XX Lo fantástico como elemento inherente a la literatura argentina del s. XX Qué es la literatura fantástica argentina? «Ya Buenos Aires,

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ. + HCO 3 c c c (1) - +


Διαβάστε περισσότερα

Εμπορική αλληλογραφία Ηλεκτρονική Αλληλογραφία

Εμπορική αλληλογραφία Ηλεκτρονική Αλληλογραφία - Εισαγωγή ελληνικά Αξιότιμε κύριε Πρόεδρε, ισπανικά Distinguido Sr. Presidente: Εξαιρετικά επίσημη επιστολή, ο παραλήπτης έχει ένα ειδικό τίτλο ο οποίος πρέπει να χρησιμοποιηθεί αντί του ονόματος του

Διαβάστε περισσότερα

LESET Let ssaveenergytogether (Ας Εξοικονομήσουμε Μαζί Ενέργεια) (GR)

LESET Let ssaveenergytogether (Ας Εξοικονομήσουμε Μαζί Ενέργεια) (GR) LESET Let ssaveenergytogether (Ας Εξοικονομήσουμε Μαζί Ενέργεια) (GR) Información general Resumen Το LESET έργο ήταν πολύ επιτυχημένο. Οι συμμετέχοντες, μαθητές μεταξύ 15 και 16 ετών, από 5 διαφορετικές

Διαβάστε περισσότερα

%!$ ' ( ' () * + + * + * + . / -

%!$ ' ( ' () * + + * + * + . / - !"#$ %!$ & ' ' ) * + + * + * +,. -!" ) * + + * + * - ' - +, -,* - ' - + = * 0 ' & + #' $ θ θ% &'!θ #! θ + θ&θ!" ) *'+,1* θ +' * θ+ ' ' = 1 - ' - ') * - ' - +, - * - + * θ + ' - + * θ + + * - ' - + ' 3.!

Διαβάστε περισσότερα

bab.la Φράσεις: Προσωπική Αλληλογραφία Ευχές ελληνικά-ισπανικά

bab.la Φράσεις: Προσωπική Αλληλογραφία Ευχές ελληνικά-ισπανικά Ευχές : Γάμος Συγχαρητήρια. Σας ευχόμαστε όλη την ευτυχία του κόσμου. Felicitaciones. Les deseamos a ambos toda la felicidad del mundo. νιόπαντρο ζευγάρι Θερμά συγχαρητήρια για τους δυο σας αυτήν την ημέρα

Διαβάστε περισσότερα


FUNCIONES Y FÓRMULAS TRIGONOMÉTRICAS 5 FUNCIONES Y FÓRMULAS TRIGONOMÉTRICAS Página PARA EMPEZAR, REFLEXIONA Y RESUELVE. Aunque el método para resolver las siguientes preguntas se sistematiza en la página siguiente, puedes resolverlas ahora:

Διαβάστε περισσότερα


EL ARTÍCULO PRIMERA DECLINACIÓN FEMENINOS EL ARTÍCULO Masculino Femenino Neutro Nominativo ὁ ἡ τό Acusativo τόν τήν τό Genitivo τοῦ τῆς τοῦ Dativo τῷ τῇ τῷ Nominativo οἱ αἱ τά Acusativo τούς τάς τά Genitivo τῶν τῶν τῶν Dativo τοῖς ταῖς τοῖς PRIMERA

Διαβάστε περισσότερα



Διαβάστε περισσότερα

MATRICES DE TRANSFORMACION DE COORDENADAS. 3D. ü INCLUDES. ü Cálculo de las componentes de la Matriz de rotación de tensiones (3-3)

MATRICES DE TRANSFORMACION DE COORDENADAS. 3D. ü INCLUDES. ü Cálculo de las componentes de la Matriz de rotación de tensiones (3-3) MATRICES DE TRANSFORMACION DE COORDENADAS. 3D ü INCLUDES In[298]:= In[301]:= In[302]:= In[303]:= Off@General::"spell"D; Off@General::"spell1"D; Off@Set::"wrsm"D; Needs@"LnearAlgebra`MatrxManpulaton`"D

Διαβάστε περισσότερα

De la Base de Datos de Torneos de Chess-Results

De la Base de Datos de Torneos de Chess-Results De la Base de Datos de Torneos de Chess-Results http://chess-results.com Διασυλλογικό Πρωτάθλημα Ε.Σ.Σ.ΠΕ.Π. 2010 Última actualización21.02.2010 19:47:18 Orden de fuerza de los equipos con resultados ronda

Διαβάστε περισσότερα

Επιτυχόντες 2001-2002

Επιτυχόντες 2001-2002 Επιτυχόντες 2001-2002 1 Λακιωτάκη Ελευθερία Ηλεκτρολόγων Μηχ. & Μηχ. Υπολογιστών Θεσσαλονίκης 2 Τραχανατζή Ειρήνη Ιατρικής Κρήτης 3 Λιόλιου Παναγιώτα Οδοντιατρικής Θεσσαλονίκης 4 Μπλαζάκης Κωνσταντίνος

Διαβάστε περισσότερα

PROTEÍNAS. 8. Que é un aminoácido?

