APPENDICES TO HEALTHY, WEALTHY, AND WISE?
|
|
|
- Σαπφειρη Βαρουξής
- 5 χρόνια πριν
- Προβολές:
Transcript
1 APPENDICES TO HEALTHY, WEALTHY, AND WISE? A1. Transformed Variables and Functions Related to Partial Moments of an Edgeworth Expansion A2. Prevalence Models A3. Health Incidence Models A4. Wealth Change Models A5. Invariance Tests in the Wealth Change Models A6. Causality Tests in the Wealth Change Models A7. Income Change Models A8. Mobility, Tenure, Neighborhood Safety, Dwelling Condition Models
2 Table A1. Transformed Variables Wave 1-2 Wave 2-3 Label Variable N Mean Std Dev Variable N Mean Std Dev Wealth Variables Total Wealth Transformed wealth (Z1) WLTH Transformed wealth (Z2) WLTH Transformed wealth (Z3) WLTH Wealth Change (dependent variable) CWLTH CWLTH Non-liquid wealth (right hand side) XNWLTH XNWLTH Liquid wealth (right hand side) XLWLTH XLWLTH Non-Liquid Wealth Transformed wealth (Z1) WLTH Transformed wealth (Z2) WLTH Transformed wealth (Z3) WLTH Wealth Change (dependent variable) CWLTH CWLTH Non-liquid wealth (right hand side) XNWLTH XNWLTH Liquid wealth (right hand side) XLWLTH XLWLTH Liquid Wealth Transformed wealth (Z1) WLTH Transformed wealth (Z2) WLTH Transformed wealth (Z3) WLTH Wealth Change (dependent variable) CWLTH CWLTH Non-liquid wealth (right hand side) XNWLTH XNWLTH Liquid wealth (right hand side) XLWLTH XLWLTH NOTE: Xvariable_name refers to the interaction of each variable with X=Z(1-Z), where Z is the transformed nonliquid wealth. Results for Z calculated with liquid wealth are similar Page A1.1
3 Table A1. Transformed Variables (continued) Wave 1-2 Wave 2-3 Label Variable N Mean Std Dev Variable N Mean Std Dev Males Demographic/SES Variables 1 st quartile income XQ1I XQ1I th quartile income XQ4I XQ4I Poor/Fair Neighborhood cond. XHOODPF XHOODPF Poor/Fair House cond. XCONDPF XCONDPF Own House XDNHOUS XDNHOUS Educ>10 yrs XHS XHS Educ>14 yrs XCOLL XCOLL max(0, age-70) XAS701S XAS702S max(0, age-80) XAS801S XAS802S Never married XNEVMARR XNEVMARR Widow XWIDOW XWIDOW Divorced/Separated XDIVSEP XDIVSEP Mother s death age XMAGEDI XMAGEDI Father s death age XPAGEDI XPAGEDI Ever smoke XSMOKEV XSMOKEV Health Condition Prevalence Doc ever told had cancer? XCANCER XCANCER Doc ever told heart attactk/disease? XHEART XHEART Doc ever told had stroke? XSTROKE XSTROKE Doc ever told had lung disease? XLUNG XLUNG Doc ever told had diabetes? XDIABET XDIABET Doc ever told had high blood pressure? XHIGHBP XHIGHBP Ever had arthritis? XARTHRT XARTHRT Incontinence last 12 mo? XINCONT XINCONT Fall last 12 mo require treatment? XFALL XFALL Ever fractured hip? XHIPFRC XHIPFRC Proxy interview XPROXYW XPROXYW Age-educ adjust cog. impairment XCOGIM XCOGIM Ever seen Doc for psych prob? XPSYCH XPSYCH Depressed (cesd8>4) XDEPRES XDEPRES Low BMI XLOBMI XLOBMI High BMI XHIBMI XHIBMI Current smoker XSMOKNOW XSMOKNOW Number of ADL s XNUMADL XNUMADL Number of IADL s XNUMIADL XNUMIADL Poor/fair self reported health XDHLTH XDHLTH Health Condition Incidence New cancer since last wave? XJCANCER XJCANCER New heart attack/diseas since last wave? XJHEART XJHEART New stroke since last wave? XJSTROKE XJSTROKE Lung disease XILUNG XILUNG Diabetes XIDIABET XIDIABET High blood pressure XIHIGHBP XIHIGHBP Arthritis XIARTHRT XIARTHRT Incontinence XJINCONT XJINCONT Fall XJFALL XJFALL Hip fracture XJHIPFRC XJHIPFRC Proxy interview XPROXYW XPROXYW Cognitive impairment XICOGIM XICOGIM Psychiatric problems XIPSYCH XIPSYCH Depression XIDEPRES XIDEPRES BMI better XBMIBT XBMIBT BMI worse XBMIWS XBMIWS Current smoker XSMOKNOW XSMOKNOW Number of ADL s XNUMADL XNUMADL Number of IADL s XNUMIADL XNUMIADL Poor/fair self reported health XDHLTH XDHLTH NOTE: Xvariable_name refers to the interaction of each variable with X=Z(1-Z), where Z is the transformed nonliquid wealth. Results for Z calculated with liquid wealth are similar Page A1.2
