Διαστρωμάτωση Κινδύνου στην Υπερτροφική Μυοκαρδιοπάθεια (ΥΜΚ) Γεώργιος Κ Ευθυμιάδης

ΥΜΚ: Ανεξήγητη υπερτροφία της αριστερής κοιλίας

HCM phenotypes

Hypertrophic Cardiomyopathy HCM Landmarks Maron BJ et al. J Am Coll Cardiol 2012;60:705 15

histology

Λήψη ατομικού ιστορικού Υπάρχει, ιδίως μετά από κόπωσηː δύσπνοια, πόνος στο στήθος, αίσθημα παλμών, απώλεια συνειδήσεως Υπάρχει ιατρική αναφορά για φύσημα, παθολογικό ΗΚΓ, αρρυθμίες ή εγκεφαλικό επεισόδιο Υπάρχει αποκλεισμός από τον στρατό ή την άθληση για ιατρικούς λόγους

Λήψη οικογενειακού ιστορικού (3 Γενεές) Αιφνίδιος θάνατος Μυοκαρδιοπάθεια

Γιατί προσέρχεται για έλεγχο ο ασθενής 1. Εμφάνιση συμπτωμάτων (Δύσπνοια, στηθάγχη, αίσθημα παλμών) 2. Εμφάνιση συμβαμάτων (συγκοπή, εγκεφαλικό επεισόδιο, κολπική μαρμαρυγή) 3. Διερεύνηση φυσήματος ή παθολογικού ΗΚΓ σε προληπτικό έλεγχο 4. Ύπαρξη οικογενειακού ιστορικού ΥΜΚ 5. Αιφνίδιος θάνατος στην οικογένεια σε μικρή ηλικία

Οικογενειακό δένδρο

Κλινική εξέταση Τραχύ συστολικό φύσημα εξωθήσεως μεταξύ κορυφής και αριστερού χείλους στέρνου Ολοσυστολικό φύσημα κορυφής Αύξηση της έντασης σε όρθια θέση, μετά έκτακτη κοιλιακή συστολή, valsalva

Παρακλινικες εξετασεις ΗΚΓ ΥΠΕΡΗΧΟ 24-ωρη ΗΚΓ καταγραφή Καρδιοαναπνευστική δοκιμασία κόπωσης Μαγνητική τομογραφία καρδιάς

ΗΚΓ Παθολογικό στο 90% κύματα q, πτώση ST, αρνητικά Τ, LVH

υπερηχογράφημα

Υπερτροφική Μυοκαρδιοπάθεια

Απόφραξη χώρου εξόδου ΑΚ

Apical 5-chamber long-axis view at rest showing mitral valve at end diastole (SAM was absent in systole) (A) with normal continuous-wave Doppler velocity through the LV outflow tract (C) Maron, M. S. et al. Circulation 2006;114:2232-2239 Copyright 2006 American Heart Association

Holter Monitoring: NSVT

Cardiopulmonary stress test: Blood pressure response

Cardiopulmonary stress test: VO2 max

Μαγνητική τομογραφία καρδιάς

Figure 3. Diverse patterns of LV hypertrophy encountered in HCM shown in CMR short-axis images at end diastole. Rickers C et al. Circulation 2005;112:855-861 Copyright American Heart Association

Figure 2. Diagnostic images from 13-year-old identical twin with nonobstructive HCM. Two-dimensional stop-frame echocardiogram (A) and comparative CMR (B) images acquired in short-axis plane in end diastole at mitral valve level, and 12-lead ECG (C). Rickers C et al. Circulation 2005;112:855-861 Copyright American Heart Association

Apical variants of HCM are also better identified by CMR. J C C Moon, N G Fisher, W J McKenna, D J Pennell Heart 2004;90:645 649

ΓΕΝΕΤΙΚΗ Οικογενής μορφή : 55% Μεταβίβαση κατά τον αυτοσωματικό επικρατούντα χαρακτήρα

Types of mutations Missense (δυσυνθετικές) 90% Single amino acid substitution Frame shift (αλλαγή αναγνωστικού πλαισίου) Deletions/Insertions of nucleic acids Shortened truncated proteins Pathogenic mutations, severe disease MYBPC gene

B-Myosin Heavy Chain Gene EXON 23 codon 403 AATGCATGCTTGAGTCTGAC:MHC gene...tac...mutant gene. Gln.b-MHC protein Arg403Gln

Clinical Applications of Genetic Testing Prevalence of HCM Genes in Probands Maron BJ, J Am Coll Cardiol. 2012;60(8):705-15.