PROTEÍNAS. 8. Que é un aminoácido? PROTEÍNAS 1. Indique a natureza química, a función e ónde se atopan en maior abundancia as seguintes moléculas: glicóxeno, fosfolípidos, colesterol e queratina 2. En relación ás seguintes macromoléculas:

Διαβάστε περισσότερα

De la Base de Datos de Torneos de Chess-Results

De la Base de Datos de Torneos de Chess-Results De la Base de Datos de Torneos de Chess-Results http://chess-results.com Διασυλλογικό Πρωτάθλημα Ε.Σ.Σ.ΠΕ.Π. 2010 Última actualización21.02.2010 19:47:18 Orden de fuerza de los equipos con resultados ronda

Διαβάστε περισσότερα



Διαβάστε περισσότερα

www.absolualarme.com met la disposition du public, via www.docalarme.com, de la documentation technique dont les rιfιrences, marques et logos, sont

www.absolualarme.com met la disposition du public, via www.docalarme.com, de la documentation technique dont les rιfιrences, marques et logos, sont w. ww lua so ab me lar m.co t me la sit po dis ion du c, bli pu via lar ca do w. ww me.co m, de la ion nta t do cu me on t ed hn iqu tec les en ce s, rι fιr ma rq ue se t lo go s, so nt la pr op riι tι

Διαβάστε περισσότερα

LIPIDOS. Ácidos grasos saturados más comunes.

LIPIDOS. Ácidos grasos saturados más comunes. LIPIDOS Ácidos grasos saturados más comunes. 4C butírico 5 valerico 6 caproico 7 enántico 8 caprilico 9 nonanoico 10 caprico 12 laurico 14 miristico 15 pentadecanoico 16 palmitico 17 margárico 18 esteárico

Διαβάστε περισσότερα

Palabra derivada de glicosa pois se pensaba que tódolos glícidos procedian desta. As biomoléculas máis abundantes da natureza

Palabra derivada de glicosa pois se pensaba que tódolos glícidos procedian desta. As biomoléculas máis abundantes da natureza Palabra derivada de glicosa pois se pensaba que tódolos glícidos procedian desta. As biomoléculas máis abundantes da natureza GLÍCIDOS : características xerais Biomoléculas formadas por C, H y O, en una

Διαβάστε περισσότερα



Διαβάστε περισσότερα


AMORTIGUADORES DE VIBRACIÓN AMORTIGUADORES DE VIBRACIÓN Estas instrucciones forman parte integrante del manual que acompaña el aparato en el cual se va a instalar este accesorio. Este manual se refiere a ADVERTENCIAS GENERALES y

Διαβάστε περισσότερα

ΚΑΙΝΟΤΟΜΙΑ ΚΑΙ ΑΠΛΟΤΗΤΑ. Innovación y simplicidad

ΚΑΙΝΟΤΟΜΙΑ ΚΑΙ ΑΠΛΟΤΗΤΑ. Innovación y simplicidad pro ima pro ima Innovación y simplicidad PROXIMA es la última innovación de Serrature Meroni, un producto diseñado tanto para aquellos que ya disponen de un pomo PremiApri Meroni en su puerta, como para

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πληροφόρηση σχετικά με το αν πρέπει να πληρώσετε ποσοστά προμήθειας όταν κάνετε ανάληψη σε μια συγκεκριμένη χώρα

Πληροφόρηση σχετικά με το αν πρέπει να πληρώσετε ποσοστά προμήθειας όταν κάνετε ανάληψη σε μια συγκεκριμένη χώρα - Γενικά Can I withdraw money in [country] without paying fees? Puedo sacar dinero en (país) sin pagar comisiones? Πληροφόρηση σχετικά με το αν πρέπει να πληρώσετε ποσοστά προμήθειας όταν κάνετε ανάληψη

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Γενικό ποσοστό συμμετοχής στην αγορά εργασίας πληθυσμού χρονών - σύνολο