4 Table A1. Transformed Variables (continued) Wave 1-2 Wave 2-3 Label Variable N Mean Std Dev Variable N Mean Std Dev Females Demographic/SES Variables 1 st quartile income XQ1I XQ1I th quartile income XQ4I XQ4I Poor/Fair Neighborhood cond. XHOODPF XHOODPF Poor/Fair House cond. XCONDPF XCONDPF Own House XDNHOUS XDNHOUS Educ>10 yrs XHS XHS Educ>14 yrs XCOLL XCOLL max(0, age-70) XAS701S XAS702S max(0, age-80) XAS801S XAS802S Never married XNEVMARR XNEVMARR Widow XWIDOW XWIDOW Divorced/Separated XDIVSEP XDIVSEP Mother s death age XMAGEDI XMAGEDI Father s death age XPAGEDI XPAGEDI Ever smoke XSMOKEV XSMOKEV Health Condition Prevalence Doc ever told had cancer? XCANCER XCANCER Doc ever told heart attactk/disease? XHEART XHEART Doc ever told had stroke? XSTROKE XSTROKE Doc ever told had lung disease? XLUNG XLUNG Doc ever told had diabetes? XDIABET XDIABET Doc ever told had high blood pressure? XHIGHBP XHIGHBP Ever had arthritis? XARTHRT XARTHRT Incontinence last 12 mo? XINCONT XINCONT Fall last 12 mo require treatment? XFALL XFALL Ever fractured hip? XHIPFRC XHIPFRC Proxy interview XPROXYW XPROXYW Age-educ adjust cog. impairment XCOGIM XCOGIM Ever seen Doc for psych prob? XPSYCH XPSYCH Depressed (cesd8>4) XDEPRES XDEPRES Low BMI XLOBMI XLOBMI High BMI XHIBMI XHIBMI Current smoker XSMOKNOW XSMOKNOW Number of ADL s XNUMADL XNUMADL Number of IADL s XNUMIADL XNUMIADL Poor/fair self reported health XDHLTH XDHLTH Health Condition Incidence New cancer since last wave? XJCANCER XJCANCER New heart attack/diseas since last wave? XJHEART XJHEART New stroke since last wave? XJSTROKE XJSTROKE Lung disease XILUNG XILUNG Diabetes XIDIABET XIDIABET High blood pressure XIHIGHBP XIHIGHBP Arthritis XIARTHRT XIARTHRT Incontinence XJINCONT XJINCONT Fall XJFALL XJFALL Hip fracture XJHIPFRC XJHIPFRC Proxy interview XPROXYW XPROXYW Cognitive impairment XICOGIM XICOGIM Psychiatric problems XIPSYCH XIPSYCH Depression XIDEPRES XIDEPRES BMI better XBMIBT XBMIBT BMI worse XBMIWS XBMIWS Current smoker XSMOKNOW XSMOKNOW Number of ADL s XNUMADL XNUMADL Number of IADL s XNUMIADL XNUMIADL Poor/fair self reported health XDHLTH XDHLTH NOTE: Xvariable_name refers to the interaction of each variable with X=Z(1-Z), where Z is the transformed nonliquid wealth. Results for Z calculated with liquid wealth are similar Page A1.3
5 Functions Related to Partial Moments of an Edgeworth Expansion Let H j ( ) denote Hermite polynomials, defined by H j ( )φ( ) = (-1) j φ (j) ( ), where φ (j) d j φ/dε j. This definition implies the recursion H j ( ) = H j-1 ( ) - dh j-1 ( )/d with H 0 ( ) = 1 and H 1 ( ) =. Other leading polynomials are H 2 ( ) = 2-1, H 3 ( ) = 3-3, H 4 ( ) = , H 5 ( ) = , and H 6 ( ) = A useful recursion for computation is H j ( ) = H j-1 ( ) - (j-1)h j-2 ( ). For j k, repeated integration by parts yields H j ( )H k ( )φ( )d (-1) k H j ( )φ (k) ( )d = (- 1) k-j (j) H j ( )φ (k-j) ( )d = ( j!) H k-j ( )φ( )d. Then, H j ( ) 2 φ( )d = j!, and for j < k, H j ( )H k ( )φ( )d = 0, since H k-j ( )φ( )d = (-1) k-j φ (k-j) ( )d = 0. Define Ψ jk (a) = k H j ( )φ( )d. One has Ψ 00 (a) = Φ(-a), Ψ 01 (a) = φ(a), and integrating by parts, a Ψ 0k (a) = a k-1 φ(a) + (k-1)ψ 0,k-2 (a). For j > 0, one has Ψ j0 (a) = H j ( )φ( )d = (-1) j φ (j) ( )d = -(-1) j φ (j-1) (a) = H j-1 (a)φ(a). Integration by parts for k > 0 a gives Ψ jk (a) = k (-1) j φ (j) ( )d = -a k (-1) j φ (j-1) (a) - k k-1 (- 1) j φ (j-1) ( )d = a k H j-1 (a)φ(a) + kψ j-1,k-1 (a). The table gives Ψ jk (a) for k 4 and j 6. a a a j\k Φ(-a) φ aφ+φ(-a) (a 2 +2)φ (a 3 +3a)φ+3Φ(-a) 1 φ aφ+φ(-a) (a 2 +2)φ (a 3 +3a)φ+3Φ(-a) (a 4 +4a 2 +4)φ 2 H 1 φ (ah 1 +1)φ (a 2 H 1 +2a)φ+2Φ(-a) (a 3 H 1 +3a 2 +6)φ (a 4 H 1 +4a 3 +12a)φ+12Φ(-a) 3 H 2 φ (ah 2 +H 1 )φ (a 2 H 2 +2aH 1 +2)φ (a 3 H 2 +3a 2 H 1 +6a)φ+6Φ(-a) (a 4 H 2 +4a 3 H 1 +12a 2 +24)φ 4 H 3 φ (ah 3 +H 2 )φ (a 2 H 3 +2aH 2 +2H 1 )φ (a 3 H 3 +3a 2 H 2 +6aH 1 +6)φ (a 4 H 3 +4a 3 H 2 +12a 2 H 1 +24a)φ+24Φ(-a) 5 H 4 φ (ah 4 +H 3 )φ (a 2 H 4 +2aH 3 +2H 2 )φ (a 3 H 4 +3a 2 H 3 +6aH 2 +6H 1 )φ (a 4 H 4 +4a 3 H 3 +24a 2 H 2 +24H 1 )φ 6 H 5 φ (ah 5 +H 4 )φ (a 2 H 5 +2aH 4 +2H 3 )φ (a 3 H 5 +3a 2 H 4 +6aH 3 +6H 2 )φ (a 4 H 5 +4a 3 H 4 +24a 2 H 3 +24H 2 )φ
6 An expansion f(ε) = J j 0 γ j H j (ε)φ(ε) satisfies k f j ( )d = Ψ jk (a). Then, f j ( )d = γ 0, εf j ( )d = γ 1, ε 2 f j ( )d = γ 0 + J j 0 γ j a 2γ 2,, ε 3 f j ( )d = 3γ 1 + 6γ 3, and ε 4 f j ( )d = 3γ γ γ 4.. When γ 1 = 1, γ 2 = 0, and γ 3 = 0, a sufficient condition for f(ε) > 0 is γ 3 < ½ and γ 4 < (1-2 γ 3 )/6.
