Downloaded from ismj.bpums.ac.ir at 15: on Friday February 1st 2019

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Downloaded from ismj.bpums.ac.ir at 15: on Friday February 1st 2019"

Transcript

1 ( ) *. :. :... / / / / : (P=/) (P=/). (P=/) AST (P=/) ALT (P=/) (P =/) (P</)...(R=/) :. : // : // : *

2 / NAFLD.( )...().() ).(.( ). 5. Tumor Necrosis Factorα (TNFα) (NAFLD) (NASH)..() NASH.().() NASH.()..( ) ( ) ( ) 1 NonAlcoholic Fatty Liver Disease 2 Simple Steatosis 3 Non Alcoholic Steatohepatitis 4 Obese 5 Morbid Obesity

3 / / / (Utrecht, the Netherlands.... /.. ( Convex Siemens G40 / Mhz... ( ) () ( ).() ().... A... (Seca 770; Seca / GmbH & Co, Hamburg, Germany) (Lameris, 7 Antinuclear antibody, Antismooth muscle antibody, Antiliver kidney microsomal antibody

4 / NAFLD (.. (+).. :. : : : :. : : : :. : : :. : (.. /.().().( ) 8 Mesenteric leaves

5 / / P.. / ( ) /±/..( ) (Inc, Chicago, IL SPSS) SPSS.. T U ( ρ * ٠/٠٠١ ٣٨/۴±١٠/٣ ۴٢/٣ ± ١٠/۵٠ ٣۵/۶١±٩/٢ () <٠/٠٠١ <٠/٠٠١ ٠/١٣١ ٠/٩۶٧ ٠/۴٠١ ٠/۴٠۶ ٠/٧١٧ ١۶٧/٣±١٠/٢ ٨۴/٠۵±١۴/٧ ٢٩/٩±۴/۴ ٩۶/٠٣±١٧/٢ ٩٩±١٨/٣ ١/٢۵±٠/٧٨ ١٣/۴۴±٣/٠٨ ١۵٧/٠٢±۴/۶ ٧۵/۶±١٢/٢ ٣٠/٧±۴/٩ ٩۵/٩±١٢/٧ ١٠٠/٨±٢٢/۴ ١/١٨±٠/٨۴ ١٣/٣١±٣/١ ١٧۴/٨±۵/۶ ٩٠/٠٩±١٣/٣ ٢٩/٣±۴ ٩۶/٠٩±١٩/٩ ٩٧/٧±١۴/٧ ١/٣١±٠/٧۴ ١٣/۵٣±٣/١٧ (cm) (kg) (kg/m2) (cm) (mg/dl) (mm) / P* (/ P=/) (/ P=/) (/ P=/). AST) (ALT.( ) ( /) : /) ( /).( / ) ( P</) (/

6 / NAFLD ( ρ / / / </ / / / / / / / / / / /±/ /± /±/ ±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /± /±/ /±/ /±/ ±/ /±/ /± /±/ /±/ /±/ /±/ /±/ /± /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ /±/ ±/ /±/ /±/ /±/ /±/ /± /±/ /±/ /± /±/ /±/ () () () () ( ) () ( )HDL ( )LDL ( )AST ( )ALT ( )Alk P ( ) Alkaline phosphatase:alk P, non significant: alanine aminotransferase,:alt, aspartate aminotransferase:ast, Low density lipoprotein:ldl,high density lipoprotein:hdl.( ).(R=/) ( *ρ / / / / / / / / / / / / / *P. P</) (/ (/ P</) (/ P</) (/ p=/) P=/) P</) (/ (/ LDLHDL ALT AST

7 / /.( ).() α.( ) α.().(). ) (.().().().()..( ).().() ( )..().( ). 9 Portal 10 Nonportal

8 / NAFLD..().. ().() ( ) ()..() ().. References: 1.Mills SJ, Harrison SA. Comparison of the natural history of alcoholic and nonalcoholic fatty liver disease. Curr Gastroenterol Rep 2005; 7: Sanyal AJ. AGA technical review on nonalcoholic fatty liver disease. Gastroenterology 2002; 123: Caballeria L, Auladell MA, Toran P, et al. Risk factors associated with nonalcoholic fatty liver disease in subjects from primary care units. A casecontrol study. BMC Gastroenterol 2008; 8: Marchesini G, Marzocchi R. Metabolic syndrome and NASH. Clin Liver Dis 2007;

9 / / 11 : Utzschneider KM, Kahn SE. Review: The role of insulin resistance in nonalcoholic fatty liver disease. J Clin Endocrinol Metab 2006; 91: Hamaguchi M, Kojima T, Takeda N, et al. The metabolic syndrome as a predictor of nonalcoholic fatty liver disease. Ann Intern Med 2005; 143: Angulo P. Nonalcoholic fatty liver disease. N Engl J Med 2002; 346: Stranges S, Dorn JM, Muti P, et al. Body fat distribution, relative weight, and liver enzyme levels: a populationbased study. Hepatology 2004; 39: Eguchi Y, Eguchi T,Mizuta T,et al. Viseral fat accumulation and insulin resistance are important factors in nonalcoholic fatty liver disease. J Gasrtoentrol 2006; 41: Alberti KG, Zimmet P, Shaw J. The metabolic syndromea new worldwide definition. Lancet 2005; 366: RebuffeScrive M, Andersson B, Olbe L, et al. Metabolism of adipose tissue in intraabdominal depots of nonobese men and women. Metabolism 1989; 38: Bjorntorp P. Portal adipose tissue as a generator of risk factors for cardiovascular disease and diabetes. Arteriosclerosis 1990; 10: Bjorntorp P. Metabolic implications of body fat distribution. Diabetes Care 1991; 14: Koda M, Kawakami M, Murawaki Y, et al. The impact of visceral fat in nonalcoholic fatty liver disease: crosssectional and longitudinal studies. J Gastroenterol 2007; 42: Ahima RS, Flier JS. Adipose tissue as an endocrine organ. Trends Endocrinol Metab 2000; 11: Charatcharoenwitthaya P, Lindor KD. Role of radiologic modalities in the management of nonalcoholic steatohepatitis. Clin Liver Dis 2007; 11: Derchi LE, Solbiati L, Rizzatto G, et al. Normal anatomy and pathologic changes of the small bowel mesentery: US appearance. Radiology 1987; 164: Ong JP, Younossi ZM. Epidemiology and natural history of NAFLD and NASH. Clin Liver Dis 2007; 11: Bellentani S, Saccoccio G, Masutti F, et al. Prevalence of and risk factors for hepatic steatosis in Northern Italy. Ann Intern Med 2000; 132: ZelberSagi S, NitzanKaluski D, Halpern Z, et al. Prevalence of primary nonalcoholic fatty liver disease in a populationbased study and its association with biochemical and anthropometric measures. Liver Int 2006; 26: Angulo P, Keach JC, Batts KP, et al. Independent predictors of liver fibrosis in patients with nonalcoholic steatohepatitis. Hepatology 1999; 30: Rinella ME, Alonso E, Rao S, et al. Body mass index as a predictor of hepatic steatosis in living liver donors. Liver Transpl 2001; 7: Fried SK, Kral JG. Sex differences in regional distribution of fat cell size and lipoprotein lipase activity in morbidly obese patients. Int J Obes 1987; 11: Larter CZ, Farrell GC. Insulin resistance, adiponectin, cytokines in NASH: Which is the best target to treat?. J Hepatol 2006; 44: Hotamisligil GS, Peraldi P, Budavari A, et al. IRS1mediated inhibition of insulin receptor tyrosine kinase activity in TNFalpha and obesityinduced insulin resistance. Science 1996; 271: Barzilai N, She L, Liu BQ, et al. Surgical removal of visceral fat reverses hepatic insulin resistance. Diabetes 1999; 48: Thorne A, Lonnqvist F, Apelman J, et al. A pilot study of longterm effects of a novel obesity treatment: omentectomy in connection with adjustable gastric banding. Int J Obes Relat Metab Disord 2002; 26: van der Poorten D, Milner KL, Hui J, et al. Visceral fat: a key mediator of steatohepatitis in metabolic liver disease. Hepatology 2008; 48: Song HR, Yun KE, Park HS, et al. Relation between alanine aminotransferase concentrations and visceral fat accumulation among nondiabetic overweight Korean women. Am J Clin Nutr 2008; 88: Roskams T, Yang SQ, Koteish, et al. Oxidative stress and oval cell accumulation in mice and humans with alcoholic and nonalcoholic fatty liver disease. Am J Pathol 2003; 163: Banfi C, Mussoni L, Rise P, et al. Very low density lipoproteinmediated signal transduction and plasminogen activator inhibitor type 1 in cultured HepG2 cells. Circ Res 1999; 85: Samuel VT, Liu ZX, Qu X, et al. Mechanism of hepatic insulin resistance in

10 / NAFLD nonalcoholic fatty liver disease. J Biol Chem 2004; 279: Furukawa S, Fujita T, Shimabukuro M, et al. Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest 2004; 114: Yajima Y, Ohta K, Narui T, et al. Ultrasonographical diagnosis of fatty liver: significance of the liverkidney contrast. Tohoku J Exp Med 1983; 139: Saadeh S, Younossi ZM, Remer EM, et al. The utility of radiological imaging in nonalcoholic fatty liver disease. Gastroenterology 2002; 123:

ΣΙΣΛΟ ΜΔΛΔΣΗ ΔΠΙΠΔΓΑ ΑΝΣΙΠΟΝΔΚΣΙΝΗ ΣΟΝ ΟΡΟ ΠΑΙΓΙΩΝ ΚΑΙ ΔΦΗΒΩΝ ΜΔ ΠΑΥΤΑΡΚΙΑ. ΤΥΔΣΙΗ ΜΔ ΣΗ ΤΣΑΗ ΣΟΤ ΩΜΑΣΟ ΚΑΙ ΣΗΝ

ΣΙΣΛΟ ΜΔΛΔΣΗ ΔΠΙΠΔΓΑ ΑΝΣΙΠΟΝΔΚΣΙΝΗ ΣΟΝ ΟΡΟ ΠΑΙΓΙΩΝ ΚΑΙ ΔΦΗΒΩΝ ΜΔ ΠΑΥΤΑΡΚΙΑ. ΤΥΔΣΙΗ ΜΔ ΣΗ ΤΣΑΗ ΣΟΤ ΩΜΑΣΟ ΚΑΙ ΣΗΝ ΣΙΣΛΟ ΜΔΛΔΣΗ ΔΠΙΠΔΓΑ ΑΝΣΙΠΟΝΔΚΣΙΝΗ ΣΟΝ ΟΡΟ ΠΑΙΓΙΩΝ ΚΑΙ ΔΦΗΒΩΝ ΜΔ ΠΑΥΤΑΡΚΙΑ. ΤΥΔΣΙΗ ΜΔ ΣΗ ΤΣΑΗ ΣΟΤ ΩΜΑΣΟ ΚΑΙ ΣΗΝ ΑΝΣΙΣΑΗ ΣΗΝ ΙΝΟΤΛΙΝΗ. Υπνβάιιεηαη πξνο έγθξηζε ζηνλ Τνκέα Υγείαο ηνπ Παηδηνύ ηνπ Ιαηξηθνύ

Διαβάστε περισσότερα

Καινοτόμα Προγράμματα της Έδρας UNESCO Εφηβικής Υγείας και Ιατρικής για την Πρόληψη και Αντιμετώπιση της Παιδικής και Εφηβικής Παχυσαρκίας

