Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:



1 ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν κανονικά δάχτυλα. Η μητέρα της Ιωάννας έχει κανονικό δάχτυλα και ο πατέρας της βραχυδαχτυλία. Η γιαγιά της από τον πατέρα της έχει βραχυδαχτυλία και ο παππούς της που δεν ζει είχε κανονικά δάχτυλα. Και οι δύο γονείς της μητέρας της είχαν κανονικά δάχτυλα. Η Ιωάννα παντρεύτηκε τον Γιάννη και έκαναν 2 γιούς με κανονικά δάχτυλα και μια κόρη με βραχυδαχτυλία. α. Να σχηματίσετε το γενεαλογικό δένδρο και να δείξετε τον τύπο κληρονομικότητας της συγκεκριμένης ασθένειας. β. Ποια είναι η πιθανότητα η Ιωάννα και ο Γιάννης να κάνουν και 2 η κόρη με βραχυδαχτυλία; α. Αυτοσωμικό επικρατές β. Έστω Β=βραχυδαχτυλία, β=φυσιολογικό, όπου Β>β Γιάννης: ββ, Ιωάννα: Ββ P= 1/2 1/2 =1/4 2. Ένα ζευγάρι σκοπεύει να αποκτήσει παιδιά, αλλά συμβουλεύεται έναν γενετικό σύμβουλο διότι ο άντρας έχει μια αδερφή με PKU (φαινυλκετονουρία) και η γυναίκα έχει έναν αδερφό με PKU. Εκτός από αυτούς δεν υπάρχουν άλλα γνωστά άτομα στις οικογένειές τους με PKU. Ζήτησαν από το γενετικό σύμβουλο να προσδιορίσει την πιθανότητα το πρώτο τους παιδί να έχει PKU. Ποια είναι αυτή η πιθανότητα; Η PKU (φαινυλκετονουρία) οφείλεται σε υπολειπόμενο αυτοσωμικό γονίδιο. Έστω Φ= φυσιολογικό, φ= φαινυλκετονουρία, όπου Φ>φ Εφόσον έχουν αδέλφια που φέρουν την ασθένεια αυτό σημαίνει ότι οι γονείς τους είναι ετερόζυγοι. Οι ίδιοι είναι φυσιολογικοί και μπορεί να έχουν γονότυπο Φφ (P=2/3) 1

2 ή ΦΦ (P=1/3). Για να γεννηθεί παιδί με την ασθένεια θα πρέπει και οι 2 γονείς να είναι ετερόζυγοι. Φφ Χ Φφ Γαμέτες: Φ, φ Φ, φ F1: ΦΦ, Φφ, Φφ, φφ 3/4 φυσιολογικά 1/4 φαινυλκετονουρία Άρα η πιθανότητα να αποκτήσουν παιδί με την ασθένεια είναι: P=2/3 2/3 1/4=4/36=1/9 3. Μια σπάνια ανθρώπινη ασθένεια έπληξε μια οικογένεια και αυτή απεικονίζεται στο παρακάτω γενεαλογικό δέντρο. α. Να προσδιορίστε τον πιο πιθανό τύπο κληρονομικότητας. β. Ποιοι θα μπορούσαν να είναι οι απόγονοι από τους γάμους μεταξύ των ξαδέρφων V1 Χ V9, V1 Χ V4, και V2 Χ V8; α. Δεν είναι φυλοσύνδετο υπολειπόμενο γονίδιο γιατί πατέρας χωρίς την ιδιότητα (ΙΙΙ9) έχει κόρη με την ιδιότητα αυτή (ΙV3). Θα μπορούσε, αλλά δεν είναι αυτοσωμικό υπολειπόμενο γονίδιο γιατί εμφανίζεται σε κάθε γενιά σε σημαντικό αριθμό απογόνων, ενώ θα έπρεπε και τα άτομα που παντρεύονται ασθενή άτομα να είναι ετερόζυγα, πράγμα αδύνατο λόγω σπανιότητας της ασθένειας. Το πιο πιθανό να είναι επικρατές φυλοσύνδετο γιατί: - Εμφανίζεται σε κάθε γενιά και σε σημαντικό αριθμό ατόμων - Εμφανίζονται πολύ περισσότερα θηλυκά άτομα με το χαρακτηριστικό - Μεταφέρεται μόνο από τον πατέρα στην κόρη, ενώ αν ήταν αυτοσωμικό θα έπρεπε να μεταφέρεται και από τον πατέρα στο γιό β. Έστω Χ Α =γονίδιο της ασθένειας, Χ α =φυσιολογικός, όπου Χ Α >Χ α Γονότυποι V1: Χ Α Χ α, V2: Χ α Υ, V4: Χ α Υ, V8: Χ α Χ α, V9: Χ Α Υ Χ Α Χ Α, ασθενής V1 Χ V9 Χ Α Χ α Χ Α Υ Χ Α, Χ α Χ Α, Υ Χ Α Χ α, ασθενής Χ Α Υ, ασθενής Χ α Υ φυσιολογικό 2