7 Table A2. Prevalence of Health Conditions Cancer Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer1 heart1 stroke1 lung1 diabet1 highbp1 arthrt1 incont1 fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 1 of 19
8 Table A2. Prevalence of Health Conditions Heart Disease Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart1 stroke1 lung1 diabet1 highbp1 arthrt1 incont1 fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 2 of 19
9 Table A2. Prevalence of Health Conditions Stroke Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke1 lung1 diabet1 highbp1 arthrt1 incont1 fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 3 of 19
10 Table A2. Prevalence of Health Conditions Lung Disease Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung1 diabet1 highbp1 arthrt1 incont1 fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 4 of 19
11 Table A2. Prevalence of Health Conditions Diabetes Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet1 highbp1 arthrt1 incont1 fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 5 of 19
12 Table A2. Prevalence of Health Conditions High Blood Pressure Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp1 arthrt1 incont1 fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 6 of 19
13 Table A2. Prevalence of Health Conditions Arthritis Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt1 incont1 fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 7 of 19
14 Table A2. Prevalence of Health Conditions Incontinence Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont1 fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 8 of 19
15 Table A2. Prevalence of Health Conditions Fall Requiring Treatment Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall1 hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 9 of 19
16 Table A2. Prevalence of Health Conditions Hip Fracture Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc1 proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 10 of 19
17 Table A2. Prevalence of Health Conditions Proxy Interview Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw1 cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 11 of 19
18 Table A2. Prevalence of Health Conditions Cognitive Impairment Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw cogim1 psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 12 of 19
19 Table A2. Prevalence of Health Conditions Psychiatric Condition Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw cogim psych1 depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 13 of 19
20 Table A2. Prevalence of Health Conditions Depression Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw cogim psych depres1 bmi1 smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 14 of 19
21 Table A2. Prevalence of Health Conditions Body Mass Index (OLS) Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw cogim psych depres bmi1 smoknow1 numadl1 numiadl1 R-Square Sign. of SES Observations Count Percent Count Percent Total Page 15 of 19
22 Table A2. Prevalence of Health Conditions Smoke Now Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw cogim psych depres bmi smoknow1 numadl1 numiadl1 Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 16 of 19
23 Table A2. Prevalence of Health Conditions Number of ADL's (Ordered Probit) Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw cogim psych depres bmi smoknow numadl1 numiadl1 Count Count Thresh Thresh Thresh Thresh Thresh Thresh Thresh Likelihood Sign. of SES Page 17 of 19
24 Table A2. Prevalence of Health Conditions Number of IADL's (Ordered Probit) Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw cogim psych depres bmi smoknow numadl numiadl1 Count Count Thresh Thresh Thresh Thresh Thresh Thresh Likelihood Sign. of SES Page 18 of 19
25 Table A2. Prevalence of Health Conditions Poor/Fair Self-Rated Health Female Male one q1wb q4wb q1ib q4ib hs coll hoodpf condpf as as nevmarr widow divsep magedie pagedie smokev cancer heart stroke lung diabet highbp arthrt incont fall hipfrc proxyw cogim psych depres bmi smoknow numadl numiadl Likelihood Sign. of SES Odds Hi/Lo SES Sign. of Odds Observations Count Percent Count Percent Negative Positive Page 19 of 19
26 Table A3. Incidence of Health Conditions Cancer Females Males All No Previous Previous All No Previous Previous Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. one one logm logm as70m as80m as70m as80m q1wb q4wb q1ib q4ib hs coll hoodpf condpf nevmar widow divsep magedi pagedi smokev canc heart strk lung diab high arth incon fall hip proxy cog Page 1 of 40
27 Table A3. Incidence of Health Conditions Cancer Females Males All No Previous Previous All No Previous Previous Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. psych depr bmi12 lobmi hibmi smok adl iadl dhlth jcanc23 jheart23 jstrk23 ilung23 idiab23 ihigh23 iarth23 jincon23 jfall23 jhip23 proxy23 icog23 ipsych23 idepr23 bmibt23 bmiws23 smok23 adl23 iadl23 Likelihood Observation Count Percent Count Percent Count Percent Count Percent Count Percent Count Percent Negative Positive Page 2 of 40
28 Table A3. Incidence of Health Conditions Heart Disease Females Males All No Previous Previous All No Previous Previous Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. one one logm logm as70m as80m as70m as80m q1wb q4wb q1ib q4ib hs coll hoodpf condpf nevmar widow divsep magedi pagedi smokev canc heart strk lung diab high arth incon fall hip proxy cog Page 3 of 40
29 Table A3. Incidence of Health Conditions Heart Disease Females Males All No Previous Previous All No Previous Previous Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. psych depr bmi12 lobmi hibmi smok adl iadl dhlth jcanc jheart23 jstrk23 ilung23 idiab23 ihigh23 iarth23 jincon23 jfall23 jhip23 proxy23 icog23 ipsych23 idepr23 bmibt23 bmiws23 smok23 adl23 iadl23 Likelihood Observation Count Percent Count Percent Count Percent Count Percent Count Percent Count Percent Negative Positive Page 4 of 40