Εκτίμηση κινδύνου αιφνιδίου θανάτου

ΥΠΕΡΤΡΟΦΙΚΗ ΜΥΟΚΑΡΔΙΟΠΑΘΕΙΑ φυσική ιστορία Ασυμπτωματική δια βίου Στηθάγχη, Δύσπνοια, Συγκοπή ΑΕΕ, Κολπική μαρμαρυγή (30%) Ενδοκαρδίτιδα (0.3%) Εξέλιξη προς διατατική μυοκαρδιοπάθεια (8%) Φυσιολογικό προσδώκιμο επιβίωσης (75%) Αιφνίδιος θάνατος (<1%)

Figure 1. Contemporary Insights and Strategies for Risk Stratification and Prevention of Sudden Death in Hypertrophic Cardiomyopathy. Maron, Barry Circulation. 121(3):445-456, January 26, 2010. DOI: 10.1161/CIRCULATIONAHA.109.878579 Figure 1. SD and age in HCM. Top, SD is most common before [almost equal to]25 years of age, whereas heart failure and stroke generally occur later in life. From Maron et al.11 Used with permission from the American Heart Association, copyright (C) 2000. Bottom, Single most frequent cause of SD in young competitive athletes in the United States. ARVC indicates arrhythmogenic right ventricular cardiomyopathy; AS, aortic valve stenosis; CHD, congenital heart disease; LAD, left anterior descending; MVP, mitral valve prolapse; and WPW, Wolff-Parkinson-White. *Regarded as possible (but not definitive) evidence for HCM at autopsy with mildly increased LV wall thickness and heart weight (447+/-76 g). +Includes Kawasaki disease, sickle cell trait, and sarcoid. 2010 American Heart Association, Inc. Published by American Heart Association. 2

Μηχανισμοί ΑΚΘ στην ΥΜΚ Barry J. Maron BJ, et. al Efficacy of Implantable Cardioverter Defibrillators for the Prevention of Sudden Death in Patients with Hypertrophic Cardiomyopathy. N Engl J Med 2000; 342:365-373 In all 21 patients with stored electrographic data and appropriate interventions, the interventions were triggered by ventricular tachycardia or fibrillation.

Αιφνίδιος θάνατος στην ΥΜΚ < 1% ανά έτος Σε επιλεγμένη ομάδα ασθενών (15-20%) 4-6% ανά έτος

Αιφνίδιος θάνατος στην ΥΜΚ επιδημιολογία Μπορεί να είναι η πρώτη εκδήλωση της νόσου Συχνά σε ασυμπτωματικά ή ελάχιστα συμπτωματικά νέα άτομα Συμβαίνει σε -ήπια/έντονη άσκηση (>50%) -συνηθισμένες δραστηριότητες -στον ύπνο Κύριο αίτιο θανάτου σε άτομα <35 ετών και σε αθλητές

Major Risk Factors for SD in HCM Prior aborted cardiac arrest and spontaneous sustained ventricular tachycardia 7-year mortality rate of 33% 5-year SCD or ICD discharge rate of 41% Cecchi F. J Am Coll Cardiol 1989;13:1283-8. Elliott PM. J Am Coll Cardiol 1999;33:1596-601.

Clinical Markers of SD in HCM Family history of premature SD Unexplained syncope (<6 months) Huge hypertrophy (> 30 mm) Non-sustained VT (especially <30-y) Abnormal blood pressure response on exercise (<40-y)

Cardiovasc Ultrasound. 2009; 7: 37.