3 Χ Α Χ α, ασθενής V1 Χ V4 Χ Α Χ α Χ α Υ Χ Α, Χ α Χ α, Υ Χ α Χ α, φυσιολογικό Χ Α Υ, ασθενής Χ α Υ φυσιολογικό V2 Χ V8 Χ α Υ Χ α Χ α Χ α, Υ Χ α Χ α Χ α, Χ α Υ όλοι οι απόγονοι φυσιολογικοί 4. Το παρακάτω δένδρο δείχνει τον τρόπο κληρονόμησης της νόσου Huntington. Ποια περίπτωση γονιδίου μπορεί να υποστηριχθεί ότι ελέγχει το συγκεκριμένο χαρακτηριστικό; α. Αυτοσωμικό επικρατές; β. Αυτοσωμικό υπολειπόμενο; γ. Φυλοσύνδετο επικρατές; δ. Φυλοσύνδετο υπολειπόμενο; - Δεν είναι φυλοσύνδετο επικρατές γιατί άνδρας με το γνώρισμα (Ι1) αποκτά κόρη χωρίς το γνώρισμα (ΙΙ2) - Δεν είναι φυλοσύνδετο υπολειπόμενο γιατί άνδρας χωρίς το γνώρισμα (ΙΙ7) αποκτά κόρη με το γνώρισμα (ΙΙΙ10) - Θεωρητικά θα μπορούσε να είναι αυτοσωμικό υπολειπόμενο. Όμως ουσιαστικά κάτι τέτοιο δεν ισχύει γιατί αφενός δε θα εμφανιζόταν σε κάθε γενιά και σε πολλά άτομα και αφετέρου τα φυσιολογικά άτομα που παντρεύονται με ασθενή άτομα θα έπρεπε όλα να είναι ετερόζυγα, γεγονός πρακτικά αδύνατο λόγω της σπανιότητας της ασθένειας. Είναι αυτοσωμικό επικρατές γιατί: - Εμφανίζεται σε κάθε γενιά. - Κάθε ασθενές άτομο έχει ασθενή γονέα και η αναλογία θηλυκών και αρσενικών με το γνώρισμα είναι περίπου 1 : 1 5. Το παρακάτω δένδρο δείχνει τον τρόπο κληρονόμησης της μυϊκής δυστροφία Duchenne. Ποια περίπτωση γονιδίου μπορεί να υποστηριχθεί ότι ελέγχει το συγκεκριμένο χαρακτηριστικό; α. Αυτοσωμικό επικρατές; β. Αυτοσωμικό υπολειπόμενο; γ. Φυλοσύνδετο επικρατές; δ. Φυλοσύνδετο υπολειπόμενο; 3

4 Το γονίδιο είναι υπολειπόμενο γιατί από άτομα που δεν πάσχουν (Ι1 και Ι2) γεννιέται απόγονος που πάσχει (ΙΙ1). - Θεωρητικά μπορεί, αλλά ουσιαστικά δε γίνεται να είναι αυτοσωμικό υπολειπόμενο επειδή θα έπρεπε και τα κορίτσια να εμφανίζουν την ασθένεια και όχι μόνο τα αγόρια. Επίσης τα φυσιολογικά άτομα που παντρεύονται με ασθενή άτομα θα έπρεπε όλα να είναι ετερόζυγα, γεγονός πρακτικά αδύνατο λόγω της σπανιότητας της ασθένειας. - Είναι φυλοσύνδετο υπολειπόμενο γιατί εμφανίζεται σε αγόρια και μεταβιβάζεται από τον παππού (ΙΙ6) στη μητέρα (ΙΙΙ9-ετερόζυγη φυσιολογική) και από εκεί στον εγγονό (IV9) 6. Το παρακάτω γενεαλογικό δένδρο απεικονίζει μια από τις ασθένειες: έλλειψη της απαμινάσης της αδενοσίνης (ADA), οικογενή υπερχοληστερολαιμία και δαλτωνισμό. α. Να προσδιορίσετε ποια είναι η ασθένεια. β. Να γράψετε τους γονότυπους των γονέων γ. Ποια η πιθανότητα από τα άτομα II3 και II4 να γεννηθεί παιδί με την ασθένεια; δ. Ποια η πιθανότητα από τα άτομα II1 και II2 να γεννηθούν 2 αγόρια με την ασθένεια; ε. Εάν το κορίτσι II6 παντρευτεί με άτομο που φέρει την ασθένεια ποια η πιθανότητα να αποκτήσουν κορίτσι με την ασθένεια; α. - Δεν είναι φυλοσύνδετο υπολειπόμενο γιατί γυναίκα με την ιδιότητα (ΙΙ8) έχει γιο χωρίς την ιδιότητα (ΙΙΙ7) - Δεν είναι φυλοσύνδετο επικρατές γιατί γυναίκα που δεν έχει την ιδιότητα (Ι2) αποκτά γιο με την ιδιότητα (ΙΙ1) - Θεωρητικά θα μπορούσε να είναι αυτοσωμικό υπολειπόμενο. Όμως ουσιαστικά κάτι τέτοιο δεν ισχύει γιατί δε θα εμφανιζόταν σε κάθε γενιά με τέτοια συχνότητα στους 4