30 Table A3. Incidence of Health Conditions Stroke Females Males All No Previous Previous All No Previous Previous Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. one one logm logm as70m as80m as70m as80m q1wb q4wb q1ib q4ib hs coll hoodpf condpf nevmar widow divsep magedi pagedi smokev canc heart strk lung diab high arth incon fall hip proxy cog Page 5 of 40
31 Table A3. Incidence of Health Conditions Stroke Females Males All No Previous Previous All No Previous Previous Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. Coef. T-Stat. psych depr bmi12 lobmi hibmi smok adl iadl dhlth jcanc jheart jstrk23 ilung23 idiab23 ihigh23 iarth23 jincon23 jfall23 jhip23 proxy23 icog23 ipsych23 idepr23 bmibt23 bmiws23 smok23 adl23 iadl23 Likelihood Observation Count Percent Count Percent Count Percent Count Percent Count Percent Count Percent Negative Positive Page 6 of 40
Finite Field Problems: Solutions
Finite Field Problems: Solutions 1. Let f = x 2 +1 Z 11 [x] and let F = Z 11 [x]/(f), a field. Let Solution: F =11 2 = 121, so F = 121 1 = 120. The possible orders are the divisors of 120. Solution: The
Does anemia contribute to end-organ dysfunction in ICU patients Statistical Analysis
Does anemia contribute to end-organ dysfunction in ICU patients Statistical Analysis Xue Han, MPH and Matt Shotwell, PhD Department of Biostatistics Vanderbilt University School of Medicine March 14, 2014
EE512: Error Control Coding
EE512: Error Control Coding Solution for Assignment on Finite Fields February 16, 2007 1. (a) Addition and Multiplication tables for GF (5) and GF (7) are shown in Tables 1 and 2. + 0 1 2 3 4 0 0 1 2 3
CHAPTER 25 SOLVING EQUATIONS BY ITERATIVE METHODS
CHAPTER 5 SOLVING EQUATIONS BY ITERATIVE METHODS EXERCISE 104 Page 8 1. Find the positive root of the equation x + 3x 5 = 0, correct to 3 significant figures, using the method of bisection. Let f(x) =
22 .5 Real consumption.5 Real residential investment.5.5.5 965 975 985 995 25.5 965 975 985 995 25.5 Real house prices.5 Real fixed investment.5.5.5 965 975 985 995 25.5 965 975 985 995 25.3 Inflation
Other Test Constructions: Likelihood Ratio & Bayes Tests
Other Test Constructions: Likelihood Ratio & Bayes Tests Side-Note: So far we have seen a few approaches for creating tests such as Neyman-Pearson Lemma ( most powerful tests of H 0 : θ = θ 0 vs H 1 :
3.4 SUM AND DIFFERENCE FORMULAS. NOTE: cos(α+β) cos α + cos β cos(α-β) cos α -cos β
3.4 SUM AND DIFFERENCE FORMULAS Page Theorem cos(αβ cos α cos β -sin α cos(α-β cos α cos β sin α NOTE: cos(αβ cos α cos β cos(α-β cos α -cos β Proof of cos(α-β cos α cos β sin α Let s use a unit circle
Supplemental tables and figures
Supplemental tables and figures Supplemental Table S1. Demographic and clinical parameters by quartiles of white Variables blood cell count. WBC quartiles( 1 9 cells/l) Q1(.6-5.3, n=2587) Q2(5.4-6.3, n=263)
Supplementary Materials: A Preliminary Link between Hydroxylated Metabolites of Polychlorinated Biphenyls and Free Thyroxin in Humans
S1 of S11 Supplementary Materials: A Preliminary Link between Hydroxylated Metabolites of Polychlorinated Biphenyls and Free Thyroxin in Humans Eveline Dirinck, Alin C. Dirtu, Govindan Malarvannan, Adrian
D Alembert s Solution to the Wave Equation
D Alembert s Solution to the Wave Equation MATH 467 Partial Differential Equations J. Robert Buchanan Department of Mathematics Fall 2018 Objectives In this lesson we will learn: a change of variable technique
GDF-15 is a predictor of cardiovascular events in patients presenting with suspicion of ACS
GDF-15 is a predictor of cardiovascular events in patients presenting with suspicion of ACS Δρ Στέργιος Z. Τζήκας 30.10.2015 36 ο Διεθνές Καρδιολογικό Συνέδριο, Θεσσαλονίκη Σύγκρουση συμφερόντων Δεν έχω
Fourier Series. MATH 211, Calculus II. J. Robert Buchanan. Spring Department of Mathematics
Fourier Series MATH 211, Calculus II J. Robert Buchanan Department of Mathematics Spring 2018 Introduction Not all functions can be represented by Taylor series. f (k) (c) A Taylor series f (x) = (x c)
ST5224: Advanced Statistical Theory II
ST5224: Advanced Statistical Theory II 2014/2015: Semester II Tutorial 7 1. Let X be a sample from a population P and consider testing hypotheses H 0 : P = P 0 versus H 1 : P = P 1, where P j is a known
Ordinal Arithmetic: Addition, Multiplication, Exponentiation and Limit
Ordinal Arithmetic: Addition, Multiplication, Exponentiation and Limit Ting Zhang Stanford May 11, 2001 Stanford, 5/11/2001 1 Outline Ordinal Classification Ordinal Addition Ordinal Multiplication Ordinal
Solutions to Exercise Sheet 5
Solutions to Eercise Sheet 5 jacques@ucsd.edu. Let X and Y be random variables with joint pdf f(, y) = 3y( + y) where and y. Determine each of the following probabilities. Solutions. a. P (X ). b. P (X
2 Composition. Invertible Mappings
Arkansas Tech University MATH 4033: Elementary Modern Algebra Dr. Marcel B. Finan Composition. Invertible Mappings In this section we discuss two procedures for creating new mappings from old ones, namely,
SOLUTIONS TO MATH38181 EXTREME VALUES AND FINANCIAL RISK EXAM
SOLUTIONS TO MATH38181 EXTREME VALUES AND FINANCIAL RISK EXAM Solutions to Question 1 a) The cumulative distribution function of T conditional on N n is Pr T t N n) Pr max X 1,..., X N ) t N n) Pr max
Nowhere-zero flows Let be a digraph, Abelian group. A Γ-circulation in is a mapping : such that, where, and : tail in X, head in
Nowhere-zero flows Let be a digraph, Abelian group. A Γ-circulation in is a mapping : such that, where, and : tail in X, head in : tail in X, head in A nowhere-zero Γ-flow is a Γ-circulation such that
Durbin-Levinson recursive method