Γενικό ποσοστό συμμετοχής στην αγορά εργασίας πληθυσμού χρονών - σύνολο πληθυσμού 15-64 χρονών - σύνολο Περιγραφή δείκτη και πηγή πληροφοριών Το γενικό ποσοστό συμμετοχής στην αγορά εργασίας πληθυσμού 15-64 χρονών υπολογίζεται με τη διαίρεση του αριθμού του οικονομικά ενεργού

Διαβάστε περισσότερα


ΕΠΙΤΡΟΠΗ ΤΩΝ ΕΥΡΩΠΑΪΚΩΝ ΚΟΙΝΟΤΗΤΩΝ ΕΠΙΤΡΟΠΗ ΤΩΝ ΕΥΡΩΠΑΪΚΩΝ ΚΟΙΝΟΤΗΤΩΝ Βρυξέλλες, 5.9.2005 COM(2005) 405 τελικό ΑΝΑΚΟΙΝΩΣΗ ΤΗΣ ΕΠΙΤΡΟΠΉΣ στο Συµβούλιο, το Ευρωπαϊκό Κοινοβούλιο, την Ευρωπαϊκή Οικονοµική και Κοινωνική Επιτροπή και την Επιτροπή

Διαβάστε περισσότερα

TEMA DE PRESENTE. *βάλ-y-ω > βάλλω, *θιλέ-y-ω > θιλέω, *πρακ-y-ω > πράηηω, etc. ὀθλι-ζκ-άν-ω, etc.

TEMA DE PRESENTE. *βάλ-y-ω > βάλλω, *θιλέ-y-ω > θιλέω, *πρακ-y-ω > πράηηω, etc. ὀθλι-ζκ-άν-ω, etc. TEMA DE PRESENTE. El tema de presente se considera el tema básico u originario del verbo griego. Aunque realmente esto no es exacto, pues aunque el resto de temas en muchas ocasiones, cuando se consideran

Διαβάστε περισσότερα

Γενικός ρυθμός μεταβολής οικονομικά ενεργού πληθυσμού χρονών - σύνολο

Γενικός ρυθμός μεταβολής οικονομικά ενεργού πληθυσμού χρονών - σύνολο 15-64 χρονών - σύνολο Περιγραφή δείκτη και πηγή πληροφοριών Ο γενικός ρυθμός μεταβολής οικονομικά ενεργού πληθυσμού 15-64 χρονών υπολογίζεται με τη διαίρεση της ετήσιας αύξησης του οικονομικά ενεργού πληθυσμού

Διαβάστε περισσότερα

Τεχνικές του δράματος και Διδακτική των ζωντανών γλωσσών. Η συμβολή τους στη διαμόρφωση διαπολιτισμικής συνείδησης

Τεχνικές του δράματος και Διδακτική των ζωντανών γλωσσών. Η συμβολή τους στη διαμόρφωση διαπολιτισμικής συνείδησης Αντώνης Χασάπης 839 Αντώνης Χασάπης Εκπαιδευτικός, Μεταπτυχιακός ΠΔΜ, Ελλάδα Résumé Dans le domaine de la didactique des langues vivantes l intérêt de la recherche scientifique se tourne vers le développement

Διαβάστε περισσότερα

Θέμα/Αντικείμενο: Δομή και λειτουργίες των φύλλων.

Θέμα/Αντικείμενο: Δομή και λειτουργίες των φύλλων. FL/STEM Σχεδιασμός/Πρότυπο μαθήματος / Βαρσοβία 2882015 Μάθημα (τίτλος) EEstructura y características de las hojas. Επίπεδο επάρκειας γλώσσας A1 A2 B1 B2 C1 Τάξη/βαθμίδα: 5η Αριθμός μαθητών στην τάξη:

Διαβάστε περισσότερα

Γενικό ποσοστό απασχόλησης ισοδύναμου πλήρως απασχολούμενου πληθυσμού - σύνολο

Γενικό ποσοστό απασχόλησης ισοδύναμου πλήρως απασχολούμενου πληθυσμού - σύνολο απασχολούμενου πληθυσμού - σύνολο Περιγραφή δείκτη και πηγή πληροφοριών Το γενικό ποσοστό απασχόλησης ισοδύναμου πλήρως απασχολούμενου πληθυσμού υπολογίζεται με τη διαίρεση του αριθμού του ισοδύναμου πλήρως

Διαβάστε περισσότερα


ACTIVIDADES INICIALES Solucionario Trigonometría ACTIVIDADES INICIALES.I. En una recta r hay tres puntos: A, B y C, que distan, sucesivamente, y cm. Por esos puntos se trazan rectas paralelas que cortan otra, s, en M, N y P.

Διαβάστε περισσότερα



Διαβάστε περισσότερα