Καινοτόμα Προγράμματα της Έδρας UNESCO Εφηβικής Υγείας και Ιατρικής για την Πρόληψη και Αντιμετώπιση της Παιδικής και Εφηβικής Παχυσαρκίας Καινοτόμα Προγράμματα της Έδρας UNESCO Εφηβικής Υγείας και Ιατρικής για την Πρόληψη και Αντιμετώπιση της Παιδικής και Εφηβικής Παχυσαρκίας UNESCO Chair in Adolescent Medicine and Health Care Φλώρα Μπακοπούλου

Διαβάστε περισσότερα

Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis

Effects of soothing liver and invigorating spleen recipes of TCM on hepatic inflammatory cytokines of rats with nonalcoholic steatosishepatitis 33 2 Vol. 33 No. 2 2012 4 Journal of Jinan University Medicine Edition Apr. 2012 TNF-α IL-6 IL-1 1 2 1 3 2 2 2 1. 510630 2. 510632 3. 510630 NASH TNF-α 6 IL-6 1 IL-1 NASH NASH 16 HE O ELISA TNF-α IL-6

Διαβάστε περισσότερα

ΠΑΡΟΥΣΙΑΣΕΙΣ ΠΑΙΔΙΑΤΡΙΚΩΝ ΠΕΡΙΠΤΩΣΕΩΝ. Μεταβολικό Σύνδρομο. Νεδελκοπούλου Ναταλία Τριανταφύλλου Παναγιώτα

ΠΑΡΟΥΣΙΑΣΕΙΣ ΠΑΙΔΙΑΤΡΙΚΩΝ ΠΕΡΙΠΤΩΣΕΩΝ. Μεταβολικό Σύνδρομο. Νεδελκοπούλου Ναταλία Τριανταφύλλου Παναγιώτα ΠΑΡΟΥΣΙΑΣΕΙΣ ΠΑΙΔΙΑΤΡΙΚΩΝ ΠΕΡΙΠΤΩΣΕΩΝ 9 Μεταβολικό Σύνδρομο Νεδελκοπούλου Ναταλία Τριανταφύλλου Παναγιώτα Εισαγωγή Το Μεταβολικό Σύνδρομο (ΜΣ) αποτελεί ένα οργανικό σύνδρομο που χαρακτηρίζεται από την

Διαβάστε περισσότερα

Μη Αλκοολική Λιπώδης Νόσος του Ήπατος Οι ανησυχίες του Διαβητολόγου

Μη Αλκοολική Λιπώδης Νόσος του Ήπατος Οι ανησυχίες του Διαβητολόγου Μη Αλκοολική Λιπώδης Νόσος του Ήπατος Οι ανησυχίες του Διαβητολόγου Ν. Τεντολούρης Α' Προπαιδευτική Παθολογική Κλινική και Ειδική Νοσολογία Πανεπιστημίου Αθηνών & Διαβητολογικό Κέντρο Γ. Ν. Α. Λαϊκό Δεν

Διαβάστε περισσότερα

Π.ΠΑΣΧΟΣ, Ε.ΜΠΕΚΙΑΡΗ, Ε.ΑΘΑΝΑΣΙΑΔΟΥ, Μ. ΣΑΡΗΓΙΑΝΝΗ, Α. ΤΣΑΠΑΣ, Κ. ΠΑΛΕΤΑΣ

Π.ΠΑΣΧΟΣ, Ε.ΜΠΕΚΙΑΡΗ, Ε.ΑΘΑΝΑΣΙΑΔΟΥ, Μ. ΣΑΡΗΓΙΑΝΝΗ, Α. ΤΣΑΠΑΣ, Κ. ΠΑΛΕΤΑΣ Π.ΠΑΣΧΟΣ, Ε.ΜΠΕΚΙΑΡΗ, Ε.ΑΘΑΝΑΣΙΑΔΟΥ, Μ. ΣΑΡΗΓΙΑΝΝΗ, Α. ΤΣΑΠΑΣ, Κ. ΠΑΛΕΤΑΣ ΜΟΝΑΔΑ ΜΕΛΕΤΗΣ ΜΕΤΑΒΟΛΙΚΩΝ ΝΟΣΗΜΑΤΩΝ, Β ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΑΠΘ, ΙΠΠΟΚΡΑΤΕΙΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ Το 20 30% του γενικού πληθυσμού

Διαβάστε περισσότερα

ΥΠΕΡΗΧΟΓΡΑΦΙΑ ΗΠΑΤΟΣ ΧΟΛΗΦΟΡΩΝ

ΥΠΕΡΗΧΟΓΡΑΦΙΑ ΗΠΑΤΟΣ ΧΟΛΗΦΟΡΩΝ ΥΠΕΡΗΧΟΓΡΑΦΙΑ ΗΠΑΤΟΣ ΧΟΛΗΦΟΡΩΝ Αγγεία ήπατος Τμηματική ανατομία ήπατος 2 & 3 2 3 1 1 ΠΥΛΑΊΑ ΦΛΕΒΑ 8 7 ΗΠΑΤΙΚΗ ΦΛΕΒΑ 6 6 5 8 4 5 2 3 4 2 1 4 2 7 8 4 6 5 4 8 4 7 http://www.ultrasound-images.com Λοβός

Διαβάστε περισσότερα

High mobility group 1 HMG1

High mobility group 1 HMG1 Vol. 29, pp.705 ~ 711, 2001 High mobility group 1 HMG1 13 12 20 anti-neutrophil cytoplasmic antibodies, ANCA ANCA 1982 Davies 1980 1 high mobility group HMG1 HMG2 30 kd high mobility group HMGHMG HMG1

Διαβάστε περισσότερα

ΛΙΠΩΔΗς ΙΣΤΟς ΚΑΙ ΛΙΠΟΚΥΤΤΟΚΊΝΕς ΣΤΗΝ ΕΓΚΥΜΟΣΎΝΗ

ΛΙΠΩΔΗς ΙΣΤΟς ΚΑΙ ΛΙΠΟΚΥΤΤΟΚΊΝΕς ΣΤΗΝ ΕΓΚΥΜΟΣΎΝΗ ΛΙΠΩΔΗς ΙΣΤΟς ΚΑΙ ΛΙΠΟΚΥΤΤΟΚΊΝΕς ΣΤΗΝ ΕΓΚΥΜΟΣΎΝΗ Γεώργιος Βαλσαμάκης Ενδοκρινολόγος Ευγενίδειο Νοσοκομείο και έμμισθος επιστημονικός συνεργάτης μεταπτυχιακου Αρεταίειο Νοσοκομείο European SCOPE fellow

Διαβάστε περισσότερα

5- CACGAAACTACCTTCAACTCC-3 beta actin-r 5- CATACTCCTGCTTGCTGATC-3 GAPDH-F GAPDH-R

5- CACGAAACTACCTTCAACTCC-3 beta actin-r 5- CATACTCCTGCTTGCTGATC-3 GAPDH-F GAPDH-R Table S1 Primers used in this work LncPPARδ-F 5- AGGATCCCAAGGCAGAAGTT -3 LncPPARδ-R 5- GAATAGAAAGGCGGGAAAGG -3 PPARδ-F 5- CACCCAGTGTCCTTCCATCT -3 PPARδ-R 5- CAGAATTGGGTGTGCTGCTT -3 ADRP-F 5- ACAACCGAGTGTGGTGACTC

Διαβάστε περισσότερα

Μεταβολικό Σύνδροµο και Σεξουαλική δραστηριότητα. ά ς ό ς.. ής ί ς ή ή ά ώ ά ής ί ς ά

Μεταβολικό Σύνδροµο και Σεξουαλική δραστηριότητα. ά ς ό ς.. ής ί ς ή ή ά ώ ά ής ί ς ά Μεταβολικό Σύνδροµο και Σεξουαλική δραστηριότητα ά ς ό ς. ής ί ς ή ή ά ώ ά ής ί ς ά Ιούνιος 2011 Μεταβολικό Σύνδροµο και Στυτική δυσλειτουργία έ ς ή ς έ. ό. ί ς ός ί ς ί ά Μεταβολικό Σύνδροµο και Στυτική

Διαβάστε περισσότερα

ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΚΑΡΚΙΝΟΣ

ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΚΑΡΚΙΝΟΣ 1 ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΚΑΡΚΙΝΟΣ Δ. Κιόρτσης Ενδοκρινολόγος Αν. Καθηγητής Ιατρικής Σχολής Παν/μίου Ιωαννίνων European SCOPE fellow 1η ΠΑΝΕΛΛΗΝΙΑ ΕΠΙΔΗΜΙΟΛΟΓΙΚΗ ΜΕΛΕΤΗ ΕΠΙΠΟΛΑΣΜΟΥ ΠΑΧΥΣΑΡΚΙΑΣ Ελληνική Ιατρική

Διαβάστε περισσότερα

Bariatric. Downloaded from at 8:25 CEST on Saturday August 30th in vivo.

Bariatric. Downloaded from   at 8:25 CEST on Saturday August 30th in vivo. 536-542 (5 ) 0 390 -. Bariatric 5 4 3 2 * 6 :.. bariatric HOMA. (BMI 35) 46 :... HOMA /9±2/09) : BMI.(P

Διαβάστε περισσότερα

Η παχυσαρκία επιβαρυντικός ή βοηθητικός παράγοντας. Π.Α. Κυριάκου Καρδιολόγος Διευθύντρια ΕΣΥ Διδάκτωρ ΑΠΘ Γ Καρδιολογική κλινική, ΙΓΠΝΘ

Η παχυσαρκία επιβαρυντικός ή βοηθητικός παράγοντας. Π.Α. Κυριάκου Καρδιολόγος Διευθύντρια ΕΣΥ Διδάκτωρ ΑΠΘ Γ Καρδιολογική κλινική, ΙΓΠΝΘ Η παχυσαρκία επιβαρυντικός ή βοηθητικός παράγοντας Π.Α. Κυριάκου Καρδιολόγος Διευθύντρια ΕΣΥ Διδάκτωρ ΑΠΘ Γ Καρδιολογική κλινική, ΙΓΠΝΘ Από μόνη η παχυσαρκία αυξάνει την θνητότητα Calle EE, Thun MJ, Petrelli

Διαβάστε περισσότερα

Αναστασόπουλος ΝΑ 1, Καραμάνη-Πλουμπίδου ΑΒ 1, Μαλλιώρας Ι 1, Παπούδου-Μπάη Α 2, Παλιούρας Α 3, Στυλιανίδη ΜΧ 1, Γούσια Α 1,2, Γκλαντζούνης Γ 1,3

Αναστασόπουλος ΝΑ 1, Καραμάνη-Πλουμπίδου ΑΒ 1, Μαλλιώρας Ι 1, Παπούδου-Μπάη Α 2, Παλιούρας Α 3, Στυλιανίδη ΜΧ 1, Γούσια Α 1,2, Γκλαντζούνης Γ 1,3 ΚΛΙΝΙΚΑ ΚΑΙ ΙΣΤΟΛΟΓΙΚΑ ΧΑΡΑΚΤΗΡΙΣΤΙΚΑ ΑΣΘΕΝΩΝ ΜΕ ΗΠΑΤΟΚΥΤΤΑΡΙΚΟ ΚΑΡΚΙΝΩΜΑ (HKK) ΠΟΥ ΑΝΤΙΜΕΤΩΠΙΣΤΗΚΑΝ ΧΕΙΡΟΥΡΓΙΚΑ ΣΤΟ ΠΑΝΕΠΙΣΤΗΜΙΑΚΟ ΝΟΣΟΚΟΜΕΙΟ ΙΩΑΝΝΙΝΩΝ (ΠΝΙ) Αναστασόπουλος ΝΑ 1, Καραμάνη-Πλουμπίδου ΑΒ

Διαβάστε περισσότερα

Υπέρταση και Διατροφή

Υπέρταση και Διατροφή Υπέρταση και Διατροφή Αντώνης Ζαμπέλας Μονάδα Διατροφής του Ανθρώπου Τμήμα Επιστήμης και Τεχνολογίας Τροφίμων Γεωπονικό Πανεπιστήμιο Αθηνών Συχνότητα εμφάνισης της υπέρτασης στην Ελλάδα. Μελέτη Αττικής

Διαβάστε περισσότερα

Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ.

