ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ. Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ. Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό"


1 ΓΕΝΕΤΙΚΗ ΠΛΗΘΥΣΜΩΝ Προβλέποντας την κληρονομικότητα σε έναν πληθυσμό

2 Γενετική Πληθυσμών γενετική δομή ενός πληθυσμού αλληλόμορφα γενότυποι Ομάδα ατόμων του ίδιου είδους που μπορούν να διασταυρωθούν Πρότυπα γενετικής ποικιλότητας σε πληθυσμούς Αλλαγές στη γενετική δομή στο χρόνο και στο χώρο

3 Πληθυσμοί: Μέλη ενός σεξουαλικά αναπαραγόμενου είδους είναι ικανά να διασταυρώνονται, να παράγουν γόνιμους απογόνους και να μοιράζονται μια κοινή γονιδιακή δεξαμενή Γονιδιακή δεξαμενή είναι το σύνολο των αλληλομόρφων όλων των ατόμων σε έναν πληθυσμό

4 Πληθυσμοί Διαφορετικά είδη δεν ανταλλάσσουν γονίδια μεταξύ τους με διασταύρωση Ένας πληθυσμός είναι μια ομάδα οργανισμών του ίδιου είδους που καταλαμβάνουν μια συγκεκριμένη περιοχή

5 Πληθυσμοί Τα μέλη ενός πληθυσμού διαφέρουν μεταξύ τους Η ποικιλότητα είναι το ακατέργαστο υλικό υπόβαθρο για τις εξελικτικές αλλαγές Χαρακτήρες που κάνουν έναν οργανισμό κατάλληλο για το περιβάλλον του ώστε να επιβιώνει, να αναπαράγεται και να περνάει τα αλληλόμορφά του στους απογόνους του, καλούνται προσαρμογές Lampropeltis getulus: Χρωματικός και σχηματικός πολυμορφισμός στο «βασιλικό φίδι» της Καλιφόρνιας

6 Πληθυσμοί Ειδογένεση είναι η διαίρεση ενός είδους σε δύο ή περισσότερα ή ο μετασχηματισμός ενός είδους σε ένα άλλο με το χρόνο Η ειδογένεση είναι το τελικό αποτέλεσμα των αλλαγών της γονιδιακής δεξαμενής σε αλληλομορφικές και γενοτυπικές συχνότητες

7 Ανθρώπινες φυλές: υποείδη ή πολυμορφισμός;

8 Γενετική πληθυσμών-περίγραμμα Τι είναι Γενετική Πληθυσμών; Υπολογισμός - γενοτυπικών συχνοτήτων - αλληλομορφικών συχνοτήτων Γιατί είναι σημαντική η γενετική ποικιλότητα; Πώς μεταβάλλεται η γενετική δομή;

9 Γενετική ποικιλότητα σε χώρο και χρόνο Συχνότητα του αλληλομόρφου Mdh-1 σε αποικίες σαλιγκαριών σε δύο οικοδομικά τετράγωνα

10 Γενετική ποικιλότητα σε χώρο και χρόνο Αλλαγές στη συχνότητα των αλληλομόρφων του τόπου Est σε πληθυσμούς αρουραίων για πάνω από 20 γενιές

11 Έχει η φαινοτυπική ποικιλότητα πάντα γενετικό υπόβαθρο; Ηπερίπτωση της κουτσομούρας (Mullus barbatus)

12 Η μορφολογική ποικιλότητα δεν συμβαδίζει πάντα με τη γενετική διαφοροποίηση

13 Αναδιπλασιασμός του DNA Μοριακοί Δείκτες Μικρές περιοχές του γονιδιώματος που χρησιμοποιούνται ως δείκτες γενετικής ποικιλομορφίας Λάθη Είναι χρήσιμοι μόνο όταν είναι πολυμορφικοί στους πληθυσμούς 3 εκατ. πολυμορφικές θέσεις Single Nucleotide Polymorphisms (SNPs) AGTTCGATTGCTCGATAGCACGAT AGTTCAATTGCTTGATAGCACGAT AGTTCGATTGCTTGATAGCTCGAT Repeats AGTTCAATTGCTTGATAGCGCGAT AGTTCAATTGCTTGCTTGCTTGATAGCGCGAT Deletions AGTTCAATTGATAGCGCGAT

14 Γιατί μοριακοί δείκτες; Ενυπάρχουν στα άτομα (δεν μπορούν να χαθούν) Κληρονομήσιμοι (ταυτοποίηση απογόνων) Δεν καταστρέφεται το δείγμα (δεν απαιτείται θανάτωση του ζώου) Πολλοί διαφορετικοί δείκτες: Ισοένζυμα Αλληλουχίες μιτοχονδριακού (mt( mt) DNA Αλληλουχίες χλωροπλαστικού (cp) DNA Μικροδορυφορικό DNA Αλληλουχίες πυρηνικού DNA

15 Πυρηνικό DNA Εξωπυρηνικό DNA Μικροδορυφορικό DNA Μικροδορυφόροι είναι τόποι όπου μικρές αλληλουχίες DNA επαναλαμβάνονται στη σειρά η μια αμέσως μετά την άλλη. Χρωμόσωμα Y Μικρό χρωμόσωμα cpdna που προσδιορίζει Μιτοχονδριακό Χρωμόσωμα DNA το (mtdna) φύλο ενός Υ ατόμου. Έμβρυα με Το σπέρμα δίνει μόνο χρωμόσωμα γενετικό υλικό Υ γίνονται αρσενικά. και όχι κυτταρικά οργανίδια. Έτσι, η γενετική Έτσι, πληροφορία του όλο το mtdna προέρχεται χρωμοσώματος από Υ το είναι μόνο ωάριο, το οποίο είναι πατρικής μητρικής προέλευσης. προέλευσης. mtdna

16 Γενετική ποικιλότητα σε χώρο και χρόνο Γιατί είναι σημαντική η γενετική ποικιλότητα; Δυναμικό για αλλαγή της γενετικής δομής προσαρμογή σε περιβαλλοντικές αλλαγές - διατήρηση διαφοροποίηση πληθυσμών - βιοποικιλότητα

17 Γιατί είναι σημαντική η γενετική ποικιλότητα; ποικιλότητα Πλανητική θέρμανση επιβίωση ΕΞΑΦΑΝΙΣΗ!! έλλειψη ποικιλότητας

18 Γιατί είναι σημαντική η γενετική ποικιλότητα; βορράς νότος ποικιλότητα βορράς νότος έλλειψη ποικιλότητας

19 Γιατί είναι σημαντική η γενετική ποικιλότητα; βορράς νότος διαφοροποίηση ποικιλότητα βορράς νότος έλλειψη ποικιλότητας ΧΩΡΙΣ ΔΙΑΦΟΡΟΠΟΙΗΣΗ!!