5 απογόνους, ενώ θα έπρεπε και τα φυσιολογικά άτομα που παντρεύονται με ασθενή να είναι όλα ετερόζυγα, γεγονός πρακτικά αδύνατο λόγω της σπανιότητας της ασθένειας. - Είναι αυτοσωμικό επικρατές δηλαδή είναι η οικογενής υπερχοληστερολαιμία επειδή εμφανίζεται σε κάθε γενιά, σε ένα σημαντικό αριθμό απογόνων, σε ίση περίπου αναλογία αρσενικών-θηλυκών, ενώ κάθε ασθενής έχει και έναν γονέα ασθενή. β. Έστω Υ=οικογενής υπερχοληστερολαιμία, υ=φυσιολογικό, όπου Υ>υ Γονότυποι Ι1, ΙΙ1, ΙΙ5, ΙΙ8, ΙΙΙ1, ΙΙΙ6, ΙΙΙ8: Υυ Όλα τα υπόλοιπα άτομα: υυ γ. P=0 δ. P= (1/2 1/2) (1/2 1/2)= 1/16 1 ο αγόρι 2 ο αγόρι ε. Το άτομο με την ασθένεια έχει γονότυπους: Υυ (1/2) ή ΥΥ (1/2) Διακρίνουμε δύο περιπτώσεις. 1 η περίπτωση: υυ Χ ΥΥ Γαμέτες υ Υ Υυ P 1 =1/2 1/2 1=1/4 2 η περίπτωση: υυ Χ Υυ υ Υ, υ Υυ, υυ P 2 =1/2 1/2 1/2=1/8 Άρα Pολ= P 1 +P 2 =1/4+1/8=2/8+1/8=3/8 7. Το παρακάτω γενεαλογικό δένδρο απεικονίζει μια σπάνια ανθρώπινη ασθένεια. α. Να προσδιορίστε τον πιο πιθανό τύπο κληρονομικότητας. β. Να γράψετε τους γονότυπους των ατόμων. γ. Ποια η πιθανότητα τα άτομα II3 και II4 να αποκτήσουν κόρη με την ασθένεια; δ. Ποια η πιθανότητα τα επόμενα 2 παιδιά των II3 και II4 να είναι αγόρια και να μην εμφανίζουν την ασθένεια; ε. Εάν το άτομο II5 παντρευτεί με άνδρα ασθενή ποια είναι η πιθανότητα τα τρία πρώτα τους παιδιά να είναι φυσιολογικά; α. Η ασθένεια οφείλεται σε υπολειπόμενο γονίδιο γιατί από άτομα φυσιολογικά Ι3 Χ Ι4 γεννιέται άτομο ασθενές (ΙΙ4). Θα μπορούσε να είναι αυτοσωμικό υπολειπόμενο, όμως δεν είναι γιατί εμφανίζεται μόνο στα αρσενικά (θα έπρεπε να εμφανίζεται και στα θηλυκά). Επίσης θα έπρεπε, αν ήταν αυτοσωμικό υπολειπόμενο, τα άτομα που παντρεύονται να είναι όλα ετερόζυγα, γεγονός πρακτικά αδύνατο λόγω της σπανιότητας της ασθένειας. Η ασθένεια οφείλεται σε φυλοσύνδετο υπολειπόμενο γονίδιο γιατί μεταφέρεται από τον παππού (Ι1) στην κόρη (ΙΙ3-ετερόζυγη φυσιολογική) και στη συνέχεια στον εγγονό (ΙΙΙ1). β. Έστω Χ Α =φυσιολογικό, Χ α =ασθένεια, όπου Χ Α >Χ α Γονότυποι Ι1, ΙΙ4, ΙΙΙ1: Χ α Υ 5

6 Ι3: Χ Α Υ Ι4: Χ Α Χ α Ι2: Χ Α Χ α ή Χ Α Χ Α ΙΙ1: Χ Α Υ ΙΙ2, ΙΙ3: Χ Α Χ α ΙΙ5, ΙΙ6: Χ Α Χ Α ή Χ Α Χ α γ. P=1/4 δ. P= 1/4 1/4= 1/16 ε. Το άτομο ΙΙ5 μπορεί να έχει γονότυπο: Χ Α Χ Α (1/2) ή Χ Α Χ α (1/2) Διακρίνουμε δύο περιπτώσεις. 1 η περίπτωση: Χ Α Χ Α Χ Χ α Υ P 1 =1/2 1=1/2 2 η περίπτωση: Χ Α Χ α Χ Χ α Υ P 2 =1/2 1/2 =1/4 Άρα Pολ= P 1 +P 2 =1/2+1/4=2/4+1/4=3/4 Οπότε για τα 3 πρώτα παιδιά θα ισχύει: P=3/4 3/4 3/4 =27/64 8. Το παρακάτω γενεαλογικό δένδρο απεικονίζει μια σπάνια ανθρώπινη ασθένεια. α. Να προσδιορίστε τον πιο πιθανό τύπο κληρονομικότητας. β. Να γράψετε τους γονότυπους των ατόμων. γ. Ποια η πιθανότητα τα άτομα III3 και III4 να αποκτήσουν κόρη με την ασθένεια; δ. Ποια η πιθανότητα τα άτομα III3 και III4 να αποκτήσουν πρώτα 2 γιους χωρίς την ασθένεια και στη συνέχεια μία κόρη με την ασθένεια; ε. Ποια η πιθανότητα τα άτομα II1 και II2 να αποκτήσουν παιδί με την ασθένεια; α. - Είναι υπολειπόμενο το γονίδιο που ελέγχει την ασθένεια αφού από άτομα υγιή (Ι1 και Ι2) γεννιούνται άτομα με ασθένεια (ΙΙ3). - Δεν είναι φυλοσύνδετο υπολειπόμενο, αφού πατέρας υγιής (Ι1) αποκτά κόρη με την ασθένεια (ΙΙ3). Άρα είναι αυτοσωμικό υπολειπόμενο. β. Έστω Α=φυσιολογικό, α=ασθένεια, όπου Α>α Ι1 και Ι2: Αα ΙΙ3 και IV2: αα ΙΙ1, ΙΙ2, ΙΙ4, ΙΙ5: ΑΑ ή Αα ΙΙΙ1, ΙΙΙ2, ΙΙΙ5: ΑΑ ή Αα ΙΙΙ3, ΙΙΙ4: Αα ΙV1, ΙV3, ΙV4: ΑΑ ή Αα γ. P=1/2 1/4 =1/8 δ. Για τον κάθε γιο η πιθανότητα είναι P=3/4 1/2 =3/8 Για την κόρη η πιθανότητα είναι P=1/4 1/2 =1/8 Η σειρά είναι γιος-γιος-κόρη=3/8 3/8 1/8=9/512 ε. Για να αποκτήσουν τα άτομα II1 και II2 παιδί με ασθένεια θα πρέπει να είναι ετερόζυγα. Οι γονείς του II2 είναι ετερόζυγοι, οπότε η πιθανότητα το άτομο αυτό να 6