Ινσουλίνη και καρδιά. Ηλιάδης Φώτης Λέκτορας Α.Π.Θ. Ινσουλίνη και καρδιά Ηλιάδης Φώτης Λέκτορας Α.Π.Θ. Επίδραση ινσουλίνης στο ήπαρ, στους μυς και στον λιπώδη ιστό : Διατήρηση ευγλυκαιμίας Nature 2001;414:799 806 Ινσουλίνη? Λειτουργικότητα Μορφολογία Βιωσιμότητα

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛΙΚΟ ΣΥΝΔΡΟΜΟ ΚΑΙ ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΘΡΟΜΒΟΕΜΒΟΛΙΚΗ ΝΟΣΟΣ. Δ. Κιόρτσης. Ενδοκρινολόγος-Διαβητολόγος Καθηγητής Ιατρικής Σχολής Παν/μίου Ιωαννίνων

ΜΕΤΑΒΟΛΙΚΟ ΣΥΝΔΡΟΜΟ ΚΑΙ ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΘΡΟΜΒΟΕΜΒΟΛΙΚΗ ΝΟΣΟΣ. Δ. Κιόρτσης. Ενδοκρινολόγος-Διαβητολόγος Καθηγητής Ιατρικής Σχολής Παν/μίου Ιωαννίνων ΜΕΤΑΒΟΛΙΚΟ ΣΥΝΔΡΟΜΟ ΚΑΙ ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΘΡΟΜΒΟΕΜΒΟΛΙΚΗ ΝΟΣΟΣ 1 Δ. Κιόρτσης Ενδοκρινολόγος-Διαβητολόγος Καθηγητής Ιατρικής Σχολής Παν/μίου Ιωαννίνων PRECISION MEDICINE ΥΛΙΚΟ ΜΕΛΕΤΗΣ ΠΑΙΔΙΑ-ΕΦΗΒΟΙ: (2-19

Διαβάστε περισσότερα

Ο ρόλος των στατινών στην μη αλκοολική λιπώδη νόσο του ήπατος

Ο ρόλος των στατινών στην μη αλκοολική λιπώδη νόσο του ήπατος Ο ρόλος των στατινών στην μη αλκοολική λιπώδη νόσο του ήπατος Β. Αθυρος, MD, FESC, FRSPH, FASA, FACS Β Προπ. Παθολογική Κλινική ΑΠΘ, Ιπποκράτειο Θεσσαλονίκης ΜΑΛΝΗ Κλινικο παθολογικό σύνδρομο που περιλαμβάνει

Διαβάστε περισσότερα

Ελκώδης Κολίτιδα: Χαρακτηριστικά της νόσου και Θεραπευτικοί στόχοι

Ελκώδης Κολίτιδα: Χαρακτηριστικά της νόσου και Θεραπευτικοί στόχοι Ελκώδης Κολίτιδα: Χαρακτηριστικά της νόσου και Θεραπευτικοί στόχοι Ιωάννης Ε. Κουτρουμπάκης Καθηγητής Γαστρεντερολογίας Ιατρικής Σχολής Πανεπιστημίου Κρήτης Δήλωση σύγκρουσης συμφερόντων Οι παρουσιάσεις

Διαβάστε περισσότερα

ΔΙΕΡΕΥΝΗΣΗ ΑΣΘΕΝΗ ΜΕ ΔΙΑΤΑΡΑΧΕΣ ΑΣΒΕΣΤΙΟΥ, ΦΩΣΦΟΡΟΥ ΚΑΙ ΜΑΓΝΗΣΙΟΥ

ΔΙΕΡΕΥΝΗΣΗ ΑΣΘΕΝΗ ΜΕ ΔΙΑΤΑΡΑΧΕΣ ΑΣΒΕΣΤΙΟΥ, ΦΩΣΦΟΡΟΥ ΚΑΙ ΜΑΓΝΗΣΙΟΥ ΔΙΕΡΕΥΝΗΣΗ ΑΣΘΕΝΗ ΜΕ ΔΙΑΤΑΡΑΧΕΣ ΑΣΒΕΣΤΙΟΥ, ΦΩΣΦΟΡΟΥ ΚΑΙ ΜΑΓΝΗΣΙΟΥ Ευάγγελος Λυμπερόπουλος Επίκουρος Καθηγητής Παθολογίας Ιατρικής Σχολής Παν/μίου Ιωαννίνων www.bpath.gr www.atherosclerosis.gr ΔΙΑΤΑΡΑΧΕΣ

Διαβάστε περισσότερα

JOURNAL OF HYGIENE RESEARCH. ghrelin LDL-C. HDL-C ghrelin. ghrelin P < BMI % BF

JOURNAL OF HYGIENE RESEARCH. ghrelin LDL-C. HDL-C ghrelin. ghrelin P < BMI % BF 252 42 2 2013 3 JOURNAL OF HYGIENE RESEARCH Vol. 42 No. 2 Mar. 2013 1000-8020 2013 02-0252-06 ghrelin 1 100050 ghrelin 879 8 ~ 10 BMI % BF TC TG LDL-C HDL-C ghrelin ghrelin BMI % BF P < 0. 0001 HDL-C P

Διαβάστε περισσότερα

ΕΠΙΔΡΑΣΗ ΤΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΣΤΗΝ ΑΝΤΙΣΤΑΣΗ ΣΤΗΝ ΙΝΣΟΥΛΙΝΗ ΚΑΙ ΤΙΣ ΑΠΑΙΤΗΣΕΙΣ ΣΕ ΙΝΣΟΥΛΙΝΗ

ΕΠΙΔΡΑΣΗ ΤΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΣΤΗΝ ΑΝΤΙΣΤΑΣΗ ΣΤΗΝ ΙΝΣΟΥΛΙΝΗ ΚΑΙ ΤΙΣ ΑΠΑΙΤΗΣΕΙΣ ΣΕ ΙΝΣΟΥΛΙΝΗ ΕΠΙΔΡΑΣΗ ΤΩΝ ΜΑΚΡΟΘΡΕΠΤΙΚΩΝ ΣΥΣΤΑΤΙΚΩΝ ΣΤΗΝ ΑΝΤΙΣΤΑΣΗ ΣΤΗΝ ΙΝΣΟΥΛΙΝΗ ΚΑΙ ΤΙΣ ΑΠΑΙΤΗΣΕΙΣ ΣΕ ΙΝΣΟΥΛΙΝΗ ΠΗΝΕΛΟΠΗ ΔΟΥΒΟΓΙΑΝΝΗ Κ Λ Ι Ν Ι Κ Η Δ Ι Α Ι Τ Ο Λ Ο Γ Ο Σ - Δ Ι ΑΤ Ρ Ο Φ Ο Λ Ο Γ Ο Σ M S C, R D Περίληψη

Διαβάστε περισσότερα

DECODE σχετικός κίνδυνος θνητότητας από κάθε αίτιο σε µη διαβητικά άτοµα

DECODE σχετικός κίνδυνος θνητότητας από κάθε αίτιο σε µη διαβητικά άτοµα DECODE σχετικός κίνδυνος θνητότητας από κάθε αίτιο σε µη διαβητικά άτοµα 2.5 Hazard ratio 2.0 1.5 1.0 0.5 0

Διαβάστε περισσότερα

ΟΥΡΙΚΗ ΝΟΣΟΣ: ΤΟ ΚΥΝΗΓΙ ΤΗΣ ΥΠΕΡΟΥΡΙΧΑΙΜΙΑΣ

ΟΥΡΙΚΗ ΝΟΣΟΣ: ΤΟ ΚΥΝΗΓΙ ΤΗΣ ΥΠΕΡΟΥΡΙΧΑΙΜΙΑΣ 25 ΟΥΡΙΚΗ ΝΟΣΟΣ: ΤΟ ΚΥΝΗΓΙ ΤΗΣ ΥΠΕΡΟΥΡΙΧΑΙΜΙΑΣ Δημήτριος Βασιλόπουλος Επίκουρος Καθηγητής Παθολογίας Ρευματολογίας, Ιατρική Σχολή Πανεπιστημίου Αθηνών Ιπποκράτειο Γενικό Νοσοκομείο Αθηνών, Αθήνα Το φάσμα

Διαβάστε περισσότερα

2. Η Βαρύτητα Διαφόρων Γλυκαιμικών Δεικτών Νοσηλείας στην Λειτουργική Έκβαση του ΑΕΕ των Διαβητικών Ασθενών

2. Η Βαρύτητα Διαφόρων Γλυκαιμικών Δεικτών Νοσηλείας στην Λειτουργική Έκβαση του ΑΕΕ των Διαβητικών Ασθενών 26 2. Η Βαρύτητα Διαφόρων Γλυκαιμικών Δεικτών Νοσηλείας στην Λειτουργική Έκβαση του ΑΕΕ των Διαβητικών Ασθενών Β. Δραγουμάνος 1, Δ. Αθανασόπουλος 2, Ε. Φουστέρης 1, Δ. Αναστασόπουλος 2, Π. Φουρλεμάδης

Διαβάστε περισσότερα

Ορισµός της παχυσαρκίας Είναι η αύξηση του σωµατικού βάρους πάνω από ένα καθορισµένο όριο που ορίζεται µε βάση το ύψος και το βάρος σε κιλά (kg) και α

Ορισµός της παχυσαρκίας Είναι η αύξηση του σωµατικού βάρους πάνω από ένα καθορισµένο όριο που ορίζεται µε βάση το ύψος και το βάρος σε κιλά (kg) και α «ιαστρωµάτωση του κινδύνου υπερτασικών ασθενών» «Ο ρόλος της παχυσαρκίας» Dr. Αθαν. Ι. Τριανταφύλλου FESC,EHS καρδιολογική κλινική «Γ.Ν. Ευαγγελισµός Αθήνα» Ορισµός της παχυσαρκίας Είναι η αύξηση του σωµατικού

Διαβάστε περισσότερα

Ασθενής με ηπατική ίνωση λόγω NAFLD/NASH και διαβήτη. Υπάρχει κοινή θεραπεία;

Ασθενής με ηπατική ίνωση λόγω NAFLD/NASH και διαβήτη. Υπάρχει κοινή θεραπεία; Ασθενής με ηπατική ίνωση λόγω NAFLD/NASH και διαβήτη. Υπάρχει κοινή θεραπεία; Δρ. Α. Μελιδώνης Συντονιστής Διευθυντής Α Παθ. Κλινικής & Διαβητολογικού Κέντρου Γ.Ν. Πειραιά «ΤΖΑΝΕΙΟ» Ο Κύριος Κ. είναι ασθενής