Durbin-Levinson recursive method A recursive method for computing ϕ n is useful because it avoids inverting large matrices; when new data are acquired, one can update predictions, instead of starting again
Every set of first-order formulas is equivalent to an independent set
Every set of first-order formulas is equivalent to an independent set May 6, 2008 Abstract A set of first-order formulas, whatever the cardinality of the set of symbols, is equivalent to an independent
Matrices and vectors. Matrix and vector. a 11 a 12 a 1n a 21 a 22 a 2n A = b 1 b 2. b m. R m n, b = = ( a ij. a m1 a m2 a mn. def
Matrices and vectors Matrix and vector a 11 a 12 a 1n a 21 a 22 a 2n A = a m1 a m2 a mn def = ( a ij ) R m n, b = b 1 b 2 b m Rm Matrix and vectors in linear equations: example E 1 : x 1 + x 2 + 3x 4 =
APPENDICES APPENDIX A. STATISTICAL TABLES AND CHARTS 651 APPENDIX B. BIBLIOGRAPHY 677 APPENDIX C. ANSWERS TO SELECTED EXERCISES 679
APPENDICES APPENDIX A. STATISTICAL TABLES AND CHARTS 1 Table I Summary of Common Probability Distributions 2 Table II Cumulative Standard Normal Distribution Table III Percentage Points, 2 of the Chi-Squared
Srednicki Chapter 55
Srednicki Chapter 55 QFT Problems & Solutions A. George August 3, 03 Srednicki 55.. Use equations 55.3-55.0 and A i, A j ] = Π i, Π j ] = 0 (at equal times) to verify equations 55.-55.3. This is our third
Homework 8 Model Solution Section
MATH 004 Homework Solution Homework 8 Model Solution Section 14.5 14.6. 14.5. Use the Chain Rule to find dz where z cosx + 4y), x 5t 4, y 1 t. dz dx + dy y sinx + 4y)0t + 4) sinx + 4y) 1t ) 0t + 4t ) sinx
Statistical Inference I Locally most powerful tests
Statistical Inference I Locally most powerful tests Shirsendu Mukherjee Department of Statistics, Asutosh College, Kolkata, India. shirsendu st@yahoo.co.in So far we have treated the testing of one-sided
( y) Partial Differential Equations
Partial Dierential Equations Linear P.D.Es. contains no owers roducts o the deendent variables / an o its derivatives can occasionall be solved. Consider eamle ( ) a (sometimes written as a ) we can integrate
Example Sheet 3 Solutions
Example Sheet 3 Solutions. i Regular Sturm-Liouville. ii Singular Sturm-Liouville mixed boundary conditions. iii Not Sturm-Liouville ODE is not in Sturm-Liouville form. iv Regular Sturm-Liouville note
Section 7.6 Double and Half Angle Formulas
09 Section 7. Double and Half Angle Fmulas To derive the double-angles fmulas, we will use the sum of two angles fmulas that we developed in the last section. We will let α θ and β θ: cos(θ) cos(θ + θ)
The challenges of non-stable predicates
The challenges of non-stable predicates Consider a non-stable predicate Φ encoding, say, a safety property. We want to determine whether Φ holds for our program. The challenges of non-stable predicates
Lecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3
Lecture 2: Dirac notation and a review of linear algebra Read Sakurai chapter 1, Baym chatper 3 1 State vector space and the dual space Space of wavefunctions The space of wavefunctions is the set of all
4.6 Autoregressive Moving Average Model ARMA(1,1)
84 CHAPTER 4. STATIONARY TS MODELS 4.6 Autoregressive Moving Average Model ARMA(,) This section is an introduction to a wide class of models ARMA(p,q) which we will consider in more detail later in this
Math221: HW# 1 solutions
Math: HW# solutions Andy Royston October, 5 7.5.7, 3 rd Ed. We have a n = b n = a = fxdx = xdx =, x cos nxdx = x sin nx n sin nxdx n = cos nx n = n n, x sin nxdx = x cos nx n + cos nxdx n cos n = + sin
Practice Exam 2. Conceptual Questions. 1. State a Basic identity and then verify it. (a) Identity: Solution: One identity is csc(θ) = 1
Conceptual Questions. State a Basic identity and then verify it. a) Identity: Solution: One identity is cscθ) = sinθ) Practice Exam b) Verification: Solution: Given the point of intersection x, y) of the
Queensland University of Technology Transport Data Analysis and Modeling Methodologies
Queensland University of Technology Transport Data Analysis and Modeling Methodologies Lab Session #7 Example 5.2 (with 3SLS Extensions) Seemingly Unrelated Regression Estimation and 3SLS A survey of 206
Inverse trigonometric functions & General Solution of Trigonometric Equations. ------------------ ----------------------------- -----------------
Inverse trigonometric functions & General Solution of Trigonometric Equations. 1. Sin ( ) = a) b) c) d) Ans b. Solution : Method 1. Ans a: 17 > 1 a) is rejected. w.k.t Sin ( sin ) = d is rejected. If sin
SOLUTIONS TO MATH38181 EXTREME VALUES AND FINANCIAL RISK EXAM
SOLUTIONS TO MATH38181 EXTREME VALUES AND FINANCIAL RISK EXAM Solutions to Question 1 a) The cumulative distribution function of T conditional on N n is Pr (T t N n) Pr (max (X 1,..., X N ) t N n) Pr (max
Section 8.3 Trigonometric Equations
99 Section 8. Trigonometric Equations Objective 1: Solve Equations Involving One Trigonometric Function. In this section and the next, we will exple how to solving equations involving trigonometric functions.
5- CACGAAACTACCTTCAACTCC-3 beta actin-r 5- CATACTCCTGCTTGCTGATC-3 GAPDH-F GAPDH-R
Table S1 Primers used in this work LncPPARδ-F 5- AGGATCCCAAGGCAGAAGTT -3 LncPPARδ-R 5- GAATAGAAAGGCGGGAAAGG -3 PPARδ-F 5- CACCCAGTGTCCTTCCATCT -3 PPARδ-R 5- CAGAATTGGGTGTGCTGCTT -3 ADRP-F 5- ACAACCGAGTGTGGTGACTC
Appendix to On the stability of a compressible axisymmetric rotating flow in a pipe. By Z. Rusak & J. H. Lee
Appendi to On the stability of a compressible aisymmetric rotating flow in a pipe By Z. Rusak & J. H. Lee Journal of Fluid Mechanics, vol. 5 4, pp. 5 4 This material has not been copy-edited or typeset
2. THEORY OF EQUATIONS. PREVIOUS EAMCET Bits.
EAMCET-. THEORY OF EQUATIONS PREVIOUS EAMCET Bits. Each of the roots of the equation x 6x + 6x 5= are increased by k so that the new transformed equation does not contain term. Then k =... - 4. - Sol.