20 Περιγράφοντας τη Γενετική Δομή γενοτυπικές συχνότητες αλληλομορφικές συχνότητες 200 άσπρα 500 ροζ Γενοτυπικές συχνότητες: 200/1000 = 0.2 rr 300 κόκκινα σύνολο = 1000 λουλούδια 500/1000 = 0.5 Rr 300/1000 = 0.3 RR

21 Περιγράφοντας τη Γενετική Δομή γενοτυπικές συχνότητες αλληλομορφικές συχνότητες 200 rr 500 Rr 300 RR = 400 r = 500 r = 500 R = 600 R αλληλομορφικές συχνότητες: 900/2000 = 0.45 r 1100/2000 = 0.55 R σύνολο = 2000 αλληλόμορφα

22 Για έναν πληθυσμό με γενότυπους: 100 GG 160 Gg 140 gg 260 υπολογίζουμε: Γενοτυπικές συχνότητες 100/400 = 0.25 GG 160/400 = 0.40 Gg 140/400 = 0.35 gg Φαινοτυπικές συχνότητες 260/400 = 0.65 green 140/400 = 0.35 brown Αλληλομορφικές συχνότητες 360/800 = 0.45 G 440/800 = 0.55 g 0.65

23 Ένας άλλος τρόπος να υπολογίσουμε αλληλομορφικές συχνότητες: 100 GG 160 Gg 140 gg Γενοτυπικές συχνότητες 0.25 GG 0.40 Gg 0.35 gg G G g g Αλληλομορφικές συχνότητες 360/800 = 0.45 G 440/800 = 0.55 g /2 = /2 = Ή [ (0.40)/2] = 0.45 [ (0.40)/2] = 0.55

24 Οι συχνότητες ισοδυναμούν με πιθανότητες. Επομένως, η πιθανότητα να πάρουμε τυχαία από τον πληθυσμό ένα άτομο RR είναι ίση με f(rr) και η πιθανότητα να πάρουμε τυχαία, από ένα σύνολο γαμετών, ένα γαμέτη που φέρει το αλληλόμορφο R είναι ίση με f(r).

25 ΤΥΧΑΙΕΣ ΣΥΖΕΥΞΕΙΣ Τυχαίες συζεύξεις (random matings ή panmixia), είναι το σύστημα συζεύξεων κατά το οποίο κάθε άτομο έχει την ίδια πιθανότητα να συζευχθεί με οποιοδήποτε άλλο άτομο του αντίθετου φύλου στον πληθυσμό ΠΙΘΑΝΟΤΗΤΕΣ ΣΥΖΕΥΞΗΣ Η πιθανότητα της τυχαίας σύζευξης μεταξύ δύο ζώων με γνωστό γενότυπο, είναι ίση με το γινόμενο των γενοτυπικών τους συχνοτήτων

26 Για παράδειγμα υπάρχουν 9 δυνατοί συνδυασμοί συζεύξεων, όταν έχουμε ένα χαρακτηριστικό που καθορίζεται από ένα ζεύγος αλληλόμορφων (έστω Β και b) και με την προϋπόθεση πόθεση ότι οι γενοτυπικές συχνότητες είναι ίσες στα αρσενικά και τα θηλυκά άτομα Αρσενικό Θηλυκό Συχνότητα σύζευξης ΒΒ ΒΒ f(bb) x f(bb) ΒΒ Βb f(bb) x f(bb Bb) ΒΒ Βb Βb Βb bb bb bb bb f(bb) x f(bb bb) BB f(bb Bb) ) x f(bb) Bb f(bb Bb) ) x f(bb Bb) bb f(bb Bb) ) x f(bb bb) BB f(bb bb) ) x f(bb) Bb f(bb bb) ) x f(bb Bb) bb f(bb bb) ) x f(bb bb)

27 Ο Νόμος των Hardy-Weinberg (1908) Σε μεγάλους παμμικτικούς πληθυσμούς, εφόσον δεν συμβαίνουν γεγονότα που μεταβάλλουν τη συχνότητα των γονιδίων (όπως μετάλλαξη, μετανάστευση ή επιλογή), οι γενοτυπικές και γονιδιακές συχνότητες παραμένουν σταθερές από τη μια γενιά στην επόμενη και ο πληθυσμός βρίσκεται σε ισορροπία ή ισοζύγιο

28 Νόμος των Hardy Weinberg: Γονιδιακή δεξαμενή A a AA (p+q) 2 Αλλημορφικές συχνότητες Aa Γενοτυπικές συχνότητες Απεριόριστοι πληθυσμοί Τυχαίες συζεύξεις aa = p 2 +2pq +q 2 = 1 Μη επίδραση δυνάμεων που μεταβάλλουν τις γονιδιακές συχνότητες Ισορροπία HW: η συχνότητες των αλληλομόρφων παραμένουν σταθερές από γενιά σε γενιά, κάτω από ορισμένες συνθήκες

29 Τα αποτελέσματα των γενοτυπικών συχνοτήτων μπορούν να προκύψουν από την ανάπτυξη του διωνύμου: (pb + qb) 2 = p 2 BB + 2pqBb + q 2 bb Το άθροισμα των πιθανοτήτων να ληφθεί το γονίδιο Β ή το γονίδιο b είναι ίσο με τη μονάδα p + q = 1 Παρομοίως το άθροισμα των συχνοτήτων όλων των πιθανών ενδεχόμενων θα είναι ίσο με τη μονάδα p 2 + 2pq + q 2 = 1

30 Άλλη σημαντική εφαρμογή είναι πως για τα σπάνια αλληλόμορφα, υπάρχουν πολλοί περισσότεροι ετεροζυγώτες από ότι ομοζυγώτες για το σπάνιο αλληλόμορφο

31 ΠΑΡΑΔΕΙΓΜΑ 2 Η κατανομή του χρωματισμού του τριχώματος σε ένα δείγμα βοοειδών Angus, ήταν η ακόλουθη Φαινότυπος Γενότυπος Αριθμός ζώων μαύρα ΒΒ ή Ββ 640 λευκά ββ 360 Σύνολο 1000 Εάν ο πληθυσμός βρίσκεται σε ισοζύγιο, τότε η εκτίμηση της συχνότητας q είναι, q = f(bb bb) ) = 360/1000 = 0,6 και p = -q 1q = 0,4 και οι συχνότητες p και q μπορούν να χρησιμοποιηθούν για την εκτίμηση των f(bb) και f(ββ Ββ): f(bb) = p 2 = 0,16 και f(bb Bb) ) = 2pq = 0,48


33 ΠΟΛΛΑΠΛΑ ΑΛΛΗΛΟΜΟΡΦΑ Έστω τα αλληλόμορφα Α 1, Α 2 και Α 3 με γονιδιακές συχνότητες f(a 1 ) = p, f(a 2 ) = q, f(a 3 ) = r Σε κατάσταση ισορροπίας εφόσον p + q + r = 1 (pa1+qa2+ra3) 2 = (p+q+r( p+q+r) 2 = p 2 +2pq+2pr+q 2 +2qr+r 2 = 1 Η πιθανότητα να συναντήσουμε τυχαία στον πληθυσμό έναν γενότυπο θα είναι f(a 1 A 1 ) = p 2, f(a 1 A 2 ) = 2pq, f(a 1 A 3 ) = 2pr, f(a 2 A 2 ) = q 2, f(a 2 A 3 ) = 2qr, f(a 3 A 3 ) = r 2

34 ΠΑΡΑΔΕΙΓΜΑ 5 Ο χρωματισμός τριχώματος στα mink ελέγχεται από 3 αλληλόμορφα Α1> 1>Α2> 2>Α3. Σε 1000 mink οι φαινότυποι ήταν οι ακόλουθοι: Γενοτυπική συχνότητα Γενότυπος Α 1 Α 1 p 2 Α 1 Α 2 Α 1 Α 3 2pr Α 2 Α 2 q 2 Α 2 Α 3 2qr Α 3 Α 3 r 2 2pq Φαινότυπος Αριθμός φαινοτύπων Mαύρος 910 Μπλέ 80 Πλατίνα 10 Σύνολο 1000 Η εκτίμηση της συχνότητας του υποτελούς Α 3 θα είναι: r = f(a 3 A 3 ) = 10/1000 = 0,1 q 2 + 2qr = 0,08 επειδή r = 0,1 q 2 + 2q(0,1) = 0,08 q 2 + 0,2q = 0,08 q 2 + 0,2q - 0,08 = 0 (q+0,4) (q-0,2) = 0 q -0,4 ή 0,2 επειδή οι συχνότητες πρέπει να είναι > = 0 q = 0,2 εφόσον p + q + r = 1 p = 0,7 Επομένως p = 0,7 q = 0,2 r = 0,1