Διαβάστε περισσότερα

ΜΕΤΑΒΟΛΙΚΟ ΣΥΝΔΡΟΜΟ ΣΕ ΠΑΙΔΙΑΤΡΙΚΟΥΣ ΑΣΘΕΝΕΙΣ ΜΕ ΑΠΛΗ ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΔΙΑΒΗΤΟ-ΠΑΧΥΣΑΡΚΙΑ (DIABESITY) Α. Γαλλή-Τσινοπούλου

ΜΕΤΑΒΟΛΙΚΟ ΣΥΝΔΡΟΜΟ ΣΕ ΠΑΙΔΙΑΤΡΙΚΟΥΣ ΑΣΘΕΝΕΙΣ ΜΕ ΑΠΛΗ ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΔΙΑΒΗΤΟ-ΠΑΧΥΣΑΡΚΙΑ (DIABESITY) Α. Γαλλή-Τσινοπούλου 23ο ΣΥΝΕΔΡΙΟ ΔΕΒΕ ΘΕΣΣΑΛΟΝΙΚΗ, 2009 ΜΕΤΑΒΟΛΙΚΟ ΣΥΝΔΡΟΜΟ ΣΕ ΠΑΙΔΙΑΤΡΙΚΟΥΣ ΑΣΘΕΝΕΙΣ ΜΕ ΑΠΛΗ ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΔΙΑΒΗΤΟ-ΠΑΧΥΣΑΡΚΙΑ (DIABESITY) Α. Γαλλή-Τσινοπούλου Τσινοπούλου¹, Μ. Γραμματικοπούλου¹, Ε. Εμμανουηλίδου¹,

Διαβάστε περισσότερα

Εισαγωγή στη Διατροφή

Εισαγωγή στη Διατροφή Εισαγωγή στη Διατροφή Ενότητα 9 η ΜΕΡΟΣ Β THE INTERNATIONAL OBESITY TASK FORCE (IOTF) Όνομα καθηγητή: Μ. ΚΑΨΟΚΕΦΑΛΟΥ Όνομα καθηγητή: Α. ΖΑΜΠΕΛΑΣ Τμήμα: Επιστήμης τροφίμων και διατροφής του ανθρώπου ΣΤΟΧΟΙ

Διαβάστε περισσότερα

ΕΠΙΠΕ Α ΛΕΠΤΙΝΗΣ ΚΑΙ Α ΙΠΟΝΕΚΤΙΝΗΣ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ Ι ΙΟΠΑΘΗ ΠΝΕΥΜΟΝΙΚΗ ΙΝΩΣΗ. Πανεπιστήµιο Θεσσαλίας, Λάρισα

ΕΠΙΠΕ Α ΛΕΠΤΙΝΗΣ ΚΑΙ Α ΙΠΟΝΕΚΤΙΝΗΣ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ Ι ΙΟΠΑΘΗ ΠΝΕΥΜΟΝΙΚΗ ΙΝΩΣΗ. Πανεπιστήµιο Θεσσαλίας, Λάρισα ΕΠΙΠΕ Α ΛΕΠΤΙΝΗΣ ΚΑΙ Α ΙΠΟΝΕΚΤΙΝΗΣ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ Ι ΙΟΠΑΘΗ ΠΝΕΥΜΟΝΙΚΗ ΙΝΩΣΗ Φωτεινή Μάλλη 1, Παναγιώτης Γεωργούλιας 2, Βαρβάρα Βαλοτάσιου 2, Ειρήνη Τσιλιώνη 1, ηµοσθένης Μακρής 3, Κωνσταντίνος Ι Γουργουλιάνης

Διαβάστε περισσότερα

Ψωρίαση: Πέρα από τα Όρια Μεταβολικές Διαταραχές

Ψωρίαση: Πέρα από τα Όρια Μεταβολικές Διαταραχές Ψωρίαση: Πέρα από τα Όρια Μεταβολικές Διαταραχές Ερυφίλη Χατζηαγγελάκη Ερυφίλη Χατζηαγγελάκη Αναπλ. Καθηγήτρια Παθολογίας Β Προπ. Παθολογική Κλινική & Μονάδα Έρευνας του Πανεπιστημίου Αθηνών Πανεπιστημιακό

Διαβάστε περισσότερα

Προσαρµογές και οφέλη από την εφαρµογή προγραµµάτων άσκησης σε άτοµα µε χρόνιες παθήσεις

Προσαρµογές και οφέλη από την εφαρµογή προγραµµάτων άσκησης σε άτοµα µε χρόνιες παθήσεις Προσαρµογές και οφέλη από την εφαρµογή προγραµµάτων άσκησης σε άτοµα µε χρόνιες παθήσεις Εισαγωγή Στις µέρες µας έχει αναγνωριστεί η ιδιαίτερη αξία της άσκησης και η συµβολή της στην προάσπιση της υγείας

Διαβάστε περισσότερα

Καμία σύγκρουση συμφερόντων

Καμία σύγκρουση συμφερόντων Καμία σύγκρουση συμφερόντων Χρονολόγιο μετφορμίνης Galega officinalis Werner και Bell 1922 Δουβλίνο 1956 UK: 1958/ USA: 1995 UKPDS 1 ο φάρμακο εκλογής 1.Shenfield G. Metformin: myths, misunderstandings

Διαβάστε περισσότερα

!!Διατροφή!και!αθηροσκλήρωση!!ίσως!το! καλύτερο!φάρμακο

!!Διατροφή!και!αθηροσκλήρωση!!ίσως!το! καλύτερο!φάρμακο !!Διατροφή!και!αθηροσκλήρωση!!ίσως!το! καλύτερο!φάρμακο Dietary!Fats!and!LDLCCholesterol! 0,18 0,14 0,10 β=0.032*& SFA! Change!in! LDLCC! (mmol/l)! 0,06 0,02-0,02-0,06-0,10 β=c0.009*& β=c0.019*& 0 1%

Διαβάστε περισσότερα

Chin J Osteoporos April 2011 Vol 17 No. 4 Published online www. wanfangdate. com. cn doi / j. issn

Chin J Osteoporos April 2011 Vol 17 No. 4 Published online www. wanfangdate. com. cn doi / j. issn 312 Published online www. wanfangdate. com. cn doi 10. 3969 / j. issn. 1006-7108. 2011. 04. 007 R681 A 1006-7108 2011 04-0312-05 fat mass lean mass 414 1020 Hologic Delphi A X fat mass lean mass 1 2 Lean

Διαβάστε περισσότερα

Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ

Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ Η ΥΠΕΡΕΚΦΡΑΣΗ ΤΟΥ SMAD7 ΠΡΟΣΤΑΤΕΥΕΙ ΤΟ ΗΠΑΡ ΑΠΟ ΤΗΝ TGF-Β/SMAD ΜΕΣΟΛΑΒΟΥΜΕΝΗ ΙΝΟΓΕΝΕΣΗ OVEREXPRESSION OF SMAD7 PROTECTS LIVER FROM TGF-B/SMAD-MEDIATED FIBROGENESIS Γ. Γερμανίδης(1), Ν. Αργέντου(2), Ε.

Διαβάστε περισσότερα

ΚΥΤΤΑΡΙΚΟΣ ΘΑΝΑΤΟΣ ΚΑΙ ΑΝΑΓΕΝΝΗΣΗ Β-ΚΥΤΤΑΡΟΥ ΝΕΟΤΕΡΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗ ΘΕΡΑΠΕΙΑ ΤΟΥ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ

ΚΥΤΤΑΡΙΚΟΣ ΘΑΝΑΤΟΣ ΚΑΙ ΑΝΑΓΕΝΝΗΣΗ Β-ΚΥΤΤΑΡΟΥ ΝΕΟΤΕΡΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗ ΘΕΡΑΠΕΙΑ ΤΟΥ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΚΥΤΤΑΡΙΚΟΣ ΘΑΝΑΤΟΣ ΚΑΙ ΑΝΑΓΕΝΝΗΣΗ Β-ΚΥΤΤΑΡΟΥ ΝΕΟΤΕΡΑ ΔΕΔΟΜΕΝΑ ΓΙΑ ΤΗ ΘΕΡΑΠΕΙΑ ΤΟΥ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΚΑΛΛΙΟΠΗ ΚΩΤΣΑ ΕΠΙΚ. ΚΑΘΗΓΗΤΡΙΑ ΕΝΔΟΚΡΙΝΟΛΟΓΙΑΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ Α.Π.Θ ΤΜΗΜΑ ΕΝΔΟΚΡΙΝΟΛΟΓΙΑΣ-ΔΙΑΒΗΤΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ. ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΑΡΙΣΤΟΤΕΛΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΑΤΡΙΚΗ ΣΧΟΛΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΠΤΥΧΙΑΚΩΝ ΣΠΟΥ ΩΝ «Ιατρική Ερευνητική Μεθοδολογία» ΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ Νόσος Pompe: Νεότερα κλινικά, γενετικά, διαγνωστικά και θεραπευτικά

Διαβάστε περισσότερα

ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα

ΙΔΡΥΜΑ. Θεσσαλονίκη, ύλα ΑΛΕΞΑΝΔΡΕΙΟ ΤΕΧΝΟΛΟΓΙΚΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΙΔΡΥΜΑ ΘΕΣΣΑΛΟΝΙΚΗΣ ΣΧΟΛΗ ΤΕΧΝΟΛΟΓΙΑΣ ΓΕΩΠΟΝΙΑΣ, ΤΡΟΦΙΜΩΝ & ΔΙΑΤΡΟΦΗΔ ΗΣ ΤΜΗΜΑ ΔΙΑΤΡΟΦΗΣ & ΔΙΑΙΤΟΛΟΓΙΑΣ ΠΑΡΕΜΒΑΤΙΚΟ ΠΡΟΓΡΑΜΜΑ ΔΙΑΤΡΟΦΙΚΗΣ ΑΓΩΓΗΣ ΣΤΟΝ ΔΗΜΟ ΚΑΒΑΛΑΣ Πτυχιακή

Διαβάστε περισσότερα

Η ΣΧΕΣΗ ΠΕΡΙΦΕΡΕΙΑΣ ΛΑΙΜΟΥ ΜΕ ΤΟΥΣ ΚΑΡΔΙΟΜΕΤΑΒΟΛΙΚΟΥΣ ΠΑΡΑΓΟΝΤΕΣ ΚΙΝΔΥΝΟΥ ΣΕ ΑΤΟΜΑ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ.