O'Mahony C, Tome-Esteban M, Lambiase PD, Pantazis A Dickie S, McKenna WJ, Elliott PM. Heart. 2013 Jan 22 Median f/u 6.6 years SCD/appropriate ICD shock per/year 20/660 pts (3%): 0 RF (0.45%) 31/636 pts (4.8%): 1 RF (0.65%) 27/249 pts (10.8%):2 RF (1.3%) 7 /51 pts (13.7%): 3 RF (1.9%) 4/10 pts (40%): 4 RF (5.0%)

Figure 9. Contemporary Insights and Strategies for Risk Stratification and Prevention of Sudden Death in Hypertrophic Cardiomyopathy. Maron, Barry Circulation. 121(3):445-456, January 26, 2010. DOI: 10.1161/CIRCULATIONAHA.109.878579 Figure 9. Number of risk factors. Top, Appropriate ICD intervention rates (per 100 person-years) are not significantly different with respect to 1, 2, or >=3 risk factors. Center, Cumulative rates for first appropriate device intervention in patients with 1, 2, or >=3 risk factors. Reprinted from Maron et al.8 Used with permission from the American Medical Association, copyright (C) 2007. Bottom, ICD intervention rates in those patients with only 1 risk factor. LVH indicates LV hypertrophy; NSVT, nonsustained VT. 2010 American Heart Association, Inc. Published by American Heart Association. 2

Possible Risk Factors for SD in HCM Atrial fibrillation Myocardial ischaemia Dilated phase Restrictive physiology Multiple mutations (3-5% ) LV outflow obstruction Mid LV obstruction Apical aneurysm LGAD enhancement

Atrial fibrillation in HCM

From: Dilated-Hypokinetic Evolution of Hypertrophic Cardiomyopathy: Title and subtitle BreakPrevalence, Incidence, Risk Factors, and Prognostic Implications in Pediatric and Adult Patients J Am Coll Cardiol. 2005;46(8):1543-1550. doi:10.1016/j.jacc.2005.04.062 Figure Legend: A representative example of evolution to dilated-hypokinetic hypertrophic cardiomyopathy (HCM) in a female pediatric patient. (A) The basal echocardiogram (at age 13 years) shows HCM with massive left ventricular (LV) hypertrophy involving the intraventricular septum and the left posterior wall, accompanied by diminutive LV cavity size. (B) Three years later (at age 16 years), the LV cavity has become enlarged and the walls have thinned in the context of severe heart failure, requiring heart transplantation. Date of download: 10/16/2012 Copyright The American College of Cardiology. All rights reserved.

Figure 4. Evolution to ES in a male HCM patient (patient 26), shown at end diastole in parasternal long-axis (A and C) and short-axis (B and D) echocardiographic crosssectional planes. Harris K M et al. Circulation 2006;114:216-225 Copyright American Heart Association

Μυοκαρδιακή ισχαιμία

Role of genetics in prognosis

Mid-ventricular hypertrophy

Mid-LV obstruction

Efthimiadis G et.al. Prevalence and Natural History of Mid-Ventricular Obstructive HCM, in press

Importance of hypertrophy pattern in sudden death risk stratification among patients suffering from hypertrophic cardiomyopathy. E Pagourelias, GK. Efthimiadis, DG. Parcharidou, TD. Gossios, H. Karvounis, IH. Styliadis. (presented in ESC congress, Munchen 2012)

Probability of Sudden Death among 224 Patients with a Left Ventricular Ouflow Tract Gradient of at Least 30 mm Hg and 770 Patients without Obstruction Maron M et al. N Engl J Med 2003;348:295-303

Kaplan Meier estimates of the proportions of patients surviving from sudden cardiac death, appropriate ICD discharge, or resuscitated ventricular fibrillation in relation to LVOTO. Elliott P M et al. Eur Heart J 2006;27:1933-1941 The European Society of Cardiology 2006. All rights reserved. For Permissions, please e-mail: journals.permissions@oxfordjournals.org

Efthimiadis GK, Parcharidou DG, Giannakoulas G, Pagourelias ED, Charalampidis P, Savvopoulos G, Ziakas A, Karvounis H, Styliadis IH, Parcharidis GE. Left ventricular outflow tract obstruction as a risk factor for sudden cardiac death in hypertrophi cardiomyopathy. Am J Cardiol. 2009 Sep 1;104(5):695-9.