7 ΟΜΑΔΑ Β είναι ετερόζυγο είναι 2/3. Η πιθανότητα το άτομο II1 να είναι ετερόζυγο είναι 1/2. Η πιθανότητα από 2 ετερόζυγα άτομα να γεννηθεί παιδί με ασθένεια είναι 1/4. Άρα συνολικά P=2/3 1/2 1/4=2/24=1/ Ο Γιάννης και η Μάρθα εξετάζουν το ενδεχόμενο να κάνουν παιδιά, αλλά ο Γιάννης έχει ένα αδερφό που έχει γαλακτοζαιμία και η προγιαγιά της Μάρθας είχε επίσης γαλακτοζαιμία. Η αδελφή της Μάρθας έχει τρία παιδιά και κανένα δεν έχει γαλακτοζαιμία. α. Να κατασκευαστεί το γενεαλογικό δένδρο και να βρείτε ποιος είναι ο πιο πιθανός τύπος κληρονομικότητας που ακολουθεί η ασθένεια. β. Ποιοι είναι οι πιθανοί γονότυποι των ατόμων; γ. Ποια η πιθανότητα το πρώτο παιδί του Γιάννη και της Μάρθας να έχει γαλακτοζαιμία; α. Κατασκευάζεται το γενεαλογικό δέντρο: Αυτοσωμικά υπολειπόμενα. Έστω Γ=φυσιολογιικό, γ=γαλακτοζαιμία, όπου Γ>γ β. Ι1: Γγ ή ΓΓ Ι2: γγ ΙΙ1, ΙΙ2, ΙΙ3, ΙΙ4: Γγ ΙΙΙ1: γγ ΙΙΙ2, ΙΙΙ3, ΙΙΙ4, ΙΙΙ5: ΓΓ ή Γγ ΙV1, IV2, IV3: Γγ ή ΓΓ γ. Γαλακτοζαιμία μπορεί να έχει το παιδί μόνο όταν οι γονείς είναι ετερόζυγοι, δηλαδή Γγ 2/3 Γγ Χ Γγ 2/3 Γ, γ Γ, γ ΓΓ, Γγ, Γγ, γγ 1/4 Άρα P=2/3 2/3 1/4 =1/9 10. Άνδρας με προσκολλημένους λοβούς των αυτιών παντρεύεται γυναίκα αιμορροφιλική και αποκτούν μια κόρη φυσιολογική, μια κόρη με προσκολλημένους λοβούς και έναν γιο. Ο γιος παντρεύεται γυναίκα που είναι φορέας και των 2 ασθενειών και αποκτούν κορίτσι που είναι φυσιολογικό. α. Να κατασκευαστούν τα γενεαλογικά δένδρα. β. Ποιοι είναι οι πιθανοί γονότυποι των ατόμων; γ. Ποια η πιθανότητα να αποκτήσουν αγόρι που είναι αιμορροφιλικό με προσκολλημένους λοβούς; Έστω Ε=ελεύθεροι λοβοί, ε=προσκολλημένοι, όπου Ε>ε και Χ Α =φυσιολογικός, Χ α =αιμορροφιλία, όπου Χ Α >Χ α α 1. Για τους λοβούς κατασκευάζεται: 7

8 το 1 ο δέντρο ή 2 ο το δέντρο β 1. Για τους λοβούς οι πιθανοί γονότυποι είναι: Πρώτο δέντρο Δεύτερο δέντρο Ι1: εε, Ι2: Εε Ι1: εε, Ι2: Εε ΙΙ1:Εε, ΙΙ2: εε, ΙΙ3: εε, ΙΙ4: Εε ΙΙ1:Εε, ΙΙ2: εε, ΙΙ3: Εε, ΙΙ4: Εε ΙΙΙ1: Εε ΙΙΙ1: Εε ή ΕΕ Επειδή η άσκηση δεν αναφέρεται σε ασθένεια του γιού θεωρούμε για το συγκεκριμένο χαρακτηριστικό ότι μπορεί να έχει δύο γονότυπους Εε (ελεύθεροι λοβοί) ή εε (προσκολλημένοι λοβοί). Από τη διασταύρωση των γονέων του (Εε Χ εε) προκύπτει ότι ο κάθε ένας από τους 2 αυτούς γονότυπους έχει πιθανότητα εμφάνισης 1/2. 8