Η ΣΧΕΣΗ ΠΕΡΙΦΕΡΕΙΑΣ ΛΑΙΜΟΥ ΜΕ ΤΟΥΣ ΚΑΡΔΙΟΜΕΤΑΒΟΛΙΚΟΥΣ ΠΑΡΑΓΟΝΤΕΣ ΚΙΝΔΥΝΟΥ ΣΕ ΑΤΟΜΑ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ. Η ΣΧΕΣΗ ΠΕΡΙΦΕΡΕΙΑΣ ΛΑΙΜΟΥ ΜΕ ΤΟΥΣ ΚΑΡΔΙΟΜΕΤΑΒΟΛΙΚΟΥΣ ΠΑΡΑΓΟΝΤΕΣ ΚΙΝΔΥΝΟΥ ΣΕ ΑΤΟΜΑ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ. Σταματελάτου Mαρία¹, Τζιόμαλος Γεώργιος¹, Δασενάκη Μαρία¹, Κουτσοβασίλης Αναστάσιος². 1.Παθολογική

Διαβάστε περισσότερα

ΜΕΘΟ ΟΙ ΑΝΑΛΥΣΗΣ ΜΑΖΑΣ ΣΩΜΑΤΟΣ

ΜΕΘΟ ΟΙ ΑΝΑΛΥΣΗΣ ΜΑΖΑΣ ΣΩΜΑΤΟΣ Παναγιώτης Κοκκόρης Ενδοκρινολόγος- ιαβητολόγος Επιµελητής Ενδοκρινολογικής Κλινικής του 251 Γενικού Νοσοκοµείου Αεροπορίας ΜΕΘΟ ΟΙ ΑΝΑΛΥΣΗΣ ΜΑΖΑΣ ΣΩΜΑΤΟΣ Εισαγωγή Η ανάλυση µάζας σώµατος βοηθάει στην

Διαβάστε περισσότερα

HDL-χοληστερόλη παραμένει ακόμα θεραπευτικός στόχος; Δημήτριος Β. Κιόρτσης Ενδοκρινολόγος Καθηγητής Ιατρικής Σχολής Παν/μίου Ιωαννίνων

HDL-χοληστερόλη παραμένει ακόμα θεραπευτικός στόχος; Δημήτριος Β. Κιόρτσης Ενδοκρινολόγος Καθηγητής Ιατρικής Σχολής Παν/μίου Ιωαννίνων HDL-χοληστερόλη παραμένει ακόμα θεραπευτικός στόχος; Δημήτριος Β. Κιόρτσης Ενδοκρινολόγος Καθηγητής Ιατρικής Σχολής Παν/μίου Ιωαννίνων High Density Lipoprotein (HDL) Λιποπρωτεΐνη Χυλομικρά > VLDL > IDL

Διαβάστε περισσότερα

Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine

Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine Contents Part I Psychoneuroimmunology and Systems Biology Mechanisms 1 From Psychoneuroimmunology to Personalized, Systems, and Dynamical Medicine... 3 1.1 Psychoneuroimmunology (PNI) and Systems Biology...

Διαβάστε περισσότερα

RFA : HCC. percutaneous acetic acid injection therapy: PAIT 3 percutaneous hot water injection therapy: PHot 4 HCC HCV HCC

RFA : HCC. percutaneous acetic acid injection therapy: PAIT 3 percutaneous hot water injection therapy: PHot 4 HCC HCV HCC 89 Vol. 33, pp. 89 97, 2005 radiofrequency ablation therapy RFA : 17 6 14 HCC 3 HCC B HBV C HCV HCV HCC 8 HCC HCV 7 8 high risk group HCC HCC i ii iii HCC HCC radiofrequency ablation therapy: RFA 1980

Διαβάστε περισσότερα

ΜΗ ΑΛΚΟΟΛΙΚΗ ΛΙΠΩΔΗΣ ΝΟΣΟΣ ΤΟΥ ΗΠΑΤΟΣ ΚΑΙ ΚΑΡΔΙΑΓΓΕΙΑΚΗ ΝΟΣΟΣ. ΜΠΑΚΑΛΑΚΟΥ ΚΩΝΣΤΑΝΤΙΝΑ. ΠΑΘΟΛΟΓΟΣ ΕΠΙΚΟΥΡΙΚΗ ΕΠΙΜΕΛΗΤΡΙΑ Β Γ.Ν.Α. ΑΣΚΛΗΠΙΕΙΟ ΒΟΥΛΑΣ.

ΜΗ ΑΛΚΟΟΛΙΚΗ ΛΙΠΩΔΗΣ ΝΟΣΟΣ ΤΟΥ ΗΠΑΤΟΣ ΚΑΙ ΚΑΡΔΙΑΓΓΕΙΑΚΗ ΝΟΣΟΣ. ΜΠΑΚΑΛΑΚΟΥ ΚΩΝΣΤΑΝΤΙΝΑ. ΠΑΘΟΛΟΓΟΣ ΕΠΙΚΟΥΡΙΚΗ ΕΠΙΜΕΛΗΤΡΙΑ Β Γ.Ν.Α. ΑΣΚΛΗΠΙΕΙΟ ΒΟΥΛΑΣ. ΜΗ ΑΛΚΟΟΛΙΚΗ ΛΙΠΩΔΗΣ ΝΟΣΟΣ ΤΟΥ ΗΠΑΤΟΣ ΚΑΙ ΚΑΡΔΙΑΓΓΕΙΑΚΗ ΝΟΣΟΣ. ΜΠΑΚΑΛΑΚΟΥ ΚΩΝΣΤΑΝΤΙΝΑ. ΠΑΘΟΛΟΓΟΣ ΕΠΙΚΟΥΡΙΚΗ ΕΠΙΜΕΛΗΤΡΙΑ Β Γ.Ν.Α. ΑΣΚΛΗΠΙΕΙΟ ΒΟΥΛΑΣ. ΟΡΙΣΜΟΣ ΜΗ ΑΛΚΟΟΛΙΚΗ ΛΙΠΩΔΗΣ ΔΙΗΘΗΣΗ ΤΟΥ ΗΠΑΤΟΣ (ΜΑΛΔΗ)

Διαβάστε περισσότερα

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΣΙΚΗΣ ΑΓΩΓΗΣ & ΑΘΛΗΤΙΣΜΟΥ. ΜΚ 0910 «Εργοφυσιολογία στον Αγωνιστικό Αθλητισµό Ι»

ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΣΙΚΗΣ ΑΓΩΓΗΣ & ΑΘΛΗΤΙΣΜΟΥ. ΜΚ 0910 «Εργοφυσιολογία στον Αγωνιστικό Αθλητισµό Ι» ΕΠΕΑΕΚ ΑΝΑΜΟΡΦΩΣΗ ΤΟΥ ΠΡΟΓΡΑΜΜΑΤΟΣ ΣΠΟΥ ΩΝ ΤΟΥ Τ.Ε.Φ.Α.Α.ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΘΕΣΣΑΛΙΑΣ - ΑΥΤΕΠΙΣΤΑΣΙΑ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΕΣΣΑΛΙΑΣ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΦΥΣΙΚΗΣ ΑΓΩΓΗΣ & ΑΘΛΗΤΙΣΜΟΥ ΜΚ 0910 «Εργοφυσιολογία στον Αγωνιστικό

Διαβάστε περισσότερα

Table S1: Inpatient Diet Composition

Table S1: Inpatient Diet Composition Table S1: Inpatient Diet Composition Diet Components (% of Energy) Inpatient Period Baseline Intervention Protein 15.1 ± 0.0 15.0 ± 0.1 Total fat 30.0 ± 0.0 30.0 ± 0.1 Saturated fat 8.6 ± 0.8 8.4 ± 0.9

Διαβάστε περισσότερα

Πρωτογενής πρόληψη των καρδιαγγειακών IFG

Πρωτογενής πρόληψη των καρδιαγγειακών IFG Πρωτογενής πρόληψη των καρδιαγγειακών νοσημάτων στον προ-διαβήτη. Έχει θέση; IFG Δρ Σταύρος Μπούσμπουλας Διευθυντής Γ Παθολογικής Κλινικής & Υπεύθυνος Διαβητολογικού Κέντρου Γ.Ν. Νίκαιας Πειραιά Προ-διαβήτης

Διαβάστε περισσότερα

Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver

Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver Nagoya Med. J., 137 Hepatic Stellate Cells: Multifunctional mesenchymal cells of the Liver KAZUO IKEDA Department of Anatomy and Cell Biology, Graduate School of Medical Sciences, Nagoya City University

Διαβάστε περισσότερα

Μη αλκοολική λιπώδης νόσος του ήπατος και καρδιαγγειακός κίνδυνος

Μη αλκοολική λιπώδης νόσος του ήπατος και καρδιαγγειακός κίνδυνος : 90-97, 2014 Ανασκόπηση Μη αλκοολική λιπώδης νόσος του ήπατος και καρδιαγγειακός κίνδυνος A.Κ. Παπαζαφειροπούλου Α. Αγγελίδη Α. Μελιδώνης Περίληψη Είναι γνωστό ότι η μη αλκοολική λιπώδης νόσος του ήπατος

Διαβάστε περισσότερα

ΠΡΟΦΙΛ ΨΥΧΙΑΤΡΙΚΩΝ ΔΙΑΒΗΤΙΚΩΝ ΑΣΘΕΝΩΝ ΣΕ ΝΟΣΗΛΕΙΑ ΣΕ ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ

ΠΡΟΦΙΛ ΨΥΧΙΑΤΡΙΚΩΝ ΔΙΑΒΗΤΙΚΩΝ ΑΣΘΕΝΩΝ ΣΕ ΝΟΣΗΛΕΙΑ ΣΕ ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΠΡΟΦΙΛ ΨΥΧΙΑΤΡΙΚΩΝ ΔΙΑΒΗΤΙΚΩΝ ΑΣΘΕΝΩΝ ΣΕ ΝΟΣΗΛΕΙΑ ΣΕ ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ Παθολογική Κλινική ΓΝΘ Γ.Παπανικολάου- Οργανική µονάδα Ψυχιατρικού Νοσοκοµείου Θεσσαλονίκης Φρυδά Χρυσόθεµις Ειδικευόµενη Ιατρός

Διαβάστε περισσότερα

Δημήτρης Χριστοδούλου Επίκουρος Καθηγητής Γαστρεντερολογίας Ιατρικής Σχολής Πανεπιστημίου Ιωαννίνων Ετήσια Ενδοσκοπική Ημερίδα ΕΓΕ

Δημήτρης Χριστοδούλου Επίκουρος Καθηγητής Γαστρεντερολογίας Ιατρικής Σχολής Πανεπιστημίου Ιωαννίνων Ετήσια Ενδοσκοπική Ημερίδα ΕΓΕ Δημήτρης Χριστοδούλου Επίκουρος Καθηγητής Γαστρεντερολογίας Ιατρικής Σχολής Πανεπιστημίου Ιωαννίνων Ετήσια Ενδοσκοπική Ημερίδα ΕΓΕ ΙΦΠΕ και καρκίνος παχέος εντέρου Οι ασθενείς με ΙΦΠΕ έχουν αυξημένο κίνδυνο

Διαβάστε περισσότερα

Ο ρόλος του λιπώδους ιστού

Ο ρόλος του λιπώδους ιστού Ο ρόλος του λιπώδους ιστού Γιώργος Βαλσαμάκης Ενδοκρινολόγος Eπιστημονικός συνεργάτης Ενδοκρινολογικήs Μονάδαs Β Μαιευτικής και Γυναικολογικής κλινικής Αρεταίειο Νοσοκομείο Θέματα συζήτησης Α. Ο λιπώδης

Διαβάστε περισσότερα

Σπλαχνικό λίπος και εμμηνόπαυση

Σπλαχνικό λίπος και εμμηνόπαυση Σπλαχνικό λίπος και εμμηνόπαυση Γιώργος Μίλεσης Διαιτολόγος Διατροφολόγος MSc Εφαρμοσμένης Κλινικής Διατροφής Η επίπτωση της παχυσαρκίας είναι διαρκώς αυξανόμενη τόσο στις αναπτυγμένες όσο και στις αναπτυσσόμενες

Διαβάστε περισσότερα

(non-alcoholic fatty liver , NASH. (non-alcoholic steatohepatitis,nash) NASH, NASH NAFLD, NAFLD NASH NASH NAFLD NASH NASH ,ALT

(non-alcoholic fatty liver , NASH. (non-alcoholic steatohepatitis,nash) NASH, NASH NAFLD, NAFLD NASH NASH NAFLD NASH NASH ,ALT 133 李学军 1 孙倩 2 (1. 361003; 2. 2013 361002) : ; ; :R575.5 DOI:10.3969/j.issn.1671-2870.2014.02.006 :A :1671-2870(2014)02-0133-05 NASH [5] (non-alcoholic fatty liver diseasenafld) NAFLD (non-alcoholic steatohepatitisnash)

Διαβάστε περισσότερα

ΧΑΡΑΛΑΜΠΟΣ Ι. ΚΑΡΒΟΥΝΗΣ Καθηγητής Καρδιολογίας Α.Π.Θ.