Apical aneurysm

Apical aneurysms

HCM with apical aneurysms 2% 40% <=50 years of age. 70% mid-lv obstruction 30% apical HCM myocardial scarring (late gadolinium enhancement) recognized by echocardiography in 60% By MRI in 100% Maron MS, et al. Circulation 2008;118:1541-1549

LGAD in risk stratification process

LGAD)enhancement Efthimiadis GK, et al. Hypertrophic cardiomyopathy involving the right ventricular apex Can J Cardiol. 2007; 23(14): 1162.

Prevalence of LGAD enhancement in 87/403pts with HCM (AHEPA registry, unpublished data)

Correlation of %LGAD and Syncope (AHEPA registry, unpublished data)

Correlation of %LGAD and Max. thickness 30 mm (AHEPA registry, unpublished data)

Correlation of %LGAD and prevalence of NSVT (AHEPA registry, unpublished data)

Correlation of % LGAD and Risk Factors for SCD (AHEPA registry, unpublished data) Late Gadolinium Enhancement (%) p value Family history (SCD) Yes No Syncope Yes No Max wall thickness >30mm Yes No NSVT Yes No ABPR Yes No 13.5 (9.5) 9.48 (12.1) 17.1 (10.4) 8.7 (11.5) 16.38 (5.7) 9.5 (12) 13.4 (8.54) 9.6 (12.14) 12.1 (13.4) 9.15 (10.7) 0.238 0.031 0.024 0.014 0.228

Indications for ICDs in HCM. *SCD risk modifiers include established risk factors and emerging risk modifiers (Section 9.4.2). Writing Committee Members et al. Circulation 2011;124:2761-2796 Copyright American Heart Association

ICD implantation in 37 pts with HCM for primary prevention (AHEPA Hospital) Appropriate ICD intervention in 10 out of 37 (27.02%) primary prevention patients Cumulative probability of ICD intervention at five years was 29.2% ( 7.4%) First appropriate intervention rate was 7.18% per year (95% CI: 3.44-13.20)

Προοπτικές Έναρξη θεραπείας στο προκλινικό στάδιο της νόσου Genotype (+)/Phenotype (-) A-MEA, AT-inhibitors, spironolactone, diltiazem, b-blockers

Prevalence of late gadolinium enhancement in 87/403pts with HCM (AHEPA registry, unpublished data)

Combined Midventricular and LVOT obstruction (50%)

Female 70-y with mid-lv obstruction

Figure 3. Contemporary Insights and Strategies for Risk Stratification and Prevention of Sudden Death in Hypertrophic Cardiomyopathy. Maron, Barry Circulation. 121(3):445-456, January 26, 2010. DOI: 10.1161/CIRCULATIONAHA.109.878579 Figure 3. Prevention of SD. Top, Intracardiac electrogram obtained at 1:20 am in a patient while asleep 5 years after implantation. From 35-year-old man with HCM who received prophylactic ICD because of family history of SD and marked ventricular septal thickness (31 mm). A, VT begins abruptly at 200 bpm. B, Defibrillator senses VT and charges. C, VT deteriorates into VF, and defibrillator issues 20-J shock (D; arrow), restoring sinus rhythm. Virtually identical sequence occurred 9 years later during sleep; the patient is now 53 years of age and asymptomatic. Reprinted from Maron et al.7 Copyright (C) 2000 Massachusetts Medical Society. All rights reserved. Bottom, Flow diagram summarizing ICD-related outcome in 506 high-risk HCM patients from an international multicenter ICD registry.8 2010 American Heart Association, Inc. Published by American Heart Association. 2

Apical 5-chamber long-axis view at rest showing mitral valve at end diastole (SAM was absent in systole) (A) with normal continuous-wave Doppler velocity through the LV outflow tract (C) Maron, M. S. et al. Circulation 2006;114:2232-2239 Copyright 2006 American Heart Association

Perspectives AIM: reversal or prevention of hypertrophy and fibrosis experimental therapies: beneficial small clinical trials in overt HCM: no benefit beneficial effect when applied in the preclinical phase? ongoing trial : diltiazem in preventing phenotypes, in preclinical HCM