9 α 2. Για την αιμορροφιλία κατασκευάζεται το δέντρο β 2. Για την αιμορροφιλία οι πιθανοί γονότυποι είναι: Ι1: Χ Α Υ, Ι2: Χ α Χ α ΙΙ1: Χ Α Χ α, ΙΙ2:Χ Α Χ α, ΙΙ3: Χ α Υ, ΙΙ4: Χ Α Χ α ΙΙΙ1: Χ Α Χ α γ. Δύο είναι οι πιθανές διασταυρώσεις: 1 η περίπτωση: Χ α Υεε(1/2) Χ Χ Α Χ α Εε P 1 =1/8 1/2=1/16 2 η περίπτωση: Χ α ΥEε(1/2) Χ Χ Α Χ α Εε P 2 =1/16 1/2=1/32 Άρα Pολ= P 1 +P 2 =1/16+1/32=2/32+1/32=3/ Το ακόλουθο γενεαλογικό δέντρο δείχνει τον τύπο μεταβίβασης δύο σπάνιων φαινότυπων του ανθρώπου: του καταρράκτη και μιας μορφής νανισμού. Τα μέλη της οικογένειας με καταρράκτη απεικονίζονται με σκιασμένο το αριστερό μισό του συμβόλου, ενώ αυτά με νανισμό με σκιασμένο το δεξί μισό του συμβόλου. α. Ποιος είναι ο πιο πιθανός τύπος κληρονομικότητας κάθε φαινοτύπου; β. Αν υποθετικά παντρευτούν το άτομο IV-1 με το IV-5 ποια η πιθανότητα το πρώτο τους παιδί να είναι νάνος με καταρράκτη; Για τον καταρράκτη α. - Είναι επικρατές [από άτομα με καταρράκτη (ΙΙΙ5 και ΙΙΙ6) γεννιέται απόγονος χωρίς καταρράκτη (IV4)]. - Δεν είναι φυλοσύνδετο [άνδρας με καταρράκτη (ΙΙ4) έχει κόρη χωρίς με καταρράκτη (ΙΙΙ2)]. Άρα ο καταρράκτης είναι αυτοσωμικό επικρατές χαρακτηριστικό. 9

10 Για το νανισμό: - Είναι υπολειπόμενο [από άτομα φυσιολογικά (ΙΙ6 και ΙΙ7) γεννιέται απόγονος με νανισμό (ΙΙI9)]. - Δεν είναι φυλοσύνδετο [άνδρας φυσιολογικός (ΙΙΙ6) έχει κόρη με νανισμό (ΙV6)]. Άρα ο νανισμός είναι αυτοσωμικό υπολειπόμενο χαρακτηριστικό. β. Κ=καταρράκτης, κ=φυσιολογικό, όπου Κ>κ Ν=φυσιολογικό, ν=νανισμός, όπου Ν>ν Άτομο ΙV1: δεν έχει καταρράκτη και έχει νανισμό. Άρα κκνν Άτομο ΙV5: έχει καταρράκτη και δεν έχει νανισμό. Άρα οι πιθανοί γονότυποι είναι: ΚΚΝΝ, ΚΚΝν, ΚκΝΝ, ΚκΝν. Επειδή όμως το παιδί είναι νάνος με καταρράκτη θα έχει γονότυπο ΚΚνν ή Κκνν, αυτό σημαίνει ότι το άτομο ΙV5 μπορεί να έχει γονότυπους: ΚΚΝν ή ΚκΝν. Και οι δύο γονείς του ατόμου ΙV5 είναι ετερόζυγοι ως προς τις δύο ιδιότητες, δηλαδή θα είναι ΚκΝν. Κατά συνέπεια το άτομο ΙV5 θα έχει πιθανότητα 1/3 να είναι ΚΚ, 2/3 να είναι Κκ και 2/3 να είναι Νν. Συνδιάζοντας τις πιθανότητες αυτές προκύπτει η συνολική πιθανότητα για τον κάθε γονότυπο του ατόμου ΙV5. Γονότυπος ΚΚΝν: P=1/3 2/3=2/9 Γονότυπος ΚκΝν: P=2/3 2/3=4/9 Για τα άτομα ΙV1 Χ ΙV5 προκύπτουν 2 διασταυρώσεις. 1 η περίπτωση: κκνν Χ ΚΚΝν Γαμέτες κν ΚΝ, Κν ΚκΝν, Κκνν καταρράκτη και νανισμό (1/2) P 1 =2/9 1/2 =2/18 2 η περίπτωση: κκνν Χ ΚκΝν κν ΚΝ, Κν, κν, κν ΚκΝν, Κκνν, κκνν, κκνν καταρράκτη και νανισμό (1/4) P 2 =4/9 1/4 =4/36 Άρα Pολ= P 1 +P 2 =2/18+4/36=4/36+4/36=8/36=2/9 12. Σε τι τύπο κληρονομικότητα μπορεί να οφείλεται το παρακάτω γενεαλογικό δένδρο; - Δεν είναι φυλοσύνδετο υπολειπόμενο, αφού άνδρας που δεν πάσχει (Ι1) αποκτά κόρη με την ασθένεια (ΙΙ2). - Δεν είναι φυλοσύνδετο επικρατές, αφού άνδρας που πάσχει (ΙΙ5) αποκτά κόρη που δεν πάσχει (ΙΙΙ7). Άρα μπορεί να είναι αυτοσωμικό επικρατές ή αυτοσωμικό υπολειπόμενο. Παρατηρούμε όμως ότι από μητέρα ασθενή, όλα της τα παιδιά είναι ασθενή, ενώ όταν ο πατέρας είναι ασθενής, όλα τα παιδιά είναι υγιή. Αυτό μπορεί να εξηγηθεί με ασθένεια που οφείλεται στο μιτοχονδριακό DNA. 10


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΓΕΝΕΑΛΟΓΙΚΑ ΔΕΝΔΡΑ ΟΜΑΔΑ Α 1. Η Ιωάννα έχει βραχυδαχτυλία όπως επίσης και τα 2 μεγαλύτερα αδέλφια της που είναι ομοζυγωτικοί δίδυμοι. Οι άλλες δύο μικρότερες αδελφές της έχουν

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 5 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα


Κεφάλαιο 5: ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Κεφάλαιο 5: ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ -ΘΕΩΡΙΑ- Κληρονομικότητα: Η ιδιότητα των ατόμων να μοιάζουν με τους προγόνους τους. Κληρονομικοί χαρακτήρες: Οι ιδιότητες που κληρονομούνται στους απογόνους. Γενετική:

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης. Παραδόσεις του μαθήματος

Βιολογία Θετικής Κατεύθυνσης. Παραδόσεις του μαθήματος Βιολογία Θετικής Κατεύθυνσης Παραδόσεις του μαθήματος Κεφάλαιο 5ο ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Επιλογή του πειραματικού του υλικού Χρήση του μοσχομπίζελου το οποίο αναπτύσσεται γρήγορα, εμφανίζει ποικιλότητα

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ Λ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ : 09/09/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από δύο

Διαβάστε περισσότερα

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Ο Mendel καλλιέργησε 28.000 φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας Λόγοι επιτυχίας των πειραμάτων του Mendel 1. Μελέτησε μία ή δύο

Διαβάστε περισσότερα



Διαβάστε περισσότερα


-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα

Μεθοδολογία επίλυσης ασκήσεων Γενετικής

Μεθοδολογία επίλυσης ασκήσεων Γενετικής Μεθοδολογία επίλυσης ασκήσεων Γενετικής Νόμοι του Mendel 1. Σε όλες τις ασκήσεις διασταυρώσεων αναφέρουμε τον 1 ο νόμο του Mendel (νόμο διαχωρισμού των αλληλόμορφων γονιδίων). 2. Σε ασκήσεις διυβριδισμού

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 την κουκίδα «Για την επιλογή οργάνων συμβατών για μεταμόσχευση.» Β2. Σελ. 136 «Το πρόβατο Dolly» έως «γέννησε τη Dolly.»

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Ένας διπλοειδής οργανισμός με 4 ζεύγη ανεξάρτητων γονιδίων έχει γονότυπο ΑΑ ΒΒ Γγ Δδ. Ποια και πόσα είδη γαμετών είναι δυνατόν να δημιουργηθούν από

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων

Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων 12 Ιουνίου 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Επαναληπτικών Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α1. δ Α2. γ Α3. β Α4. δ Α5. γ ΘΕΜΑ B B1. Σχολικό βιβλίο, κεφάλαιο 9

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΠΑΝΕΛΛΑ ΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2012 ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή φράση, η οποία συµπληρώνει σωστά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα Κεφάλαιο 5: Μενδελική Κληρονομικότητα ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Ο Mendel. α. εξέταζε σε κάθε πείραμά του το σύνολο των ιδιοτήτων του μοσχομπίζελου β. χρησιμοποιούσε αμιγή στελέχη στις ιδιότητες που μελετούσε

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος: Α. είναι ατελώς επικρατή Β. είναι συνεπικρατή

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α

γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α γ ρ α π τ ή ε ξ έ τ α σ η σ τ ο μ ά θ η μ α ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ' ΛΥΚΕΙΟΥ Τάξη: Γ Λυκείου Τμήμα: Βαθμός: Ονοματεπώνυμο: Καθηγητές: Θ Ε Μ Α Να επιλέξετε τη σωστή απάντηση: Α1. Στην τεχνολογία

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΚΑΙ ΑΠΑΝΤΗΣΕΙΣ ΕΠΑΝΑΛΗΠΤΙΚΩΝ ΠΑΝΕΛΛΑΔΙΚΩΝ ΕΞΕΤΑΣΕΩΝ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό κάθε μίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα στο γράμμα, που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών»

Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο Dolly κλωνοποίηση θηλαστικών» Βιολογία Κατεύθυνσης Γ Λυκείου Απαντήσεις 2012 Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β ΘΕΜΑ Α Β1. «σελ. 120 σχ. βιβλίου: Για την επιλογή οργάνων συμβατών για μεταμόσχευση» Β2. «σελ. 136 σχ. βιβλίου: Το πρόβατο