ΧΑΡΑΛΑΜΠΟΣ Ι. ΚΑΡΒΟΥΝΗΣ Καθηγητής Καρδιολογίας Α.Π.Θ. ΧΑΡΑΛΑΜΠΟΣ Ι. ΚΑΡΒΟΥΝΗΣ Καθηγητής Καρδιολογίας Α.Π.Θ. Η αναγνώριση της σηµασίας της θρόµβωσης στα οξέα καρδιαγγειακά συµβάµατα, οδήγησε σε πολλές µεγάλες µελέτες, µε στόχο την εκτίµηση της αποτελεσµατικότητας

Διαβάστε περισσότερα

Συγκριτική μελέτη μη επεμβατικών συνδυαστικών μοντέλων για την ανίχνευση της Μη Αλκοολικής Νόσου του Ήπατος

Συγκριτική μελέτη μη επεμβατικών συνδυαστικών μοντέλων για την ανίχνευση της Μη Αλκοολικής Νόσου του Ήπατος 66 ΠΡΩΤΟΤΥΠΟ ΑΡΘΡΟ Συγκριτική μελέτη μη επεμβατικών συνδυαστικών μοντέλων για την ανίχνευση της Μη Αλκοολικής Νόσου του Ήπατος Α. Αγγελίδη, Α. Παπαζαφειροπούλου, Κ. Αναγνωστοπούλου, Α. Βαγενά, Ε. Μαρκάκης,

Διαβάστε περισσότερα

Tishreen University Journal for Research and Scientific Studies - Health Sciences Series Vol. (33) No. (4) 2011

Tishreen University Journal for Research and Scientific Studies - Health Sciences Series Vol. (33) No. (4) 2011 2011 (4) (33) _ Tishreen University Journal for Research and Scientific Studies - Health Sciences Series Vol. (33) No. (4) 2011 (BMI) * ( 2011/ 8 / 22.2011 / 6 / 26 ) 2011/1/1 30-19 56 113 169,2011/5/30,

Διαβάστε περισσότερα

Πιλοτική μελέτη της Doppler Υπερηχογραφίας των Μητριαίων Αρτηριών και της Ενδοθηλιακής Λειτουργίας με την εμφάνιση Προεκλαμψίας

Πιλοτική μελέτη της Doppler Υπερηχογραφίας των Μητριαίων Αρτηριών και της Ενδοθηλιακής Λειτουργίας με την εμφάνιση Προεκλαμψίας Ε. Αναστασάκης 1, Ν. Παπαντωνίου 1, Γ. Δασκαλάκης 1, Ι. Ανδρεάδου 2, Σ. Μεσογίτης 1, Α. Αντσακλής 1 1 Α' Μαιευτική & Γυναικολογική Κλινική Πανεπιστημίου Αθηνών, Νοσοκομείο «Αλεξάνδρα» 2 Εργαστήριο Φαρμακολογίας

Διαβάστε περισσότερα

Relationship between Connective Tissue Diseases and Thyroid Diseases

Relationship between Connective Tissue Diseases and Thyroid Diseases CHINESE JOURNAL OF ALLERGY & CLINICAL IMMUNOLOGY # * 272129 connective tissue diseasectd 2009 1 2013 4 CTD CTD CTD CTD 780 438 56. 2% 195 25. 0% 85 10. 9% 44 5. 6% SSc 18 2. 3% 286 36. 7% 8. 7% P < 0.

Διαβάστε περισσότερα

Κεφαλογιάννης Νικόλαος Παθολόγος

Κεφαλογιάννης Νικόλαος Παθολόγος 24 ΟΝ Ετήσιο Συνέδριο Διαβητολογικής Εταιρείας Βορείου Ελλάδος Θεσσαλονίκη 25 27 Νοέμβριου 2010 Makedonia Palace Κεφαλογιάννης Νικόλαος Παθολόγος Διευθ/ντης Διαβητολογικού Ιατρείου Βενιζέλειο Πανάνειο

Διαβάστε περισσότερα

ΝΕΩΤΕΡΟΙ ΑΠΕΙΚΟΝΙΣΤΙΚΟΙ ΔΕΙΚΤΕΣ ΕΚΤΙΜΗΣΗΣ ΚΑΡΔΙΑΓΓΕΙΑΚΟΥ ΚΙΝΔΥΝΟΥ

ΝΕΩΤΕΡΟΙ ΑΠΕΙΚΟΝΙΣΤΙΚΟΙ ΔΕΙΚΤΕΣ ΕΚΤΙΜΗΣΗΣ ΚΑΡΔΙΑΓΓΕΙΑΚΟΥ ΚΙΝΔΥΝΟΥ ΝΕΩΤΕΡΟΙ ΑΠΕΙΚΟΝΙΣΤΙΚΟΙ ΔΕΙΚΤΕΣ ΕΚΤΙΜΗΣΗΣ ΚΑΡΔΙΑΓΓΕΙΑΚΟΥ ΚΙΝΔΥΝΟΥ ΔΕΣΠΟΤΟΠΟΥΛΟΣ ΕΥΣΤΑΘΙΟΣ Disclosure : No conflict of interest Non contrast Cardiac CT Μέτρηση αθηρωµατικού φορτίου Μέτρηση επικαρδιακού

Διαβάστε περισσότερα

ΑΤΣΟΑΝΟΗ ΠΑΓΚΡΕΑΣΙΣΙΔΑ. ηέξγηνο Γειαθίδεο Γαζηξεληεξνιόγνο

ΑΤΣΟΑΝΟΗ ΠΑΓΚΡΕΑΣΙΣΙΔΑ. ηέξγηνο Γειαθίδεο Γαζηξεληεξνιόγνο ΑΤΣΟΑΝΟΗ ΠΑΓΚΡΕΑΣΙΣΙΔΑ ηέξγηνο Γειαθίδεο Γαζηξεληεξνιόγνο Ο νκηιεηήο δελ έρεη νπνηαδήπνηε ζύγθξνπζε ζπκθεξόλησλ κε θαξκαθεπηηθέο εηαηξείεορνξεγνύο ηνπ ζπλεδξίνπ ΑΤΣΟΑΝΟΗ ΠΑΓΚΡΕΑΣΙΣΙΔΑ: νξηζκόο Η ΑΠ είλαη

Διαβάστε περισσότερα

Σακχαρώδης Διαβήτης και Μη Αλκοολική Στεατοηπατίτιδα -Παθογένεια και Αντιμετώπιση-

Σακχαρώδης Διαβήτης και Μη Αλκοολική Στεατοηπατίτιδα -Παθογένεια και Αντιμετώπιση- Σακχαρώδης Διαβήτης και Μη Αλκοολική Στεατοηπατίτιδα -Παθογένεια και Αντιμετώπιση- Θεμιστοκλής Γ. Βασιλειάδης Επίκ. Καθηγητής Παθολογίας Α ΠΡΠ ΑΠΘ ΑΧΕΠΑ Oρισμοί NAFLD : Non Alcoholic Liver Disease NAFL

Διαβάστε περισσότερα

ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΚΑΡΚΙΝΟΣ

ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΚΑΡΚΙΝΟΣ 1 ΠΑΧΥΣΑΡΚΙΑ ΚΑΙ ΚΑΡΚΙΝΟΣ Δ. Κιόρτσης Ενδοκρινολόγος Καθηγητής Ιατρικής Σχολής Παν/μίου Ιωαννίνων ΕΠΙΠΤΩΣΗ ΠΑΧΥΣΑΡΚΙΑΣ Παχυσαρκία Υπέρβαρο Άνδρες 26 % 41.1 % Γυναίκες 18.2 % 29.9 % IOTF 1999 Prevalence

Διαβάστε περισσότερα

Ο ρόλος της ANGPTL3 στον μεταβολισμό των λιποπρωτεϊνών

Ο ρόλος της ANGPTL3 στον μεταβολισμό των λιποπρωτεϊνών 8ο Πανελλήνιο Συνέδριο της Ελληνικής Εταιρείας Αθηροσκλήρωσης Ο ρόλος της ANGPTL3 στον μεταβολισμό των λιποπρωτεϊνών Θεοδόσιος Φιλιππάτος Επίκουρος Καθηγητής Παθολογίας, Ιατρική Σχολή Πανεπιστημίου Κρήτης

Διαβάστε περισσότερα

Κίνδυνοι και Πρόληψη της Παιδικής Παχυσαρκίας

Κίνδυνοι και Πρόληψη της Παιδικής Παχυσαρκίας Κίνδυνοι και Πρόληψη της Παιδικής Παχυσαρκίας Ενότητα 3: Παιδιατρική Ενδοκρινολογία Βασιλική Ε. Γκρέκα-Σπηλιώτη Σχολή Επιστημών Υγείας Τμήμα Ιατρικής Σκοποί ενότητας Εισαγωγή σε μεταβολικά νοσήματα της

Διαβάστε περισσότερα

HDL HDL S1P. Micro Channel array Flow Analyzer (MC-FAN) ex vivo S1P S1P HDL MC-FAN HDL HDL S1P. Owen HDL S1P S1P HDL ELISA M (1) mean ±S.D.

HDL HDL S1P. Micro Channel array Flow Analyzer (MC-FAN) ex vivo S1P S1P HDL MC-FAN HDL HDL S1P. Owen HDL S1P S1P HDL ELISA M (1) mean ±S.D. HDL HDL - S1P S1P S1P β HDL β HDL HDL MM S1P Owen 2 M HDLM S1P S1P S1P M HDL HDLM S1P ELISA M HDL S1P M HDL (1) M HDLM HDLM M HDL 75gOGTT M 75gOGTT M HDL LDL CRP C- HbA1c 75gOGTT 75gOGTT M M M HDL LDL

Διαβάστε περισσότερα

ΕΚΠΑΙ ΕΥΤΙΚΟΙ ΣΤΟΧΟΙ. Τι ονοµάζουµε συνολικό καρδιαγγειακό κίνδυνο: Γιατί χρειαζόµαστε ειδικά µοντέλα υπολογισµού:

ΕΚΠΑΙ ΕΥΤΙΚΟΙ ΣΤΟΧΟΙ. Τι ονοµάζουµε συνολικό καρδιαγγειακό κίνδυνο: Γιατί χρειαζόµαστε ειδικά µοντέλα υπολογισµού: ΕΚΠΑΙ ΕΥΤΙΚΟΙ ΣΤΟΧΟΙ Τι ονοµάζουµε συνολικό καρδιαγγειακό κίνδυνο: Γιατί χρειαζόµαστε ειδικά µοντέλα υπολογισµού: Μοντέλα µε κλασσικούς παράγοντες κινδύνου: Μοντέλα µε νέους βιοδείκτες: Πως µεταβάλουν

Διαβάστε περισσότερα

Η αξία της έγκαιρης διάγνωσης και αντιμετώπισης του Σακχαρώδη Διαβήτη τύπου 2

Η αξία της έγκαιρης διάγνωσης και αντιμετώπισης του Σακχαρώδη Διαβήτη τύπου 2 Η αξία της έγκαιρης διάγνωσης και αντιμετώπισης του Σακχαρώδη Διαβήτη τύπου 2 Ηλιάδης Φώτης Επίκουρος Καθηγητής Παθολογίας Διαβητολογίας ΑΠΘ Α ΠΡΠ, Νοσοκομείο ΑΧΕΠΑ, Θεσσαλονίκη Δήλωση συμφερόντων Έχω

Διαβάστε περισσότερα

Μη αλκοολική λιπώδης νόσος του ήπατος, σακχαρώδης διαβήτης και καρδιαγγειακή νόσος

Μη αλκοολική λιπώδης νόσος του ήπατος, σακχαρώδης διαβήτης και καρδιαγγειακή νόσος Α Ν Α Σ Κ Ο Π Η Σ Η Ελληνική Επιθεώρηση Αθηροσκλήρωσης 4(2):96 103 R E V I E W Hellenic Journal of Atherosclerosis 4(2):96 103 Μη αλκοολική λιπώδης νόσος του ήπατος, σακχαρώδης διαβήτης και καρδιαγγειακή

Διαβάστε περισσότερα

Γεώργιος Βαλσαμάκης Ενδοκρινολόγος Επισκέπτης Αν/της Καθηγητής Warwick Medical School, UK European SCOPE Fellow Obesity (Int. Assoc.

Γεώργιος Βαλσαμάκης Ενδοκρινολόγος Επισκέπτης Αν/της Καθηγητής Warwick Medical School, UK European SCOPE Fellow Obesity (Int. Assoc. Λιποκύτταρο και Σακχαρώδης Διαβήτης Γεώργιος Βαλσαμάκης Ενδοκρινολόγος Πανεπιστημιακός Υπότροφος, Αρεταίειο Επισκέπτης Αν/της Καθηγητής Warwick Medical School, UK European SCOPE Fellow Obesity (Int. Assoc.

Διαβάστε περισσότερα

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13,

[11].,, , 316 6, ,., 15.5%, 9.8%, 2006., IDF,, ,500, 2,830.,, ,200.,,, β, [12]. 90% 2,,,,, [13-15].,, [13, in vitro αα In Vitro α-glucosidase and α-amylase Inhibitory Effects of Herbal Tea Leaves from Yacon (Smallanthus sonchifolius) 1, 1, 1, 2, 1, 2, 3, 1, 2, 1, 2, 1, 2, 1, 2 1, 2, *, 1 2, 3 Yuto Ueda 1, Shintaro

Διαβάστε περισσότερα

PAI PAI-1 PAI-1 PAI-1 PAI-I PAI-1 MMP Leptin [5,6] FFA PAI-1 [9,10] 1 ZJN0504

PAI PAI-1 PAI-1 PAI-1 PAI-I PAI-1 MMP Leptin [5,6] FFA PAI-1 [9,10] 1 ZJN0504 PAI-1 * 150030 E-mail erjinzhi@126.com http://www.paper.edu.cn -1 PAI-1 PAI-1 PAI-1 3 PAI-I PAI-1-1 1. ECM ECM MMP ECM ECM [1] PA / PA PAI PAI 3 PAI PAI-1 PAI PAI-2 Nexin-1 [2] PA/ PAI-1 PAI-2 α 2 - α

Διαβάστε περισσότερα

1 1 型糖尿病と 2 型糖尿病 1 1 型糖尿病

1 1 型糖尿病と 2 型糖尿病 1 1 型糖尿病 ips Key words 1 1 2 1 1 1 β 1A 1B 1 1 abatacept, otelixizumab inverse vaccine T 1 1 1 1 1B β 1 2 1 β 2 2006 ips 1 3 2 2 2 1 95 β β 2 β KCNQ1 UBE2E2 TCF7L2 4 β 5 2 ips β 1 2 TNFα MCP-1 1 6 2 7 NLRP3 β 1

Διαβάστε περισσότερα

1 η Ενότητα: Λιπίδια. Ποιοι υπερλιπιδαιμικοί δεν πρέπει να πάρουν στατίνη;

1 η Ενότητα: Λιπίδια. Ποιοι υπερλιπιδαιμικοί δεν πρέπει να πάρουν στατίνη; 1 η Ενότητα: Λιπίδια Ποιοι υπερλιπιδαιμικοί δεν πρέπει να πάρουν στατίνη; Σταμάτης Μακρυγιάννης, Καρδιολόγος, Επιμελητής Α Καρδιολογικής Κλινικής ΔΘΚΑ «ΥΓΕΙΑ» Επίδραση των διάφορων υπολιπιδαιμικών παραγόντων

Διαβάστε περισσότερα

Metabolic pathways implicated in the pathogenesis and development of obesity-induced osteoarthritis (D155)

Metabolic pathways implicated in the pathogenesis and development of obesity-induced osteoarthritis (D155) ΑΠΟΤΕΛΕΣΜΑΤΑ ΕΡΓΟΥ «Κ. ΚΑΡΑΘΕΟΔΩΡΗ 2010» Metabolic pathways implicated in the pathogenesis and development of obesity-induced osteoarthritis (D155) Dionysios J. Papachristou MD, PhD Associate Professor

Διαβάστε περισσότερα

Η νεφρική ορμονική αντίδραση στην καρδιακή ανεπάρκεια, ως προγνωστικός δείκτης καρδιαγγειακού θανάτου

Η νεφρική ορμονική αντίδραση στην καρδιακή ανεπάρκεια, ως προγνωστικός δείκτης καρδιαγγειακού θανάτου Η νεφρική ορμονική αντίδραση στην καρδιακή ανεπάρκεια, ως προγνωστικός δείκτης καρδιαγγειακού θανάτου Δημήτριος Β. Βλαχάκος Καθηγητής Παθολογίας-Νεφρολογίας Νεφρολογική Μονάδα Πανεπιστημιακό Γ.Ν. «ΑΤΤΙΚΟΝ»

Διαβάστε περισσότερα

Συστηματικά κορτικοστεροειδή και ανοσοκατασταλτικά. Dr Σέρασλη Ευαγγελία Β Πνευμονολογική Κλινική ΓΝ<Γ.Παπανικολάου>

Συστηματικά κορτικοστεροειδή και ανοσοκατασταλτικά. Dr Σέρασλη Ευαγγελία Β Πνευμονολογική Κλινική ΓΝ<Γ.Παπανικολάου> Συστηματικά κορτικοστεροειδή και ανοσοκατασταλτικά Dr Σέρασλη Ευαγγελία Β Πνευμονολογική Κλινική ΓΝ Σημεία κλειδιά κορτικοστεροειδή: παραγωγή από φλοιό επινεφριδίων υπό την επίδραση της

Διαβάστε περισσότερα

ΣΥΣΧΕΤΙΣΗ ΜΙΑΣ ΝΕΑΣ ΙΝΣΟΥΛΙΝΗΣ ΜΑΚΡΑΣ ΔΡΑΣΗΣ ΜΕ ΤΗ ΓΛΥΚΑΙΜΙΚΗ ΡΥΘΜΙΣΗ ΚΑΙ ΤΗΝ ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΑΔΥΝΑΜΩΝ ΟΙΚΟΝΟΜΙΚΑ ΑΤΟΜΩΝ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 2

ΣΥΣΧΕΤΙΣΗ ΜΙΑΣ ΝΕΑΣ ΙΝΣΟΥΛΙΝΗΣ ΜΑΚΡΑΣ ΔΡΑΣΗΣ ΜΕ ΤΗ ΓΛΥΚΑΙΜΙΚΗ ΡΥΘΜΙΣΗ ΚΑΙ ΤΗΝ ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΑΔΥΝΑΜΩΝ ΟΙΚΟΝΟΜΙΚΑ ΑΤΟΜΩΝ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 2 ΣΥΣΧΕΤΙΣΗ ΜΙΑΣ ΝΕΑΣ ΙΝΣΟΥΛΙΝΗΣ ΜΑΚΡΑΣ ΔΡΑΣΗΣ ΜΕ ΤΗ ΓΛΥΚΑΙΜΙΚΗ ΡΥΘΜΙΣΗ ΚΑΙ ΤΗΝ ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΑΔΥΝΑΜΩΝ ΟΙΚΟΝΟΜΙΚΑ ΑΤΟΜΩΝ ΜΕ ΣΑΚΧΑΡΩΔΗ ΔΙΑΒΗΤΗ ΤΥΠΟΥ 2 Αναστάσιος Κουτσοβασίλης 1, Αλέξης Σωτηρόπουλος 1, Δημήτριος

Διαβάστε περισσότερα

Ο ρόλος της δίαιτας στην πρόληψη και την αντιμετώπιση της NAFLD.

Ο ρόλος της δίαιτας στην πρόληψη και την αντιμετώπιση της NAFLD. Μη Aλκοολική Λιπώδης Νόσος του Ήπατος. Μία ολιστική προσέγγιση. Ο ρόλος της δίαιτας στην πρόληψη και την αντιμετώπιση της NAFLD. Χάρης Δημοσθενόπουλος MMedSc.PhDc Κλινικός Διαιτολόγος-Βιολόγος Προϊστάμενος

Διαβάστε περισσότερα

Επιδημιολογία αιτιών θανάτου ςε δφο Καποδιςτριακοφσ δήμουσ του Ν. Πιερίασ (πληθυςμιακή μελζτη 20ετίασ 1991-2010)

Επιδημιολογία αιτιών θανάτου ςε δφο Καποδιςτριακοφσ δήμουσ του Ν. Πιερίασ (πληθυςμιακή μελζτη 20ετίασ 1991-2010) Επιδημιολογία αιτιών θανάτου ςε δφο Καποδιςτριακοφσ δήμουσ του Ν. Πιερίασ (πληθυςμιακή μελζτη 20ετίασ 1991-2010) Καραγιάννη Δ. 1, Μπάμπα Α. 2, Σουμανίδησ τ. 2, Ρίζοσ Π 2., Μπαλτζήσ Δ. 3, κούτασ Δ., ΚοτςαμίδηΙ.

Διαβάστε περισσότερα

Παθοφυσιολογία της Διαβητικής Δυσλιπιδαιμίας

Παθοφυσιολογία της Διαβητικής Δυσλιπιδαιμίας Παθοφυσιολογία της Διαβητικής Δυσλιπιδαιμίας Βασίλης Aθυρος,, MD, FESC, FASA, FACS Ιατρεία Αθηροσκλήρωσης και Μεταβολικού Συνδρόμου, Β Προπαιδευτική Παθολογική Κλινική Α.Π.Θ., Ιπποκράτειο Νοσοκομείο, Θεσσαλονίκη.