Figure 1: Map of Kagera Region Tables Table 1: Percent of individual reporting illness and injury in the four weeks prior to survey, by age and gender Age Total Male Female 0-2 63.63 64.02 63.17 3-5 48.48
SCITECH Volume 13, Issue 2 RESEARCH ORGANISATION Published online: March 29, 2018
Journal of rogressive Research in Mathematics(JRM) ISSN: 2395-028 SCITECH Volume 3, Issue 2 RESEARCH ORGANISATION ublished online: March 29, 208 Journal of rogressive Research in Mathematics www.scitecresearch.com/journals
SCHOOL OF MATHEMATICAL SCIENCES G11LMA Linear Mathematics Examination Solutions
SCHOOL OF MATHEMATICAL SCIENCES GLMA Linear Mathematics 00- Examination Solutions. (a) i. ( + 5i)( i) = (6 + 5) + (5 )i = + i. Real part is, imaginary part is. (b) ii. + 5i i ( + 5i)( + i) = ( i)( + i)
Lecture 2. Soundness and completeness of propositional logic
Lecture 2 Soundness and completeness of propositional logic February 9, 2004 1 Overview Review of natural deduction. Soundness and completeness. Semantics of propositional formulas. Soundness proof. Completeness
Matrices and Determinants
Matrices and Determinants SUBJECTIVE PROBLEMS: Q 1. For what value of k do the following system of equations possess a non-trivial (i.e., not all zero) solution over the set of rationals Q? x + ky + 3z
An Inventory of Continuous Distributions
Appendi A An Inventory of Continuous Distributions A.1 Introduction The incomplete gamma function is given by Also, define Γ(α; ) = 1 with = G(α; ) = Z 0 Z 0 Z t α 1 e t dt, α > 0, >0 t α 1 e t dt, α >
.5 Real consumption.5 Real residential investment.5.5.5 965 975 985 995 25.5 965 975 985 995 25.5 Real house prices.5 Real fixed investment.5.5.5 965 975 985 995 25.5 965 975 985 995 25.3 Inflation rate.3
The Simply Typed Lambda Calculus
Type Inference Instead of writing type annotations, can we use an algorithm to infer what the type annotations should be? That depends on the type system. For simple type systems the answer is yes, and
= λ 1 1 e. = λ 1 =12. has the properties e 1. e 3,V(Y
Stat 50 Homework Solutions Spring 005. (a λ λ λ 44 (b trace( λ + λ + λ 0 (c V (e x e e λ e e λ e (λ e by definition, the eigenvector e has the properties e λ e and e e. (d λ e e + λ e e + λ e e 8 6 4 4
Second Order RLC Filters
ECEN 60 Circuits/Electronics Spring 007-0-07 P. Mathys Second Order RLC Filters RLC Lowpass Filter A passive RLC lowpass filter (LPF) circuit is shown in the following schematic. R L C v O (t) Using phasor
Differential equations
Differential equations Differential equations: An equation inoling one dependent ariable and its deriaties w. r. t one or more independent ariables is called a differential equation. Order of differential
Number All 397 Women 323 (81%) Men 74 (19%) Age(years) 39,1 (17-74) 38,9 (17-74) 40,5 (18-61) Maximum known weight(kg) 145,4 (92,0-292,0) 138,9 (92,0-202,0) 174,1 (126,0-292,0) Body mass index (kg/m 2
Math 446 Homework 3 Solutions. (1). (i): Reverse triangle inequality for metrics: Let (X, d) be a metric space and let x, y, z X.
Math 446 Homework 3 Solutions. (1). (i): Reverse triangle inequalit for metrics: Let (X, d) be a metric space and let x,, z X. Prove that d(x, z) d(, z) d(x, ). (ii): Reverse triangle inequalit for norms:
Oil grooved pads PFO series
Oil grooved pads PFO series Connector type Top Side Pad with locking fitting PFO K φ20 ~ 40 P237 Barb connector PFOTK PFOYK Pad with spring fitting NAPFO S Stroke(mm) φ20 ~ 40 6,15,30 P239 Female screw
Approximation of distance between locations on earth given by latitude and longitude
Approximation of distance between locations on earth given by latitude and longitude Jan Behrens 2012-12-31 In this paper we shall provide a method to approximate distances between two points on earth
1 1 1 2 1 2 2 1 43 123 5 122 3 1 312 1 1 122 1 1 1 1 6 1 7 1 6 1 7 1 3 4 2 312 43 4 3 3 1 1 4 1 1 52 122 54 124 8 1 3 1 1 1 1 1 152 1 1 1 1 1 1 152 1 5 1 152 152 1 1 3 9 1 159 9 13 4 5 1 122 1 4 122 5
A Finite Precision of Private Information Precision of Private Information Approaching Infinity 0 θ1 * θ Session Cost of Action A First 20 Last 20 Rounds Rounds Information in Stage 2 First 20 Last
Group 2 Methotrexate 7.5 mg/week, increased to 15 mg/week after 4 weeks. Methotrexate 7.5 mg/week, increased to 15 mg/week after 4 weeks
Group 1 Methotrexate 7.5 mg/week, increased to 15 mg/week after 4 weeks Group 2 Methotrexate 7.5 mg/week, increased to 15 mg/week after 4 weeks Sulfasalazine 2000-3000 mg/day Leflunomide 20 mg/day Infliximab
Integrals in cylindrical, spherical coordinates (Sect. 15.7)
Integrals in clindrical, spherical coordinates (Sect. 5.7 Integration in spherical coordinates. Review: Clindrical coordinates. Spherical coordinates in space. Triple integral in spherical coordinates.
1 String with massive end-points
1 String with massive end-points Πρόβλημα 5.11:Θεωρείστε μια χορδή μήκους, τάσης T, με δύο σημειακά σωματίδια στα άκρα της, το ένα μάζας m, και το άλλο μάζας m. α) Μελετώντας την κίνηση των άκρων βρείτε
Bayesian statistics. DS GA 1002 Probability and Statistics for Data Science.