Διαβάστε περισσότερα

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την

ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Μονάδες 2 Να αιτιολογήσετε την επιλογή σας. Μονάδες 3. β. το αλληλόµορφο γονίδιο που προκαλεί την 1 ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ - ΚΑΠΕΤΑΝΑΚΕΙΟ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 2001 ΗΜΕΡΗΣΙΟ 1. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα γονίδια Ι Α και i που καθορίζουν τις ομάδες αίματος:

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά»

1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ 1ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2ο 1. σελ. 109 «Με τον όρο ζύμωση.. όπως πρωτεΐνες και αντιβιοτικά» 2. σελ. 119-120: «Θεραπευτικά. Τα αντισώματα μπορούν να

Διαβάστε περισσότερα

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική

Βιολογία προσανατολισμού-γ Λυκείου- Χ.Κ.Φιρφιρής -Φροντιστήρια Προοπτική 5.5.24.Δίνεται το γενεαλογικό δένδρο μίας οικογένειας στην οποία εμφανίζεται η ασθένεια της αιμορροφιλίας Α. Τα άτομα 3, 6 και 7 πάσχουν από αιμορροφιλία. α. Να βρεθούν οι πιθανοί γονότυποι όλων των μελών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 2 ΕΠΙΚΡΑΤΗ 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους.

Διαβάστε περισσότερα

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό

Φέρει το χαρακτηριστικό. Δε φέρει το χαρακτηριστικό Απαντήσεις στο μάθημα της Βιολογίας Κατεύθυνσης ΘΕΜΑ 1 Ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 Ο 1.σχολικό βιβλίο σελ. 109 «Με τον όρο ζύμωση και αντιβιοτικά» 2.σχολικό βιβλίο σελ. 119-120 «Τα αντισώματα μπορούν

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Θέμα Α : Α1. δ, Α2. γ, Α3. β, Α4. β, Α5. β Θέμα Β : Β1. Σελ.123 η παράγραφος με τίτλο «Ανοσοδιαγνωστικά» Β2. α-8, β-1, γ-6, δ-5, ε-7, στ-3 Β3. Σελ. 84

Διαβάστε περισσότερα

Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης.

Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης. ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης. Μαθητές: Όλγα Ντριζάη, Κυριακή Πρίφτη 2013 ΕΙΣΑΓΩΓΗ Είναι γνωστό και εύκολα µπορεί να παρατηρηθεί ότι όλα τα άτοµα

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ Ο.Π. ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΘΕΜΑ 1ο 1. Στην αυτοσωμική επικρατή κληρονομικότητα α. κάθε ασθενής γονέας γεννά έναν τουλάχιστον ασθενή απόγονο

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων.

Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων. Αθήνα, 30/5/2012 ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ Σας αποστέλλουµε τις προτεινόµενες απαντήσεις που αφορούν τα θέµατα της Βιολογίας Θετικής Κατεύθυνσης των Ηµερησίων Γενικών Λυκείων. Η Επιτροπή Παιδείας

Διαβάστε περισσότερα

ΘΕΜΑ Α Α1. α, Α2. γ, Α3. δ, Α4. β, Α5. γ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (30-05-2012) ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Β Β1. Σελ.120 Τα µονοκλωνικά αντισώµατα χρησιµοποιούνται για την επιλογή οργάνων συµβατών για µεταµόσχευση.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α: Α1. δ Α2. γ Α3. β Α4. γ Α5. β ΘΕΜΑ Β: Β1. 4 2 1 6 3 5 Β2. α. DNA πολυμεράση β. Πριμόσωμα γ. DNA δεσμάση δ. DNA ελικάση ε. RNA πολυμεράση Β3.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΧΟΛΙΟ: Τα θέματα είναι πολύ εύκολα και αναμένονται ιδιαίτερα υψηλές βαθμολογίες από τους σωστά προετοιμασμένους υποψηφίους. ΘΕΜΑ Α Α1. δ Α2. β Α3. α Α4.

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ (ΝΕΟ ΣΥΣΤΗΜΑ) Σχόλια Τα θέματα καλύπτουν το μεγαλύτερο μέρος της ύλης που εξεταζόταν. Απαιτούσαν πολύ καλή κατανόηση της θεωρίας και αρκετό χρόνο για την επίλυση των ασκήσεων. Στο ερώτημα Γ1 υπήρχε ασάφεια στο ζητούμενο

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ. Βιολογία Κατεύθυνσης Γ Λυκείου Ασκήσεις 5 ου Κεφαλαίου

ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ. Βιολογία Κατεύθυνσης Γ Λυκείου Ασκήσεις 5 ου Κεφαλαίου ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ 1) Από την διασταύρωση ταύρου χωρίς κέρατα α) με αγελάδα που έχει κέρατα, γεννήθηκε μοσχάρι χωρίς κέρατα, β) επίσης με αγελάδα που έχει κέρατα, γεννήθηκε μοσχάρι με κέρατα γ) με αγελάδα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 09/09/07 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τ φράσ που συμπλρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:. Από δύο φορείς