Διαβάστε περισσότερα

Αθηρωµάτωση- Στεφανιαία νόσος. Μαρίνα Νούτσου Επιµελήτρια Α Παν. Παθολογικής Κλινικής Ιπποκράτειο Νοσοκοµείο Αθήνας

Αθηρωµάτωση- Στεφανιαία νόσος. Μαρίνα Νούτσου Επιµελήτρια Α Παν. Παθολογικής Κλινικής Ιπποκράτειο Νοσοκοµείο Αθήνας Αθηρωµάτωση- Στεφανιαία νόσος Μαρίνα Νούτσου Επιµελήτρια Α Παν. Παθολογικής Κλινικής Ιπποκράτειο Νοσοκοµείο Αθήνας Καρδιαγγειακά Επεισόδια : Πρώτη αιτία θανάτου στις αναπτυγµένες χώρες Καρδιαγγειακά Νοσήµατα

Διαβάστε περισσότερα

Ankylosing Spondylitis AS. NSAIDs. NSAIDs 100% B27 NSAID ~ 90% FDA EMA

Ankylosing Spondylitis AS. NSAIDs. NSAIDs 100% B27 NSAID ~ 90% FDA EMA 2016 12 12 Ankylosing Spondylitis AS human leukocyte antigen HLA- AS NSAIDs NSAIDs B27 100% NSAIDs NSAIDs 90% NSAID ~ AS 0.25% 2~3 1 100% 1 AS CFDA FDA EMA 14 AS NSAIDs 2 CFDA non-ster- AS 1 oidal anti-inflammatory

Διαβάστε περισσότερα

The Program of the 17 th Annual Meeting on Viral Hepatitis B and C

The Program of the 17 th Annual Meeting on Viral Hepatitis B and C The Program of the 17 th Annual Meeting on Viral Hepatitis B and C Compared to the Meeting of the previous year - Number of Sessions reduced from seven to five - A later start in the morning of Saturday

Διαβάστε περισσότερα

Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών

Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών Ζώων για Παραγωγή Προϊόντων Ποιότητας» 1 Αξιοποίηση Φυσικών Αντιοξειδωτικών στην Εκτροφή των Αγροτικών Ζώων για Παραγωγή Προϊόντων Ποιότητας Γεωπονικό Πανεπιστήμιο Αθηνών Εργαστήριο Ζωοτεχνίας MIS 380231

Διαβάστε περισσότερα

Μεταβολικό φνδρομο: Η νόςοσ του 21 ου αιϊνα

Μεταβολικό φνδρομο: Η νόςοσ του 21 ου αιϊνα Μεταβολικό φνδρομο: Η νόςοσ του 21 ου αιϊνα Βασίλειος ΑΘΥΡΟΣ, MD, FESC, FRSPH, FASA, FACS, FESB Μονάδεσ Αθηροςκλήρωςησ και Μεταβολικού Συνδρόμου, Β Προπ. Παθολογική Κλινική ΑΠΘ, Ιπποκράτειο Νοςοκομείο,

Διαβάστε περισσότερα

Διευθυντής Τμήμα: Διαβήτη-Παχυσαρκίας-Μεταβολισμού Ιδιωτικό Νοσοκομείο Metropolitan

Διευθυντής Τμήμα: Διαβήτη-Παχυσαρκίας-Μεταβολισμού Ιδιωτικό Νοσοκομείο Metropolitan 1 Διευθυντής Τμήμα: Διαβήτη-Παχυσαρκίας-Μεταβολισμού Ιδιωτικό Νοσοκομείο Metropolitan Νεώτερες γνώσεις για το λιπώδη ιστό 2 Τιμητική αμοιβή (Honorarium): - ΑSTRA ΖENECA - BOEHRINGER INGELHEIM - ELPEN -

Διαβάστε περισσότερα

ΣΑΚΧΑΡΩΔΗΣ ΔΙΑΒΗΤΗΣ ΤΥΠΟΥ 2 ΣΕ ΑΣΘΕΝΕΙΣ ΑΦΡΙΚΑΝΙΚΗΣ ΚΑΤΑΓΩΓΗΣ Κώστογλου-Αθανασίου I. 1, Ξανθάκου E. 2, Σπυρόπουλος Π. 3, Αθανασίου Π.

ΣΑΚΧΑΡΩΔΗΣ ΔΙΑΒΗΤΗΣ ΤΥΠΟΥ 2 ΣΕ ΑΣΘΕΝΕΙΣ ΑΦΡΙΚΑΝΙΚΗΣ ΚΑΤΑΓΩΓΗΣ Κώστογλου-Αθανασίου I. 1, Ξανθάκου E. 2, Σπυρόπουλος Π. 3, Αθανασίου Π. ΣΑΚΧΑΡΩΔΗΣ ΔΙΑΒΗΤΗΣ ΤΥΠΟΥ 2 ΣΕ ΑΣΘΕΝΕΙΣ ΑΦΡΙΚΑΝΙΚΗΣ ΚΑΤΑΓΩΓΗΣ Κώστογλου-Αθανασίου I. 1, Ξανθάκου E. 2, Σπυρόπουλος Π. 3, Αθανασίου Π. 4 1 Ενδοκρινολογικό Τμήμα, ΓΝ Ασκληπιείο Βούλας 2 Ενδοκρινολόγος, Σπάρτη

Διαβάστε περισσότερα

Βιταμίνη D και υστηματικός Ερυθηματώδης Λύκος

Βιταμίνη D και υστηματικός Ερυθηματώδης Λύκος Βιταμίνη D και υστηματικός Ερυθηματώδης Λύκος ΛΑΜΠΡΟς ΑΘΑΝΑΙΟΤ ΕΙΔΙΚΕΤΟΜΕΝΟς ΠΑΘΟΛΟΓΙΑς, ΓΝ ΑΚΛΗΠΙΕΙΟ ΒΟΤΛΑς 10 Ο ΕΣΗΙΟ ΤΝΕΔΡΙΟ ΕΠΕΜΤ ΠΟΡΣΟ ΧΕΛΙ 4 2018 Εισαγωγή Ο συστηματικός ερυθηματώδης λύκος (ΕΛ) είναι

Διαβάστε περισσότερα

Πολυπαραγοντική αντιμετώπιση του μεταβολικού συνδρόμου

Πολυπαραγοντική αντιμετώπιση του μεταβολικού συνδρόμου Β ΠΡΟΠΑΙΔΕΥΤΙΚΗ ΠΑΘΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΙΠΠΟΚΡΑΤΕΙΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΣ/ΝΙΚΗΣ Διευθ. Καθηγητής Καραγιάννης Αστέριος Πολυπαραγοντική αντιμετώπιση του μεταβολικού συνδρόμου Νίκη Κατσίκη MSc PhD MD FRSPH Παθολόγος

Διαβάστε περισσότερα

Ο ρόλος της βιταμίνης D στην διαχείριση του καρδιαγγειακού κινδύνου. Πηνελόπη Δουβόγιαννη Κλινική Διαιτολόγος Διατροφολόγος MSc, RD

Ο ρόλος της βιταμίνης D στην διαχείριση του καρδιαγγειακού κινδύνου. Πηνελόπη Δουβόγιαννη Κλινική Διαιτολόγος Διατροφολόγος MSc, RD Ο ρόλος της βιταμίνης D στην διαχείριση του καρδιαγγειακού κινδύνου Πηνελόπη Δουβόγιαννη Κλινική Διαιτολόγος Διατροφολόγος MSc, RD Βιταμίνη D Υγεία των οστών Κακοήθη νεοπλασματικά νοσήματα Διαβήτη τύπου

Διαβάστε περισσότερα

Μεταβολικό Σύνδροµο (NCEP) -2ος ορισµός

Μεταβολικό Σύνδροµο (NCEP) -2ος ορισµός Μεταβολικό Σύνδροµο (NCEP) -2ος ορισµός Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults. JAMA. 21;285:2486-2497. 2497. Σ ή Σάκχαρο >11 >11 mg% Τριγλυκερίδια >15

Διαβάστε περισσότερα

Τα περιοδικά Science και Nature από το 2009 είναι πλέον διαθέσιμα και ηλεκτρονικά μέσω της ιστοσελίδας της βιβλιοθήκης.

Τα περιοδικά Science και Nature από το 2009 είναι πλέον διαθέσιμα και ηλεκτρονικά μέσω της ιστοσελίδας της βιβλιοθήκης. Μετά από προτάσεις που έγιναν ανά τομέα για τις συνδρομές περιοδικών και για τη δυνατότητα online πρόσβασή τους μέσω της ιστοσελίδας της βιβλιοθήκης θα θέλαμε να σας ενημερώσουμε αναλυτικά για τη δυνατότητα

Διαβάστε περισσότερα

ΒUDD-CHIARI SYNDROME (SBC) Νικόλαος Χ. Γραμματικός Γαστρεντερολόγος, Επιμελητής Β ΕΣΥ Β Προπ. Παθολογική Κλινική, ΓΠΝΘ Ιπποκράτειο

ΒUDD-CHIARI SYNDROME (SBC) Νικόλαος Χ. Γραμματικός Γαστρεντερολόγος, Επιμελητής Β ΕΣΥ Β Προπ. Παθολογική Κλινική, ΓΠΝΘ Ιπποκράτειο ΒUDD-CHIARI SYNDROME (SBC) Νικόλαος Χ. Γραμματικός Γαστρεντερολόγος, Επιμελητής Β ΕΣΥ Β Προπ. Παθολογική Κλινική, ΓΠΝΘ Ιπποκράτειο. Budd Chiari Syndrome (George Budd, Hans Chiari) Aπόφραξη των ηπατικών

Διαβάστε περισσότερα

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2

IL - 13 /IL - 18 ELISA PCR RT - PCR. IL - 13 IL - 18 mrna. 13 IL - 18 mrna IL - 13 /IL Th1 /Th2 344 IL - 13 /IL - 18 1 2 1 2 1 2 1 2 1 2 3 1 2 13 18 IL - 13 /IL - 18 10% / OVA /AL OH 3 5% 16 ~ 43 d 44 d ELISA BALF IL - 13 IL - 18 PCR RT - PCR IL - 13 IL - 18 mrna IL - 13 mrna 0. 01 IL - 18 mrna 0.

Διαβάστε περισσότερα

ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΚΟΡΙΝΘΟΥ ΚΑΡΔΙΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ

ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΚΟΡΙΝΘΟΥ ΚΑΡΔΙΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ ΓΕΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΚΟΡΙΝΘΟΥ ΚΑΡΔΙΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ CONFLICT OF INTEREST ΔΕΝ ΑΝΑΦΕΡΕΤΑΙ ΣΚΟΠΟΣ ΤΗΣ ΜΕΛΕΤΗΣ Να καταγράψει τον επιπολασμό του καρδιαγγειακού κινδύνου σε υπερτασικούς ασθενείς υπό θεραπεία, που

Διαβάστε περισσότερα

Διαβητική Νεφροπάθεια. Ηλιάδης Φώτης Επίκουρος Καθηγητής Παθολογίας Διαβητολογίας Α ΠΡΠ, Νοσοκομείο ΑΧΕΠΑ

Διαβητική Νεφροπάθεια. Ηλιάδης Φώτης Επίκουρος Καθηγητής Παθολογίας Διαβητολογίας Α ΠΡΠ, Νοσοκομείο ΑΧΕΠΑ Διαβητική Νεφροπάθεια Ηλιάδης Φώτης Επίκουρος Καθηγητής Παθολογίας Διαβητολογίας Α ΠΡΠ, Νοσοκομείο ΑΧΕΠΑ Ο ΣΔ αποτελεί τη συχνότερη αιτία ΧΝΝ τελικού σταδίου Seminars in Dialysis 23: 129 133, 2010 Δομή

Διαβάστε περισσότερα