Bayesian statistics DS GA 1002 Probability and Statistics for Data Science http://www.cims.nyu.edu/~cfgranda/pages/dsga1002_fall17 Carlos Fernandez-Granda Frequentist vs Bayesian statistics In frequentist
CRASH COURSE IN PRECALCULUS
CRASH COURSE IN PRECALCULUS Shiah-Sen Wang The graphs are prepared by Chien-Lun Lai Based on : Precalculus: Mathematics for Calculus by J. Stuwart, L. Redin & S. Watson, 6th edition, 01, Brooks/Cole Chapter
Simon et al. Supplemental Data Page 1
Simon et al. Supplemental Data Page 1 Supplemental Data Acute hemodynamic effects of inhaled sodium nitrite in pulmonary hypertension associated with heart failure with preserved ejection fraction Short
Supplemental Table 1. ICD-9-CM codes and ATC codes used in this study
Supplemental Table 1. ICD-9-CM codes and ATC codes used in this study Comorbidities ICD-9-CM codes Medication ATC codes Diabetes 250 Angiotensin-converting enzyme inhibitors C09AA Ischemic heart disease
ΗΜΥ 220: ΣΗΜΑΤΑ ΚΑΙ ΣΥΣΤΗΜΑΤΑ Ι Ακαδημαϊκό έτος Εαρινό Εξάμηνο Κατ οίκον εργασία αρ. 2
ΤΜΗΜΑ ΗΛΕΚΤΡΟΛΟΓΩΝ ΜΗΧΑΝΙΚΩΝ ΚΑΙ ΜΗΧΑΝΙΚΩΝ ΥΠΟΛΟΓΙΣΤΩΝ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΗΜΥ 220: ΣΗΜΑΤΑ ΚΑΙ ΣΥΣΤΗΜΑΤΑ Ι Ακαδημαϊκό έτος 2007-08 -- Εαρινό Εξάμηνο Κατ οίκον εργασία αρ. 2 Ημερομηνία Παραδόσεως: Παρασκευή
MATH423 String Theory Solutions 4. = 0 τ = f(s). (1) dτ ds = dxµ dτ f (s) (2) dτ 2 [f (s)] 2 + dxµ. dτ f (s) (3)
![MATH423 String Theory Solutions 4. = 0 τ = f(s). (1) dτ ds = dxµ dτ f (s) (2) dτ 2 [f (s)] 2 + dxµ. dτ f (s) (3)](/thumbs/81/84712331.jpg "MATH423 String Theory Solutions 4. = 0 τ = f(s). (1) dτ ds = dxµ dτ f (s) (2) dτ 2 [f (s)] 2 + dxµ. dτ f (s) (3)")
1. MATH43 String Theory Solutions 4 x = 0 τ = fs). 1) = = f s) ) x = x [f s)] + f s) 3) equation of motion is x = 0 if an only if f s) = 0 i.e. fs) = As + B with A, B constants. i.e. allowe reparametrisations
Coefficient Inequalities for a New Subclass of K-uniformly Convex Functions
International Journal of Computational Science and Mathematics. ISSN 0974-89 Volume, Number (00), pp. 67--75 International Research Publication House http://www.irphouse.com Coefficient Inequalities for
Econ 2110: Fall 2008 Suggested Solutions to Problem Set 8 questions or comments to Dan Fetter 1
Eon : Fall 8 Suggested Solutions to Problem Set 8 Email questions or omments to Dan Fetter Problem. Let X be a salar with density f(x, θ) (θx + θ) [ x ] with θ. (a) Find the most powerful level α test
Congruence Classes of Invertible Matrices of Order 3 over F 2
International Journal of Algebra, Vol. 8, 24, no. 5, 239-246 HIKARI Ltd, www.m-hikari.com http://dx.doi.org/.2988/ija.24.422 Congruence Classes of Invertible Matrices of Order 3 over F 2 Ligong An and
Lecture 21: Properties and robustness of LSE
Lecture 21: Properties and robustness of LSE BLUE: Robustness of LSE against normality We now study properties of l τ β and σ 2 under assumption A2, i.e., without the normality assumption on ε. From Theorem
Phys460.nb Solution for the t-dependent Schrodinger s equation How did we find the solution? (not required)
Phys460.nb 81 ψ n (t) is still the (same) eigenstate of H But for tdependent H. The answer is NO. 5.5.5. Solution for the tdependent Schrodinger s equation If we assume that at time t 0, the electron starts
Lifting Entry (continued)
ifting Entry (continued) Basic planar dynamics of motion, again Yet another equilibrium glide Hypersonic phugoid motion Planar state equations MARYAN 1 01 avid. Akin - All rights reserved http://spacecraft.ssl.umd.edu
derivation of the Laplacian from rectangular to spherical coordinates
derivation of the Laplacian from rectangular to spherical coordinates swapnizzle 03-03- :5:43 We begin by recognizing the familiar conversion from rectangular to spherical coordinates (note that φ is used
Μ. Μηνάς, Ε. Γκουντουβά, Ε. Αποστολίδου, Η. Μακρής, Κ. Γουργουλιάνης, Χ. Χατζόγλου
Μ. Μηνάς, Ε. Γκουντουβά, Ε. Αποστολίδου, Η. Μακρής, Κ. Γουργουλιάνης, Χ. Χατζόγλου Ιατρικό Τμήμα, Πανεπιστημίου Θεσσαλίας Πανεπιστημιακή Πνευμονολογική κλινική Πανεπιστημιακό Γενικό Νοσοκομείο Λάρισας
C.S. 430 Assignment 6, Sample Solutions
C.S. 430 Assignment 6, Sample Solutions Paul Liu November 15, 2007 Note that these are sample solutions only; in many cases there were many acceptable answers. 1 Reynolds Problem 10.1 1.1 Normal-order
Additional Results for the Pareto/NBD Model
Additional Results for the Pareto/NBD Model Peter S. Fader www.petefader.com Bruce G. S. Hardie www.brucehardie.com January 24 Abstract This note derives expressions for i) the raw moments of the posterior
Problem Set 3: Solutions
CMPSCI 69GG Applied Information Theory Fall 006 Problem Set 3: Solutions. [Cover and Thomas 7.] a Define the following notation, C I p xx; Y max X; Y C I p xx; Ỹ max I X; Ỹ We would like to show that C
DIRECT PRODUCT AND WREATH PRODUCT OF TRANSFORMATION SEMIGROUPS
GANIT J. Bangladesh Math. oc. IN 606-694) 0) -7 DIRECT PRODUCT AND WREATH PRODUCT OF TRANFORMATION EMIGROUP ubrata Majumdar, * Kalyan Kumar Dey and Mohd. Altab Hossain Department of Mathematics University
Για να ελέγξουµε αν η κατανοµή µιας µεταβλητής είναι συµβατή µε την κανονική εφαρµόζουµε το test Kolmogorov-Smirnov.
A. ΈΛΕΓΧΟΣ ΚΑΝΟΝΙΚΟΤΗΤΑΣ A 1. Έλεγχος κανονικότητας Kolmogorov-Smirnov. Για να ελέγξουµε αν η κατανοµή µιας µεταβλητής είναι συµβατή µε την κανονική εφαρµόζουµε το test Kolmogorov-Smirnov. Μηδενική υπόθεση:
Jesse Maassen and Mark Lundstrom Purdue University November 25, 2013
Notes on Average Scattering imes and Hall Factors Jesse Maassen and Mar Lundstrom Purdue University November 5, 13 I. Introduction 1 II. Solution of the BE 1 III. Exercises: Woring out average scattering
Supplementary Appendix
Supplementary Appendix Measuring crisis risk using conditional copulas: An empirical analysis of the 2008 shipping crisis Sebastian Opitz, Henry Seidel and Alexander Szimayer Model specification Table
ANSWERSHEET (TOPIC = DIFFERENTIAL CALCULUS) COLLECTION #2. h 0 h h 0 h h 0 ( ) g k = g 0 + g 1 + g g 2009 =?