38 Ισλανδία Πληθυσμός (2007) Εμβαδόν km 2 Απόσταση από την ηπειρωτική Ευρώπη 970 km Google Earth

39 Παράδειγμα από τον Ισλανδικό Πληθυσμό: Ομάδα αίματος ΜNΜ Δείγμα πληθυσμού 747 Φαινότυποι Γενότυποι Συμβολή στη γονιδιακή δεξαμενή Τύπος M M m M m M m αλληλ. ανά άτομο Τύπος MN 1 M m αλληλ. ανά άτομο M m M n M n αλληλ. ανά άτομο Σύνολο M m αλληλ. = (2 x 233) + (1 x 385) = 851 Σύνολο M n αλληλ. = (2 x 129) + (1 x 385) = 643 Σύνολο και των δύο αλληλ. =1494 = 2 x 747 Συχνότητα M m = 851/1494 = 0.57 ή 57% Συχνότητα M n = 643/1494 = 0.43 ή 43% Τύπος N M n M n M n αλληλ. ανά άτομο

40 Υποθέτουμε ότι συμβαίνει τυχαία αναπαραγωγή ΩΑΡΙΑ M m 0.57 M n 0.43 M m 0.57 M m M m 0.32 M m M n 0.25 ΣΠΕΡΜΑ M n 0.43 M m M n 0.25 M n M n 0.18 Αρκετά κοντά στη γενετική ισορροπία Γενότυποι Αναμενόμενες συχνότητες Παρατηρούμενες συχνότητες M m M m = 0.31 M m M n = 0.52 M n M n = 0.17

41 Απόδειξη της γενετικής ισορροπίας Η χρήση της εξίσωσης Hardy Weinberg για τον προσδιορισμό των γονοτυπικών συχνοτήτων από της γονιδιακές συχνότητες ίσως φανεί ένα κυκλικό επιχείρημα 2008 Paul Billiet ODWS

42 Μόνο ένας από τους παρακάτω πληθυσμούς είναι σε γενετική ισορροπία. Ποιος; Δείγμα πληθυσμού AA Γενότυποι Aa Γον. συχνότητες aa A a

43 Μόνο ένας από τους παρακάτω πληθυσμούς είναι σε γενετική ισορροπία. Ποιος; Δείγμα πληθυσμού AA Γενότυποι Aa aa Γον. συχνότητες A a

44 Μόνο ένας από τους παρακάτω πληθυσμούς είναι σε γενετική ισορροπία. Ποιος; Δείγμα πληθυσμού AA Γενότυποι Aa Γον. συχνότητες aa A a

45 Δρεπανοκυτταρική αναιμία στη Δυτική Αφρική, ένα ισοζυγισμένος πολυμορφισμός β haemoglobin gene Normal allele Hb N Sickle allele Hb S Phenotypes Normal Sickle Cell Trait Sickle Cell Anaemia Alleles Genotypes Hb N Hb N Hb N Hb S Hb S Hb S Hb N Hb S Observed frequencies Expected frequencies

46 Δρεπανοκυτταρική αναιμία στη Δυτική β haemoglobin gene Normal allele Hb N Sickle allele Hb S Phenotypes Genotypes Observed frequencies Expected frequencies Αφρική, ένα ισοζυγισμένος πολυμορφισμός Normal Hb N Hb N Sickle Cell Trait Hb N Hb S Sickle Cell Anaemia Hb S Hb S Alleles Hb N 0.76 Hb S Paul Billiet ODWS

47 Δρεπανοκυτταρική αναιμία στη Δυτική Αφρική, ένα ισοζυγισμένος πολυμορφισμός Phenotypes Normal Sickle Cell Trait Sickle Cell Anaemia Alleles Genotypes Hb N Hb N Hb N Hb S Hb S Hb S Hb N Hb S Observed frequencies Expected frequencies Paul Billiet ODWS

48 Δρεπανοκυτταρική αναιμία στη Δυτική Αφρική, ένα ισοζυγισμένος πολυμορφισμός Phenotypes Genotypes Normal Hb N Hb N Sickle Cell Trait Hb N Hb S Sickle Cell Anaemia Hb S Hb S Alleles Hb N Hb S Observed frequencies Expected frequencies Paul Billiet ODWS

49 ΥΠΟΤΕΛΗ ΑΛΛΗΛΟΜΟΡΦΑ ΠΑΡΑΔΕΙΓΜΑ: : Ο ΑΛΦΙΣΜΟΣ ΣΤΟΝ ΒΡΕΤΑΝΙΚΟ ΠΛΗΘΥΣΜΟ Συχνότητα του αλφικού φαινοτύπου = 1 στα ή A = Αλληλόμορφο φυσιολογικού χρώματος, Συχνότητα = p a = Αλληλόμορφο αλφισμού (χωρίς χρώμα) Συχνότητα = q Φαινότυποι Γενότυποι Hardy Weinberg συχνότητες Παρατηρούμενες συχνότητες Φυσιολογικό Φυσιολογικό AA p 2 Aa 2pq Αλφικό aa q

50 Γονιδιακές συχνότητες αλφισμού Φυσιολογικό αλληλόμορφο = A = p = ; Αλφικό αλληλόμορφο = a = q = ( ) = ή 0,7% Πόσοι Βρετανοί είναι φορείς του αλφικού αλληλομόρφου (Aa)? a = q = A = p = ; Όμως p + q = 1, Άρα p = 1-1 q = = or 99.3% Συχνότητες ετερόζυγων (Aa)) = 2pq= = 2 x x = or 1.4%

51 Παράδειγμα: : Ομάδα αίματος Rhesus στην Ευρώπη Ποια είναι η πιθανότητα μια γυναίκα rhesus αρνητική (rhrh) να παντρευτεί κάποιον που θα θέσει το παιδί της σε κίνδυνο (rhesus ασυμβατότητα Rh μητέρα με ένα Rh + έμβρυο); Ομάδα αίματος Rhesus Ένα rhesus θετικό έμβρυο είναι πιθανό εάν ο πατέρας είναι rhesus θετικός RhRh x rhrh 100% πιθανότητα Rhrh x rhrh 50% πιθανότητα

52 Ομάδα αίματος Rhesus Rhesus θετικό αλληλόμορφο υπερέχον Rh Συχνότητα = p Rhesus αρνητικό αλληλόμορφο υποτελές rh Συχνότητα = q Συχνότητα του rh αλληλομόρφου = 0.4 = q Αν p + q = 1 Τότε Rh αλληλόμορφο = p = 1 q = = 0.6 Συχνότητα των rhesus θετικών φανοτύπων = RhRh + Rhrh = p 2 + 2pq = (0.6) 2 + (2 x 0.6 x 0.4) = 0.84 or 84% 2008 Paul Billiet ODWS

53 Ομάδα αίματος Rhesus Φαινότυποι Γενότυποι Hardy Weinberg συχνότητες Rhesus θετικό RhRh p 2 Rhesus θετικό Rhrh 2pq Παρατηρούμενες συχνότητες 0.84 Rhesus αρνητικό rhrh q Επομένως μια rhesus αρνητική Ευρωπαία γυναίκα έχει 84% πιθανότητα να πάρει σύζυγο που θα είναι rhesus θετικός Από τους οποίους 36% θα παράγουν rhesus θετικά παιδιά και 48% θα παράγουν rhesus θετικά παιδία στις μισές γεννήσεις


ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) ΠΡΟΓΡΑΜΜΑ ΔΙΑ ΒΙΟΥ ΜΑΘΗΣΗΣ ΑΕΙ ΓΙΑ ΤΗΝ ΕΠΙΚΑΙΡΟΠΟΙΗΣΗ ΓΝΩΣΕΩΝ ΑΠΟΦΟΙΤΩΝ ΑΕΙ (ΠΕΓΑ) «Οι σύγχρονες τεχνικές βιο-ανάλυσης στην υγεία, τη γεωργία, το περιβάλλον και τη διατροφή» Η Συμβολή της Μοριακής Βιολογίας

Διαβάστε περισσότερα

Πληθυσμός: Φαινοτυπικές συχνότητες 10/15 κόκκινα και 3/15 πράσινα

Πληθυσμός: Φαινοτυπικές συχνότητες 10/15 κόκκινα και 3/15 πράσινα Πληθυσμός: Φαινοτυπικές συχνότητες 10/15 κόκκινα και 3/15 πράσινα Ο πληθυσμός έχει γενότυπικες συχνότητες Συνολικά = 15 άτομα, συχνότητες = 8/15 (53%) = 4/15 (27%) = 3/15 (20%) Τα άτομα έχουν 2 αλληλόμορφα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πληθυσμιακή και Εξελικτική Γενετική

Πληθυσμιακή και Εξελικτική Γενετική Οικολογία και Προστασία Δασικών Οικοσυστημάτων Πληθυσμιακή και Εξελικτική Γενετική Γενετική Ποικιλότητα Εργαστήριο Δασικής Γενετικής Αριστοτέλης Χ. Παπαγεωργίου apapage@fmenr.duth.gr 25520 41155 6946108940

Διαβάστε περισσότερα

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας

ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ. Ο Mendel καλλιέργησε φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Ο Mendel καλλιέργησε 28.000 φυτά σε διάστημα 8 ετών για να φτάσει στη διατύπωση των νόμων της κληρονομικότητας Λόγοι επιτυχίας των πειραμάτων του Mendel 1. Μελέτησε μία ή δύο

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 18/09/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Η Χαρά

Διαβάστε περισσότερα

Γενετική της ιατήρησης επαπειλούμενων ειδών

Γενετική της ιατήρησης επαπειλούμενων ειδών Γενετική της ιατήρησης επαπειλούμενων ειδών Εκτίμηση γενετικής διαφοροποίησης σε μικρούς πληθυσμούς Αιμομικτική κατάπτωση και γενετικό φορτίο Εκτίμηση ανάγκης - επιτυχίας εμπλουτισμών και εισαγωγής ειδών

Διαβάστε περισσότερα

Πληθυσμιακή Γενετική

Πληθυσμιακή Γενετική Τμήμα Αγροτικής Ανάπτυξης Πληθυσμιακή Γενετική Γενετική Ποικιλότητα Κων/νος Τζανταρμάς Αριστοτέλης Παπαγεωργίου Κλάδοι της Γενετικής 1. Κλασική γενετική 2. Μοριακή γενετική 3. Πληθυσμιακή γενετική 4. Ποσοτική

Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 5.1 ΠΡΟΒΛΗΜΑ 5.2 ΠΡΟΒΛΗΜΑ 5.3 ΠΡΟΒΛΗΜΑ 5.1 Στα ποντίκια το σκούρο μάτι απαιτεί την ταυτόχρονη παρουσία των υπερεχόντων αλληλομόρφων γονιδίων R και Q. Ζώα ομοζυγωτικά για ένα από τα δύο ή και τα δύο υποτελή αλληλόμορφα έχουν ανοιχτόχρωμα

Διαβάστε περισσότερα



Διαβάστε περισσότερα


Κεφάλαιο 5: ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ Κεφάλαιο 5: ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ -ΘΕΩΡΙΑ- Κληρονομικότητα: Η ιδιότητα των ατόμων να μοιάζουν με τους προγόνους τους. Κληρονομικοί χαρακτήρες: Οι ιδιότητες που κληρονομούνται στους απογόνους. Γενετική:

Διαβάστε περισσότερα

Δασική Γενετική Τα πειράματα του Mendel

Δασική Γενετική Τα πειράματα του Mendel Δασική Γενετική Τα πειράματα του Mendel Χειμερινό εξάμηνο 2014-2015 Παράδοξο... Οι απόγονοι μοιάζουν στους γονείς τους Δεν είναι όμως ακριβώς ίδιοι, ούτε με τους γονείς τους, ούτε μεταξύ τους Κληρονομικότητα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο.

ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. ΠΡΟΒΛΗΜΑ 1.1 Η γαλακτοζαιμία στον άνθρωπο είναι ασθένεια που οφείλεται σε υποτελές γονίδιο και κληρονομείται με απλό Μεντελικό τρόπο. Μια γυναίκα της οποίας ο πατέρας έπασχε από γαλακτοζαιμία θέλει να

Διαβάστε περισσότερα

Μεθοδολογία επίλυσης ασκήσεων Γενετικής

Μεθοδολογία επίλυσης ασκήσεων Γενετικής Μεθοδολογία επίλυσης ασκήσεων Γενετικής Νόμοι του Mendel 1. Σε όλες τις ασκήσεις διασταυρώσεων αναφέρουμε τον 1 ο νόμο του Mendel (νόμο διαχωρισμού των αλληλόμορφων γονιδίων). 2. Σε ασκήσεις διυβριδισμού

Διαβάστε περισσότερα

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει;

Σε τι αναφέρεται η αναλογία 9:3:3:1 του διυβριδισμού και υπό ποιες προϋποθέσεις ισχύει; Σημειώστε τον αριθμό των χρωματίδων που υπάρχουν σε ένα κύτταρο του ανθρώπου 1)που μόλις έχει προκύψει από μίτωση 2)στη μετάφαση της μείωσης ΙΙ και 3)στην πρόφαση της μίτωσης. Σε τι αναφέρεται η αναλογία

Διαβάστε περισσότερα


ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΥΠΟΔΕΙΓΜΑΤΙΚΑ ΛΥΜΕΝΕΣ ΑΣΚΗΣΕΙΣ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΑΥΤΟΣΩΜΙΚΑ ΕΠΙΚΡΑΤΗ-ΥΠΟΛΕΙΠΟΜΕΝΑ 1. Διασταυρώνονται δυο μοσχομπίζελα, το ένα με κανονικό σχήμα καρπού και το άλλο με περιεσφιγμένο σχήμα. Να βρεθεί

Διαβάστε περισσότερα

Πληθυσμιακή Γενετική

Πληθυσμιακή Γενετική Τμήμα Αγροτικής Ανάπτυξης Πληθυσμιακή Γενετική Υπολογισμός γενετικής ποικιλότητας Κων/νος Τζανταρμάς Αριστοτέλης Παπαγεωργίου Άσκηση Hardy Weinberg 1. Στο ευρωπαϊκό σαλιγκάρι της ξηράς Cepaea nemoralis

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 8/09/06 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων

Τα γονίδια που βρίσκονται στην ίδια γενετική θέση χων ομόλογων χρωμοσωμάτων ΚεφόΑηιο 5 ΜενδεΠική κπηρονουικότηϊα 1. Συμπληρώστε με τις κατάλληλες λέξεις τα κενά στο κείμενο: Τα γονίδια που βρίσκονται στην ίδια γενετική θέση των ομόλογων χρωμοσωμάτων και ελέγχουν την ίδια ιδιότητα

Διαβάστε περισσότερα

Θέματα Πανελλαδικών

Θέματα Πανελλαδικών Θέματα Πανελλαδικών 2000-2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ ΟΜΟΓΕΝΩΝ Κεφάλαιο 5 Περιεχόμενα Περιεχόμενα 1 Κεφάλαιο 1 ο Το γενετικό υλικό Θέμα 1 ο 2 Θέμα 2 ο 8 Θέμα

Διαβάστε περισσότερα

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία

Στην αυτοσωμική υπολειπόμενη κληρονομικότητα: κυστική ίνωση Στη φυλοσύνδετη υπολειπόμενη κληρονομικότητα: αιμορροφιλία ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ 1-2-2015 ΘΕΜΑ Α Α1. γ Α2. γ Α3. β Α4. γ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2. Τα άτομα μπορεί να χαρακτηρίζονται ως φορείς στην αυτοσωμική

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με κίτρινο χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με

Διαβάστε περισσότερα

Θέματα Πανελλαδικών 2000-2013

Θέματα Πανελλαδικών 2000-2013 Θέματα Πανελλαδικών 2000-2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΗΜΕΡΗΣΙΩΝ ΛΥΚΕΙΩΝ ΕΣΠΕΡΙΝΩΝ ΛΥΚΕΙΩΝ ΕΠΑΝΑΛΗΠΤΙΚΕΣ Κεφάλαιο 5 ΚΕΦΑΛΑΙΟ 5 ΘΕΜΑ 1 ο Γράψτε τον αριθμό καθεμιάς από τις παρακάτω προτάσεις και δίπλα το γράμμα

Διαβάστε περισσότερα

Δασική Γενετική Εισαγωγή: Βασικές έννοιες

Δασική Γενετική Εισαγωγή: Βασικές έννοιες Δασική Γενετική Εισαγωγή: Βασικές έννοιες Χειμερινό εξάμηνο 2014-2015 Γενετική Πειραματική επιστήμη της κληρονομικότητας Προέκυψε από την ανάγκη κατανόησης της κληρονόμησης οικονομικά σημαντικών χαρακτηριστικών

Διαβάστε περισσότερα


ΠΡΟΒΛΗΜΑ 3.1 r/r III ΠΡΟΒΛΗΜΑ 3.2 ΠΡΟΒΛΗΜΑ 3.1 'Ένα υποτελές αλληλόμορφο r είναι υπεύθυνο για την εμφάνιση κόκκινου τριχώματος στις αγελάδες, ενώ το υπερέχων του αλληλόμορφο R προκαλεί σκούρο χρωματισμό. Στο παρακάτω γενεαλογικό δένδρο

Διαβάστε περισσότερα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα

B5-Κεφάλαιο 5: Μεντελική κληρονομικότητα A) Ερωτήσεις με πολλές πιθανές απαντήσεις Να βάλετε σε κύκλο το γράμμα ή τα γράμματα που αντιστοιχούν στη σωστή φράση ή στη φράση που συμπληρώνει σωστά την πρόταση, αν υπάρχει. 1. Από οποιοδήποτε φαινότυπο

Διαβάστε περισσότερα

Γενετική πληθυσμών. Εισαγωγή στη Δασική Γενετική. Χειμερινό εξάμηνο

Γενετική πληθυσμών. Εισαγωγή στη Δασική Γενετική. Χειμερινό εξάμηνο Εισαγωγή στη Δασική Γενετική Γενετική πληθυσμών Χειμερινό εξάμηνο 2014-2015 Δημοκρίτειο Πανεπιστήμιο Θράκης, Ορεστιάδα Τμήμα Δασολογίας & Διαχείρισης Περιβάλλοντος & Φυσικών Πόρων Εργαστήριο Δασικής Γενετικής

Διαβάστε περισσότερα


ΓΕΝΕΤΙΚΗ AAT TCG CGA TTCC ΓΕΝΕΤΙΚΗ 1. Το πιο κάτω γενεαλογικό δέντρο δείχνει τον τρόπο κληρονόμησης μιας ασθένειας σε μια οικογένεια. Τα μαυρισμένα τετράγωνα συμβολίζουν αρσενικά άτομα με την πάθηση και οι μαυρισμένοι κύκλοι θηλυκά

Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου

Βιολογία Κατεύθυνσης Γ Λυκείου Βιολογία Κατεύθυνσης Γ Λυκείου Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ A Να γράψετε τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις A1 έως A5 και δίπλα το γράμμα που αντιστοιχεί στη φράση, η οποία

Διαβάστε περισσότερα

Κυριακή 15/02/2015 Ημερομηνία

Κυριακή 15/02/2015 Ημερομηνία Διαγώνισμα 2014-15 Ενδεικτικές απαντήσεις Κυριακή 15/02/2015 Ημερομηνία Βιολογία Κατεύθυνσης Εξεταζόμενο μάθημα Γ Λυκείου Τάξη Θέμα 1 ο : 1 α, 2 γ, 3 ε, 4 α, 5 ε Θέμα 2 ο : Α. Η απεικόνιση των μεταφασικών

Διαβάστε περισσότερα

Πληθυσμιακή και Ποσοτική Γενετική. Εξέλιξη

Πληθυσμιακή και Ποσοτική Γενετική. Εξέλιξη Πληθυσμιακή και Ποσοτική Γενετική Εξέλιξη Σύνοψη Οι πληθυσμοί χαρακτηρίζονται από τις συχνότητες των γενοτύπων και των αλληλομόρφων τους Κάθε πληθυσμός έχει τη δική του γενετική «δομή» Μπορούμε να μετρήσουμε

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο ΒΙΟΛΟΓΙΑ Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ 2007 ΕΚΦΩΝΗΣΕΙΣ Να γράψετε στο τετράδιό σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή τη φράση,

Διαβάστε περισσότερα

Βελτίωση Φυτών. Βελτίωση Σταυρογονιμοποιούμενων φυτών. Είδη ποικιλιών

Βελτίωση Φυτών. Βελτίωση Σταυρογονιμοποιούμενων φυτών. Είδη ποικιλιών Βελτίωση Σταυρογονιμοποιούμενων φυτών Είδη ποικιλιών Πληθυσμοί ελεύθερης επικονίασης (OP) Είναι ετερογενείς και ετεροζύγωτοι πληθυσμοί που παράγονται με ανοιχτή, χωρίς έλεγχο επικονίαση. Η επιλογή τέτοιου

Διαβάστε περισσότερα

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις

ΕΦΗ ΜΙΧΟΠΟΥΛΟΥ. Γενετική του Φύλου Ι ασκήσεις Γενετική του Φύλου Ι ασκήσεις 1. Δώστε το φύλο των πιο κάτω ατόμων στη Drosophila: α) ΑΑΧΧΧΧ, β) ΑΑΑΑΧΧΧ, γ) ΑΑΑΧ δ) ΑΑΑΑΧΧΧΧ, ε) ΑΑΧΧΥ. Υπολογίζουμε την αναλογία Χ/Α. Υπερράρεν (0,5) Άρρεν Μεσόφυλο (1)

Διαβάστε περισσότερα

Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης.

Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης. ΓΥΜΝΑΣΙΟ ΚΕΡΑΤΕΑΣ Οι μονογονιδιακοί χαρακτήρες στον άνθρωπο και ο τρόπος κληρονόμησης. Μαθητές: Όλγα Ντριζάη, Κυριακή Πρίφτη 2013 ΕΙΣΑΓΩΓΗ Είναι γνωστό και εύκολα µπορεί να παρατηρηθεί ότι όλα τα άτοµα

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΣΕΙΡΑ: ΘΕΡΙΝΑ ΗΜΕΡΟΜΗΝΙΑ: 26/01/2014 ΘΕΜΑ 1 Ο Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Αλλαγές στην ποσότητα

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ Α ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 «Τα κύτταρα των οργάνων να είναι επιτυχείς» Β2. Σελ. 136 «Το 1997 γέννησε την Dolly»

Διαβάστε περισσότερα

5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες

5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες 5. ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 5.1. Η έννοια της κληρονομικότητας και της Γενετικής, Πολλαπλασιασμός - Αναπαραγωγή - Γονιμοποίηση Βασικές έννοιες Ποιος είναι ο σκοπός της αναπαραγωγής ; Η δημιουργία απογόνων

Διαβάστε περισσότερα

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων

Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων Βιολογία Θετικής Κατεύθυνσης 22 Μαΐου 2015 Ενδεικτικές Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. Α: 1, 4, 5, 6 Β: 2, 3, 7, 8 Β2. Βλέπε σχολικό εγχειρίδιο σελ. 41-42 «Κατά την έναρξη

Διαβάστε περισσότερα


ΦΥΣΙΚΗ ΕΠΙΛΟΓΗ ΚΑΙ ΓΕΝΕΤΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΠΛΗΘΥΣΜΩΝ ΦΥΣΙΚΗ ΕΠΙΛΟΓΗ ΚΑΙ ΓΕΝΕΤΙΚΗ ΣΥΣΤΑΣΗ ΤΩΝ ΠΛΗΘΥΣΜΩΝ ΦΥΣΙΚΗ ΕΠΙΛΟΓΗ Δεν μπορεί να ερμηνευθεί ανθρωποκεντρικά Δεν είναι: Η τυφλή και αδυσώπητη έκφραση ενός κόσμου χωρίς «αισθήματα» και προορισμό Η διαδικασία

Διαβάστε περισσότερα


Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 Πανελλήνιες 2015 Προτεινόμενες λύσεις ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΠΑΡΑΣΚΕΥΗ 22 ΜΑΙΟΥ 2015 ΘΕΜΑ Α Α1- β Α2- γ Α3- α Α4- δ Α5- γ ΘΕΜΑ Β Β1. Α: σωματικά κύτταρα στην αρχή της μεσόφασης -> 1,4,5,6 Β: γαμέτης:

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ Α Α1. β Α2. γ Α3. α Α4. δ Α5. γ ΘΕΜΑ Β Β1. 1 Α 2 Β 3 Β 4 Α 5 Α 6 Α 7 Β 8 Β Β2. Σελίδα 40 σχολικού βιβλίου (έκδοση 2014-2015) Η παράγραφος «Έναρξη

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑ Θετική Κατεύθυνση ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελίδα 120 σχολικού βιβλίου : «Τα κύτταρα των οργάνων να είναι επιτυχείς.» Β2. Σελίδα 136 σχολικού βιβλίου : «Το 1997

Διαβάστε περισσότερα

Πληθυσμιακή Γενετική Στόχος: Πληθυσμοί, φυλές, oμάδες, ποίμνια κά Μελέτη: Γενετικής δομής και δυναμικής των γονιδίων σε πληθυσμούς

Πληθυσμιακή Γενετική Στόχος: Πληθυσμοί, φυλές, oμάδες, ποίμνια κά Μελέτη: Γενετικής δομής και δυναμικής των γονιδίων σε πληθυσμούς Πληθυσμιακή Γενετική Στόχος: Πληθυσμοί, φυλές, oμάδες, ποίμνια κά Μελέτη: Γενετικής δομής και δυναμικής των γονιδίων σε πληθυσμούς Πληθυσμιακή Γενετική Έννοιες: Πληθυσμός Φαινοτυπικές και γονοτυπικές συχνότητες

Διαβάστε περισσότερα


ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 29/12/2016 ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ / Γ ΛΥΚΕΙΟΥ ΗΜΕΡΟΜΗΝΙΑ: 29/12/2016 ΘΕΜΑ 1 ο 1. α 2. β 3. γ 4. γ 5. δ ΘΕΜΑ 2ο Β1. Σημειώστε κάθε πρόταση με Σωστό ή Λάθος παραθέτοντας μια σύντομη δικαιολόγηση

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ ΛΥΚΕΙΟΥ ΘΕΜΑ 1ο Να γράψετε στο τετράδιο σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη φράση που συμπληρώνει

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ

ΑΠΑΝΤΗΣΕΙΣ. ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. ε Α2. στ Α3. ε Α4. β Α5. δ ΘΕΜΑ Β Β1. Η απάντηση περιλαμβάνεται στις σελ. 90 91 σχολικού βιβλίου από το παράδειγμα της δρεπανοκυτταρικής αναιμίας πολλές ομοιότητες με την αρχική.

Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ ΑΠΑΝΤΗΣΗ ΤΗΣ ΣΥΝΔΥΑΣΤΙΚΗΣ ΑΣΚΗΣΗΣ 1. Το γενεαλογικό δένδρο είναι η διαγραμματική απεικόνιση των μελών μιας οικογένειας για πολλές γενιές, στην οποία αναπαριστώνται οι γάμοι, η σειρά των γεννήσεων, το φύλο

Διαβάστε περισσότερα

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ.

Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. Απαντήσεις: βιολογια κατευθυνσης 24/02/2013 ΘΕΜΑ 1 ο Α. 1:β, 2:δ, 3:α, 4:β, 5:γ. ΘΕΜΑ 2 ο Α. Σελ 69 σχολικού βιβλίου: «Το μοσχομπίζελο έχει πολλά πλεονεκτήματα... έως και σελ 70 σχολικού..των αποτελεσμάτων».

Διαβάστε περισσότερα

Εισαγωγή στη Δασική Γενετική Οι νόμοι της κληρονομικότητας

Εισαγωγή στη Δασική Γενετική Οι νόμοι της κληρονομικότητας Εισαγωγή στη Δασική Γενετική Οι νόμοι της κληρονομικότητας Χειμερινό εξάμηνο 2014-2015 Σύνοψη Κάθε Οι Τυχαία Τυχαίος Αναλογία άτομο έχει δύο σειρές αλληλομόρφων σε κάθε γονίδιο γαμέτες έχουν ένα από τα

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6

ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. ΑΡΓΥΡΗΣ ΓΙΑΝΝΗΣ: Προβλήματα Γενετικής Μενδελική κληρονομικότητα 1/6 ΠΡΟΒΛΗΜΑΤΑ ΓΕΝΕΤΙΚΗΣ. Σε ένα είδος φυτών διακρίνονται δυο χρώματα άνθους, το κίτρινο και το λευκό. Για να διαπιστωθεί το είδος του γονιδίου που ελέγχει την ιδιότητα αυτή αλλά και ο τρόπος κληρονόμησής

Διαβάστε περισσότερα

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά

ΠΡΟΒΛΗΜΑ 4.1 ΠΡΟΒΛΗΜΑ 4.2 ΠΡΟΒΛΗΜΑ 4.3 Ζευγάρια Παιδιά ΠΡΟΒΛΗΜΑ 4.1 Στο σιτάρι, φυτά με κόκκινους σπόρους διασταυρώθηκαν με φυτά που είχαν λευκούς. Όλοι οι απόγονοι είχαν κόκκινους σπόρους. Μετά από την αυτογονιμοποίηση των φυτών της F 1, πήραμε στην F 2 :

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α Α1. α Α2. γ Α3. δ Α4. β Α5. γ ΘΕΜΑ Β Β1. Σελ. 120 την κουκίδα «Για την επιλογή οργάνων συμβατών για μεταμόσχευση.» Β2. Σελ. 136 «Το πρόβατο Dolly» έως «γέννησε τη Dolly.»

Διαβάστε περισσότερα

ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ. Βιολογία Κατεύθυνσης Γ Λυκείου Ασκήσεις 5 ου Κεφαλαίου

ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ. Βιολογία Κατεύθυνσης Γ Λυκείου Ασκήσεις 5 ου Κεφαλαίου ΑΣΚΗΣΕΙΣ ΓΕΝΕΤΙΚΗΣ 1) Από την διασταύρωση ταύρου χωρίς κέρατα α) με αγελάδα που έχει κέρατα, γεννήθηκε μοσχάρι χωρίς κέρατα, β) επίσης με αγελάδα που έχει κέρατα, γεννήθηκε μοσχάρι με κέρατα γ) με αγελάδα

Διαβάστε περισσότερα

DNA στα μιτοχόνδρια και τους χλωροπλάστες (1963)

DNA στα μιτοχόνδρια και τους χλωροπλάστες (1963) DNA στα μιτοχόνδρια και τους χλωροπλάστες (1963) ΕΙΔΟΣ mtdna Κύτταρα Μόρια ανά Οργανίδια DNA οργανιδίου οργανίδιο ανά κύτταρο ως % συνολικού κυτταρικού DNA Αρουραίος Συκώτι 5-10 1000 1% άνθρωπος Hela 10

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΔΙΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Από τη διασταύρωση μοσχομπίζελων προκύπτουν στην επόμενη γενιά τα εξής άτομα: 110 άτομα με χρώμα σπέρματος και ιώδες χρώμα άνθους. 109 άτομα με χρώμα

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 ΘΕΜΑ 1ο 1. δ, ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΚΑΤΕΥΘΥΝΣΗΣ 01-06-2004 2. β, 3. β, 4. γ, 5. δ. ΘΕΜΑ2ο 1. Σχολικό βιβλίο, σελίδα 31: «Υπάρχουν τέσσερα είδη μορίων RNA και το μεταφέρει στη θέση της πρωτεϊνοσύνθεσης».

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑ Α Β ) 2012 ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί

Διαβάστε περισσότερα


ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 ΔΙΑΓΩΝΙΣ:ΜΑ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ Γ Λυκείου 23 Φεβρουάριοου 2014 Ονοματεπώνυμο εξεταζόμενου:. ΘΕΜΑ 1 Ο Να απαντήσετε στις ερωτήσεις πολλαπλής επιλογής: 1. Η ανευπλοειδία είναι είδος μετάλλαξης που οφείλεται:

Διαβάστε περισσότερα


Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ Σάββατο, 26 Μαΐου 2007 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ 1o Να γράψετε στο τετράδιο σας τον αριθµό καθεµιάς από τις παρακάτω ηµιτελείς προτάσεις 1 έως 5 και δίπλα το γράµµα που αντιστοιχεί στη λέξη ή

Διαβάστε περισσότερα

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΑΠΑΝΤΗΣΕΙΣ ΒΙΟΛΟΓΙΑΣ ΚΑΤΕΥΘΥΝΣΗΣ / Γ ΛΥΚΕΙΟΥ (ΧΕΙΜΕΡΙΝΑ) ΣΕΙΡΑ: ΗΜΕΡΟΜΗΝΙΑ: 17/02/2013 ΘΕΜΑ 1 Ο Α. Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Τα

Διαβάστε περισσότερα

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο

Μεθοδολογία Ασκήσεων ΚΕΦ. 5ο Μεθοδολογία Ασκσεων ΚΕΦ. 5ο Θα πρέπει να γνωρίζετε τα ακόλουθα: Γαμέτες. Κάθε γαμέτης περιέχει μόνο το ένα αλληλόμορφο από κάθε ζευγάρι γονιδίων. Όταν τα γονίδια βρίσκονται σε διαφορετικά ζεύγη ομόλογων

Διαβάστε περισσότερα

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α. Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση.

ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α. Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση. ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ ΣΤΗ ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΜΑ Α Α1. Για τις παρακάτω προτάσεις να επιλέξετε τη σωστή απάντηση. 1. Έχοντας στη διάθεσή μας στο εργαστήριο αμιγή στελέχη για ένα συγκεκριμένο χαρακτηριστικό

Διαβάστε περισσότερα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα

Κεφάλαιο 5: Μενδελική Κληρονομικότητα Κεφάλαιο 5: Μενδελική Κληρονομικότητα ΕΛΕΓΧΟΣ ΓΝΩΣΕΩΝ 1. Ο Mendel. α. εξέταζε σε κάθε πείραμά του το σύνολο των ιδιοτήτων του μοσχομπίζελου β. χρησιμοποιούσε αμιγή στελέχη στις ιδιότητες που μελετούσε

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 30 Μαίου 2012 Απαντήσεις Θεμάτων ΘΕΜΑ Α Α1. Η διπλά έλικα του DNA ξετυλίγεται κατά την μεταγραφή

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Το DNA ως γενετικό υλικό παρουσιάζει κάποιες ιδιότητες:

Το DNA ως γενετικό υλικό παρουσιάζει κάποιες ιδιότητες: 1 ΕΝΟΤΗΤΑ 16: ΓΕΝΕΤΙΚΗ 16.1 ΕΙΣΑΓΩΓΗ Γενετική είναι ο κλάδος της Βιολογίας που ασχολείται με την μελέτη της κληρονομικότητας. Κληρονομικότητα είναι η μεταβίβαση χαρακτήρων από τους προγόνους στους απογόνους.

Διαβάστε περισσότερα

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό

Β. Σιωπηλές μεταλλάξεις: όταν προκύπτει συνώνυμο κωδικόνιο, οπότε το αμινοξύ που προκύπτει από τη μετάφραση είναι ίδιο με το φυσιολογικό Θέμα 1 ο 1. α 2. γ 3. γ 4.β 5. δ Θέμα 2 ο Α. Οι νόμοι του Mendel δεν ισχύουν σε πολυγονιδιακούς χαρακτήρες και σε συνδεδεμένα γονίδια (μη ανεξάρτητα), ενώ οι αναλογίες δεν είναι οι αναμενόμενες σε φυλοσύνδετα

Διαβάστε περισσότερα


ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Επαναληπτικό διαγώνισμα ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΚΕΦΑΛΑΙΑ 1-9 ΗΜΕΡΟΜΗΝΙΑ 1/3/2015 ΕΝΔΕΙΚΤΙΚΕΣ ΑΠΑΝΤΗΣΕΙΣ Σημείωση: η διπλή αρίθμηση στις σελίδες αφορά την παλιά και τη νέα έκδοση του σχολικού βιβλίου

Διαβάστε περισσότερα


ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΑΣΚΗΣΕΙΣ ΠΡΟΣ ΛΥΣΗ ΚΕΦ. 5ο ΜΟΝΟΫΒΡΙΔΙΣΜΟΣ ΟΜΑΔΑ Α 1. Αν διασταυρωθούν άτομα μοσχομπίζελου με κίτρινο χρώμα σπέρματος ποιες θα είναι οι φαινοτυπικές και γονοτυπικές αναλογίας της γενιάς; Κ=κίτρινο, κ=πράσινο,

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ Γ Λ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ : 09/09/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ : ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από δύο

Διαβάστε περισσότερα


-ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών -ΜΕΘΟΔΟΛΟΓΙΑ ΑΣΚΗΣΕΩΝ ΓΕΝΕΤΙΚΗΣ- Α. Εύρεση γαμετών Για να βρίσκετε σωστά τους γαμέτες και να σχηματίζονται όλοι οι συνδυασμοί αλληλομόρφων σε αυτούς πρέπει να θυμάστε ότι κάθε γαμέτης περιέχει μόνο ένα

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ

Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Βιολογία Κατεύθυνσης Γ Λυκείου ΚΥΡΙΑΚΗ 9 ΜΑΡΤΙΟΥ 2014 ΑΠΑΝΤΗΣΕΙΣ Επιμέλεια: Δημήτρης Κοτρόπουλος ΘΕΜΑ Α Α1. γ Α2. γ Α3. γ Α4. δ Α5. δ ΘΕΜΑ B B1. Στήλη Ι Στήλη ΙΙ 1. στ 2. ζ 3. ε 4. α 5. δ 6. β 7. γ Β2.

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ: ΒΙΟΛΟΓΙΑ ΟΠ Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 22/01/2017 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε τη φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: 1. Από

Διαβάστε περισσότερα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα

Στα πτηνά το φύλο «καθορίζεται από τη μητέρα». Αυτό γιατί, το αρσενικό άτομο φέρει τα χρωμοσώματα ZZ ενώ το θηλυκό τα ZW. Έτσι εναπόκειται στο που θα 1 Όπως όλοι γνωρίζουμε κάθε ζωντανός οργανισμός αποτελείται από κύτταρα. Μέσα στον πυρήνα των κυττάρων υπάρχουν τα χρωμοσώματα, τα οποία αποτελούν to γενετικό υλικό (DNA). Στα χρωμοσώματα αυτά βρίσκονται

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΘΕΜΑ 1ο Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει

Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015

Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 Πανελλαδικές εξετάσεις Γ Τάξης Ημερήσιου Γενικού Λυκείου Βιολογία Θετικής Κατεύθυνσης Παρασκευή 22 Μαΐου 2015 ΘΕΜΑ Α Α1.β Α2.γ Α3.α Α4.δ Α5.γ ΘΕΜΑ Β Β1. 1A, 2B, 3B, 4A, 5A, 6A, 7B, 8B Β2. σελίδα 40 σχολικού

Διαβάστε περισσότερα


ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑ Α. Α1 γ Α2 β Α3 α Α4 δ Α5 α ΘΕΜΑ Β. ΠΑΝΕΛΛΗΝΙΕΣ 2013 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ Β1. Σελ 123 σχολ. Βιβλίου: Από «Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά το Σεπτέμβριο του 1990»

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ 22 Μαΐου 2015 ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ Απαντήσεις Θεμάτων Πανελληνίων Εξετάσεων Ημερησίων Γενικών Λυκείων ΘΕΜΑ Α Α.1. β Α.2. γ Α.3. α Α.4. δ Α.5. γ ΘΕΜΑ B B.1. 1. A 2. B 3. B 4. A 5. A 6. A 7. B 8.

Διαβάστε περισσότερα

ΓΕ.Λ. Νέου Σκοπού Σερρών Ενδεικτικές απαντήσεις στη Βιολογία Θετικής Κατεύθυνσης

ΓΕ.Λ. Νέου Σκοπού Σερρών Ενδεικτικές απαντήσεις στη Βιολογία Θετικής Κατεύθυνσης 1 ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ Παρασκευή, 22 Μαΐου 2015 ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ A5. γ ΘΕΜΑ Β Μονάδες 5 * 5 = 25 Β1. 1. Α 2. Β 3.

Διαβάστε περισσότερα


ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΑΠΑΝΤΗΣΕΙΣ ΘΕΜΑΤΩΝ ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΧΟΛΙΟ: Τα θέματα είναι πολύ εύκολα και αναμένονται ιδιαίτερα υψηλές βαθμολογίες από τους σωστά προετοιμασμένους υποψηφίους. ΘΕΜΑ Α Α1. δ Α2. β Α3. α Α4.

Διαβάστε περισσότερα

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης

ΑΠΑΝΤΗΣΕΙΣ. Επιµέλεια: Οµάδα Βιολόγων της Ώθησης ΑΠΑΝΤΗΣΕΙΣ Επιµέλεια: Οµάδα Βιολόγων της Ώθησης 1 Παρασκευή, 21 Μαΐου 2010 Γ ΛΥΚΕΙΟΥ ΚΑΤΕΥΘΥΝΣΗΣ ΒΙΟΛΟΓΙΑ ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις Α1

Διαβάστε περισσότερα


ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ ο ΓΕΝΙΚΟ ΛΥΚΕΙΟ ΗΡΑΚΛΕΙΟΥ ΘΕΜΑΤΑ ΕΞΕΤΑΣΕΩΝ ΣΤΗ ΜΕΝ ΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ 00 ΗΜΕΡΗΣΙΟ. Από τη διασταύρωση ενός λευκού µ ένα µαύρο ποντικό όλοι οι απόγονοι είναι γκρίζοι. Τα γονίδια που καθορίζουν το χρώµα

Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα



Διαβάστε περισσότερα



Διαβάστε περισσότερα

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων

Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων. Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015. Απαντήσεις Θεμάτων Πανελλήνιες Εξετάσεις Ημερήσιων Γενικών Λυκείων Εξεταζόμενο Μάθημα: Βιολογία Θετικής Κατεύθυνσης, Ημ/νία: 22 Μαΐου 2015 Απαντήσεις Θεμάτων ΘΕΜΑ Α A1. β A2. γ A3. α A4. δ Α5. γ ΘΕΜΑ Β Β1. 1. Στην πλειονότητά

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις:

ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες προτάσεις: ΜΑΘΗΜΑ / ΤΑΞΗ : ΒΙΟΛΟΓΙΑ ΟΠ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ/Γ ΛΥΚΕΙΟΥ (ΘΕΡΙΝΑ) ΗΜΕΡΟΜΗΝΙΑ: 05/01/2016 ΕΠΙΜΕΛΕΙΑ ΔΙΑΓΩΝΙΣΜΑΤΟΣ: ΝΟΤΑ ΛΑΖΑΡΑΚΗ ΘΕΜΑ Α Να επιλέξετε την φράση που συμπληρώνει ορθά κάθε μία από τις ακόλουθες

Διαβάστε περισσότερα


ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ 27 Μαΐου 2016 ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΘΕΤΙΚΩΝ ΣΠΟΥΔΩΝ Απαντήσεις Θεμάτων Πανελλαδικών Εξετάσεων Ημερησίων Γενικών Λυκείων (Νέο & Παλιό Σύστημα) ΘΕΜΑ Γ Γ.1 Ο χαρακτήρας της ομάδας αίματος στον άνθρωπο

Διαβάστε περισσότερα

5. Η μεταγραφή σ ένα ευκαρυωτικό κύτταρο γίνεται α. στα ριβοσώματα. β. στο κυτταρόπλασμα. γ. στον πυρήνα. δ. στο κεντρομερίδιο.


Διαβάστε περισσότερα



Διαβάστε περισσότερα