Διαβάστε περισσότερα

και ο φαινότυπος τους σε σχέση µε κάποιον συγκεκριµένο χαρακτήρα. Αυτό συνεισφέρει στη µελέτη του τρόπου κληρονόµησης διαφόρων γενετικών ασθενειών. Στ

και ο φαινότυπος τους σε σχέση µε κάποιον συγκεκριµένο χαρακτήρα. Αυτό συνεισφέρει στη µελέτη του τρόπου κληρονόµησης διαφόρων γενετικών ασθενειών. Στ ΘΕΜΑ 1 1. γ 2. α 3. α 4. β 5. δ ΘΕΜΑ 2 ΑΠΑΝΤΗΣΕΙΣ ΣΑΒΒΑΤΟ 04 ΙΟΥΝΙΟΥ 2005 ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 1. Σχολικό βιβλίο σελίδα 131 «Ένας τρόπος βελτίωσης µε επιθυµητές ιδιότητες.» Σχολικό βιβλίο σελίδα

Διαβάστε περισσότερα

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α

Βιολογία. Γ ΚΥΚΛΟΣ ΠΡΟΣΟΜΟΙΩΤΙΚΩΝ ΔΙΑΓΩΝΙΣΜΑΤΩΝ ΣΥΓΧΡΟΝΟ Προτεινόμενα Θέματα Γ ΓΕΛ. Ιανουάριος προσανατολισμού ΘΕΜΑ Α Βιολογία προσανατολισμού ΘΕΜΑ Α Να επιλέξετε τη σωστή απάντηση. Α1. Αν μια ασθένεια καθορίζεται από επικρατές φυλοσύνδετο γονίδιο θα εμφανίζεται: α. Σε όλους τους απογόνους εφόσον ο ένας γονέας έχει την

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης χρησιμοποιούνται: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ ΧΕΙΜΕΡΙΝΑ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 04/03/12 ΘΕΜΑ 1 Ο Α. Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Ως φορείς κλωνοποίησης

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 04 Ιουνίου 2014 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. Τα πλασμίδια είναι: δ. κυκλικά δίκλωνα μόρια DNA

Διαβάστε περισσότερα

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ.

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. Απαντήσεις: βιολογια κατευθυνσης 24/02/2013 ΘΕΜΑ 1 ο Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. ΘΕΜΑ 2 ο Α. Σελ 69 σχολικού βιβλίου: «Το μοσχομπίζελο έχει πολλά πλεονεκτήματα... έως και σελ 70 σχολικού..των αποτελεσμάτων».

Διαβάστε περισσότερα


ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΚΕΦ.5 ΜΕΝΤΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ΕΡΩΤΗΣΕΙΣ ΑΝΑΠΤΥΞΗΣ ΚΑΙ ΕΜΒΑΘΥΝΣΗΣ ΘΕΩΡΙΑΣ 5.1. Σε ποια στοιχεία οφείλεται η επιτυχία των πειραμάτων του Mendel; 5.2. Τι είναι ο γονότυπος ; Πως μπορούμε να βρούμε το γονότυπο

Διαβάστε περισσότερα

5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες

5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες 5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες Ποιος είναι ο σκοπός της αναπαραγωγής ; Η δημιουργία απογόνων

Διαβάστε περισσότερα


ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ ΔΙΑΦΟΡΕΣ ΑΣΚΗΣΕΙΣ ΣΤΟ 5 ΚΕΦΑΛΑΙΟ 1 Στη δροσόφιλα το κόκκινο χρώμα των ματιών είναι επικρατές. Εάν οι απόγονοι σε δύο διαφορετικές διασταυρώσεις είναι οι ακόλουθοι: ιασταύρωση Α ιασταύρωση Β 24 αρσενικά

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΛΥΣΕΙΣ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α. 1. β 2. β 3. γ 4. β Β. Ζύμωση: Διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες Υβριδοποίηση:

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ 6ο ΟΜΑΔΑ Α 1. Δίνεται η κωδική αλυσίδα γονιδίου που κωδικοποιεί ολιγοπεπτίδιο: 5 AAGCGATGCCGCCAAGAAGCTGACTGAAC3 Με τη βοήθεια του γενετικού κώδικα να βρείτε τις συνέπειες στη σύνθεση

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 2016 ΘΕΜΑ Α Α1. β Α2. β Α3. δ Α4. γ Α5. γ ΘΕΜΑ Β Β1. 1. Α, 2. Γ, 3. Α, 4. Β, 5. Α, 6. Α, 7. Γ Β2. Καρυότυπος είναι η απεικόνιση των µεταφασικών χρωµοσωµάτων ενός

Διαβάστε περισσότερα

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης

Κριτήριο αξιολόγησης-βιολογία Κατεύθυνσης ΘΕΜΑ Α. Στις παρακάτω προτάσεις από Α1 έως και Α5 να σημειώσετε το γράμμα που αντιστοιχεί στη σωστή απάντηση. Α1. Όταν ένας σύνθετος φάγος που έχει το πρωτεϊνικό κάλυμμα του φάγου Τ 2 και το DNA του φάγου

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ 2009 ΘΕΜΑ 1 ο 1. γ 2. γ 3. δ 4. α 5. β ΘΕΜΑ 2 ο 1. Σελ. 109 σχολ. Βιβλίου: Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών

Διαβάστε περισσότερα