Teko Classes IITJEE/AIEEE Maths by SUHAAG SIR, Bhopal, Ph (0755) 3 00 000 www.tekoclasses.com ANSWERSHEET (TOPIC DIFFERENTIAL CALCULUS) COLLECTION # Question Type A.Single Correct Type Q. (A) Sol least
SECTION II: PROBABILITY MODELS
SECTION II: PROBABILITY MODELS 1 SECTION II: Aggregate Data. Fraction of births with low birth weight per province. Model A: OLS, using observations 1 260 Heteroskedasticity-robust standard errors, variant
Data sheet Thick Film Chip Resistor 5% - RS Series 0201/0402/0603/0805/1206
Data sheet Thick Film Chip Resistor 5% - RS Series 0201/0402/0603/0805/1206 Scope -This specification applies to all sizes of rectangular-type fixed chip resistors with Ruthenium-base as material. Features
Lecture 15 - Root System Axiomatics
Lecture 15 - Root System Axiomatics Nov 1, 01 In this lecture we examine root systems from an axiomatic point of view. 1 Reflections If v R n, then it determines a hyperplane, denoted P v, through the
The ε-pseudospectrum of a Matrix
The ε-pseudospectrum of a Matrix Feb 16, 2015 () The ε-pseudospectrum of a Matrix Feb 16, 2015 1 / 18 1 Preliminaries 2 Definitions 3 Basic Properties 4 Computation of Pseudospectrum of 2 2 5 Problems
UMI Number: All rights reserved
UMI Number: 3408360 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send
Concrete Mathematics Exercises from 30 September 2016
Concrete Mathematics Exercises from 30 September 2016 Silvio Capobianco Exercise 1.7 Let H(n) = J(n + 1) J(n). Equation (1.8) tells us that H(2n) = 2, and H(2n+1) = J(2n+2) J(2n+1) = (2J(n+1) 1) (2J(n)+1)
ΚΥΠΡΙΑΚΗ ΕΤΑΙΡΕΙΑ ΠΛΗΡΟΦΟΡΙΚΗΣ CYPRUS COMPUTER SOCIETY ΠΑΓΚΥΠΡΙΟΣ ΜΑΘΗΤΙΚΟΣ ΔΙΑΓΩΝΙΣΜΟΣ ΠΛΗΡΟΦΟΡΙΚΗΣ 6/5/2006
Οδηγίες: Να απαντηθούν όλες οι ερωτήσεις. Ολοι οι αριθμοί που αναφέρονται σε όλα τα ερωτήματα είναι μικρότεροι το 1000 εκτός αν ορίζεται διαφορετικά στη διατύπωση του προβλήματος. Διάρκεια: 3,5 ώρες Καλή
6.3 Forecasting ARMA processes
122 CHAPTER 6. ARMA MODELS 6.3 Forecasting ARMA processes The purpose of forecasting is to predict future values of a TS based on the data collected to the present. In this section we will discuss a linear
Η κοινωνική διάσταση της επιδηµιολογίας της καρδιαγγειακής νόσου την περίοδο της οικονοµικής κρίσης
Η κοινωνική διάσταση της επιδηµιολογίας της καρδιαγγειακής νόσου την περίοδο της οικονοµικής κρίσης ΔΗΜΟΣΘΕΝΗΣ Β. ΠΑΝΑΓΙΩΤΑΚΟΣ ΚΑΘΗΓΗΤΗΣ Σχολή Επιστηµών Υγείας & Αγωγής ΧΑΡΟΚΟΠΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ Ιστορική
Solution Series 9. i=1 x i and i=1 x i.
Lecturer: Prof. Dr. Mete SONER Coordinator: Yilin WANG Solution Series 9 Q1. Let α, β >, the p.d.f. of a beta distribution with parameters α and β is { Γ(α+β) Γ(α)Γ(β) f(x α, β) xα 1 (1 x) β 1 for < x
Lecture 26: Circular domains
Introductory lecture notes on Partial Differential Equations - c Anthony Peirce. Not to be copied, used, or revised without eplicit written permission from the copyright owner. 1 Lecture 6: Circular domains
Fractional Colorings and Zykov Products of graphs
Fractional Colorings and Zykov Products of graphs Who? Nichole Schimanski When? July 27, 2011 Graphs A graph, G, consists of a vertex set, V (G), and an edge set, E(G). V (G) is any finite set E(G) is
Biostatistics for Health Sciences Review Sheet
Biostatistics for Health Sciences Review Sheet http://mathvault.ca June 1, 2017 Contents 1 Descriptive Statistics 2 1.1 Variables.............................................. 2 1.1.1 Qualitative........................................
Αναερόβια Φυσική Κατάσταση
Αναερόβια Φυσική Κατάσταση Γιάννης Κουτεντάκης, BSc, MA. PhD Αναπληρωτής Καθηγητής ΤΕΦΑΑ, Πανεπιστήµιο Θεσσαλίας Περιεχόµενο Μαθήµατος Ορισµός της αναερόβιας φυσικής κατάστασης Σχέσης µε µηχανισµούς παραγωγής
Απόκριση σε Μοναδιαία Ωστική Δύναμη (Unit Impulse) Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο. Απόστολος Σ.
Απόκριση σε Δυνάμεις Αυθαίρετα Μεταβαλλόμενες με το Χρόνο The time integral of a force is referred to as impulse, is determined by and is obtained from: Newton s 2 nd Law of motion states that the action
Solutions to the Schrodinger equation atomic orbitals. Ψ 1 s Ψ 2 s Ψ 2 px Ψ 2 py Ψ 2 pz
Solutions to the Schrodinger equation atomic orbitals Ψ 1 s Ψ 2 s Ψ 2 px Ψ 2 py Ψ 2 pz ybridization Valence Bond Approach to bonding sp 3 (Ψ 2 s + Ψ 2 px + Ψ 2 py + Ψ 2 pz) sp 2 (Ψ 2 s + Ψ 2 px + Ψ 2 py)
Εισαγωγή στη Διατροφή
Εισαγωγή στη Διατροφή Ενότητα 9 η ΜΕΡΟΣ Β THE INTERNATIONAL OBESITY TASK FORCE (IOTF) Όνομα καθηγητή: Μ. ΚΑΨΟΚΕΦΑΛΟΥ Όνομα καθηγητή: Α. ΖΑΜΠΕΛΑΣ Τμήμα: Επιστήμης τροφίμων και διατροφής του ανθρώπου ΣΤΟΧΟΙ
w o = R 1 p. (1) R = p =. = 1
Πανεπιστήµιο Κρήτης - Τµήµα Επιστήµης Υπολογιστών ΗΥ-570: Στατιστική Επεξεργασία Σήµατος 205 ιδάσκων : Α. Μουχτάρης Τριτη Σειρά Ασκήσεων Λύσεις Ασκηση 3. 5.2 (a) From the Wiener-Hopf equation we have: