ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ"

Transcript

1 ΠΑΝΕΠΙΣΤΗΜΙΟ ΠΑΤΡΩΝ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ Π Μ Σ Φ Ε Τ Κ ύθ : Μ φ, β φ β ά ΜΕΤΑΠΤΥΧΙΑΚΗ ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ ΜΕΛΕΤΗ ΕΠΙΚΥΡΩΣΗΣ ΤΗΣ ΣΥΣΧΕΤΙΣΗΣ ΓΕΝΕΤΙΚΩΝ ΔΕΙΚΤΩΝ ΣΤΟ ΓΟΝΙΔΙΟ MAP3K5 ΜΕ ΤΗΝ ΑΝΤΑΠΟΚΡΙΣΗ ΑΣΘΕΝΩΝ ΜΕ β-μεσογειακη ΑΝΑΙΜΙΑ ΣΤΗΝ ΥΔΡΟΞΥΟΥΡΙΑ ΚΑΙ ΤΗΝ ΒΑΡΥΤΗΤΑ ΤΗΣ ΝΟΣΟΥ ΣΤΑΥΡΟΥΛΑ Α. ΣΙΑΜΟΓΛΟΥ, Φ ΕΠΙΒΛΕΠΩΝ: ΓΕΩΡΓΙΟΣ ΠΑΤΡΙΝΟΣ, Α ω θ Φ, Π Π Πά, Ν β 2017

2 ΕΠΙΒΛΕΠΩΝ ΚΑΘΗΓΗΤΗΣ ΓΕΩΡΓΙΟΣ Π. ΠΑΤΡΙΝΟΣ, ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΣΤΟ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΤΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΠΑΤΡΩΝ ΤΡΙΜΕΛΗΣ ΕΞΕΤΑΣΤΙΚΗ ΕΠΙΤΡΟΠΗ ΓΕΩΡΓΙΟΣ Π. ΠΑΤΡΙΝΟΣ, ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΣΤΟ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΤΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΠΑΤΡΩΝ ΓΕΩΡΓΙΟΣ ΣΠΥΡΟΥΛΙΑΣ, ΚΑΘΗΓΗΤΗΣ ΣΤΟ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΤΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΠΑΤΡΩΝ ΚΩΝΣΤΑΝΤΙΝΟΣ ΠΟΥΛΑΣ, ΑΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΣΤΟ ΤΜΗΜΑ ΦΑΡΜΑΚΕΥΤΙΚΗΣ ΤΟΥ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΠΑΤΡΩΝ 2

3 ΕΥΧΑΡΙΣΤΙΕΣ Η ύ ω θ Μ ύ Π ά Φ Ε Τ Φ Π Π. Τ ά θ Ε Μ Β Α, β ψ ύ Γ Π. Π ύ, Α ω Κ θ Φ. Μ ξ ω ύ, θ θ ω βάθ ά β. Α ά, θ θ φ ά ω ω ύ β, ύ Γ Π, Α ω Κ θ Φ Σ Π Π, ύ ξ ω, ω θ ά, θ ά ά. Ε, φ ω ά ύ ύ, ύ Γ Σ ύ, Κ θ Φ Π ύ Κω Π ά, Α ω Κ θ Φ Π, ξ, ύ β ά. Ε, φ ω ά Δ. Κ Θ ά Δ. Μ ύ Μ ξ, άψ ζ ά ω. Ε, θ θ ω ά ά ά ύ ξ. Τ, θω ά φ ά ω θ θά, ύ, ξ ά ω ά άθ ά ζω. 3

4 ΠΕΡΙΕΧΟΜΕΝΑ 1. ΕΙΣΑΓΩΓΗ ΓΕΝΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΟ ΑΙΜΑ ΕΡΥΘΡΟΚΥΤΤΑΡΟ ΚΑΙ ΕΡΥΘΡΟΠΟΙΗΣΗ ΟΙ ΦΥΣΙΟΛΟΓΙΚΕΣ ΑΝΘΡΩΠΙΝΕΣ ΑΙΜΟΣΦΑΙΡΙΝΕΣ ΤΥΠΙΚΗ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΤΗΣ ΑΙΜΟΣΦΑΙΡΙΝΗΣ ΕΙΔΗ ΑΙΜΟΣΦΑΙΡΙΝΩΝ ΚΛΗΡΟΝΟΜΙΚΕΣ ΔΙΑΤΑΡΑΧΕΣ ΤΗΣ ΑΙΜΟΣΦΑΙΡΙΝΗΣ ΚΑΤΗΓΟΡΙΟΠΟΙΗΣΗ ΤΩΝ ΔΙΑΤΑΡΑΧΩΝ ΤΗΣ ΑΙΜΟΣΦΑΙΡΙΝΗΣ ΠΟΙΟΤΙΚΕΣ ΔΙΑΤΑΡΑΧΕΣ A. ΔΡΕΠΑΝΟΚΥΤΤΑΡΙΚΗ ΑΝΑΙΜΙΑ ΠΟΣΟΤΙΚΕΣ ΔΙΑΤΑΡΑΧΕΣ A. ΚΛΗΡΟΝΟΜΙΚΗ ΠΑΡΑΜΟΝΗ ΤΗΣ ΕΜΒΡΥΙΚΗΣ ΑΙΜΟΣΦΑΙΡΙΝΗΣ B. β-μεσογειακη ΑΝΑΙΜΙΑ B1. ΙΣΤΟΡΙΚΗ ΑΝΑΔΡΟΜΗ B2. ΟΡΙΣΜΟΣ ΤΟΥ ΦΑΙΝΟΤΥΠΟΥ ΤΗΣ β-μεσογειακησ ΑΝΑΙΜΙΑΣ B3.ΠΑΘΟΦΥΣΙΟΛΟΓΙΑ ΤΗΣ β-μεσογειακησ ΑΝΑΙΜΙΑΣ B4. ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ β-μεσογειακη ΑΝΑΙΜΙΑ B4.1.ΜΕΙΖΩΝ β-μεσογειακη ΑΝΑΙΜΙΑ (major b-thalassemia) B4.2. β-μεσογειακη ΑΝΑΙΜΙΑ ΜΗ ΕΞΑΡΤΩΜΕΝΗ ΜΕΤΑΓΓΙΣΕΩΝ (intermedia b-thalassemia) B4.3. ΕΤΕΡΟΖΥΓΗ β-μεσογειακη ΑΝΑΙΜΙΑ/ΣΤΙΓΜΑ (b-thalassemia minor/trait) B5. ΔΙΑΓΝΩΣΗ ΤΗΣ β-μεσογειακησ ΑΝΑΙΜΙΑΣ ΡΥΘΜΙΣΤΙΚΑ ΣΤΟΙΧΕΙΑ ΤΟΥ ΗΒΒ ΓΕΝΕΤΙΚΟΙ ΤΡΟΠΟΠΟΙΗΤΕΣ ΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ Β-ΑΛΥΣΙΔΑΣ ΣΦΑΙΡΙΝΗΣ A. Cis ΡΥΘΜΙΣΤΙΚΑ ΣΤΟΙΧΕΙΑ B. Trans ΡΥΘΜΙΣΤΙΚΑ ΣΤΟΙΧΕΙΑ B1. ΓΟΝΙΔΙΑΚΟΙ ΤΟΠΟΙ ΠΟΣΟΤΙΚΩΝ ΓΝΩΡΙΣΜΑΤΩΝ (QTL) B1.1.QTL ΣΤΟ ΧΡΩΜΟΣΩΜΑ 6q ΚΛΙΝΙΚΗ ΑΝΤΙΜΕΤΩΠΙΣΗ.38 4

5 1.8. ΓΕΝΕΤΙΚΟΙ ΒΙΟΔΕΙΚΤΕΣ ΕΝΤΟΣ ΤΟΥ ΣΥΜΠΛΕΓΜΑΤΟΣ ΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ Β-ΑΛΥΣΙΔΑΣ ΣΦΑΙΡΙΝΗΣ ΓΕΝΕΤΙΚΟΙ ΒΙΟΔΕΙΚΤΕΣ ΕΞΩ ΑΠΟ ΤΟ ΣΥΜΠΛΕΓΜΑ ΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ Β-ΑΛΥΣΙΔΑΣ ΣΦΑΙΡΙΝΗΣ ΣΗΜΑΤΟΔΟΤΗΣΗ ΜΕΣΩ MAPKs ΜΟΝΟΠΑΤΙΩΝ A. ΣΗΜΑΤΟΔΟΤΙΚΟ ΜΟΝΟΠΑΤΙ ERK B. ΣΗΜΑΤΟΔΟΤΙΚΟ ΜΟΝΟΠΑΤΙ JNK Γ. ΣΗΜΑΤΟΔΟΤΙΚΟ ΜΟΝΟΠΑΤΙ p Δ. ΣΗΜΑΤΟΔΟΤΙΚΟ ΜΟΝΟΠΑΤΙ ERK MAP3K Α. ΔΟΜΗ ΠΡΩΤΕΪΝΗΣ Β. ΛΕΙΤΟΥΡΓΙΑ ΤΗΣ MAP3K Γ. MAP3K5 ΚΑΙ ΑΝΤΑΠΟΚΡΙΣΗ ΣΤΗΝ HU ΣΚΟΠΟΣ ΜΕΛΕΤΗΣ ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ ΔΕΙΓΜΑΤΑ DNA ΤΗΣ ΜΕΛΕΤΗΣ ΑΠΟΜΟΝΩΣΗ DNA ΑΠΟ ΑΙΜΑ ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΣΥΓΚΕΝΤΡΩΣΗΣ ΚΑΙ ΚΑΘΑΡΟΤΗΤΑΣ ΤΟΥ DNA ΠΟΛΥΜΟΡΦΙΣΜΟΙ ΠΟΥ ΜΕΛΕΤΗΘΗΚΑΝ Α. rs (g C>A) (MAP3K5- Chr. 6) Β. rs (g T>C) (MAP3K5- Chr. 6) Γ. PROMOTER STR (GCGCG)X (MAP3K5- Chr. 6) [ (GCGCG)4>(GCGCG)5] ΣΧΕΔΙΑΣΜΟΣ ΕΚΚΙΝΗΤΩΝ ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (PCR) ΑΛΛΗΛΟΥΧΙΣΗ DNA PCR-RFLP (Restriction Fragment Length Polymorphism) ΑΝΑΛΥΣΗ ΕΤΕΡΟΔΙΜΕΡΩΝ (heteroduplexanalysis, HDA) ΗΛΕΚΤΡΦΟΡΗΣΗ ΣΕ ΠΗΚΤΗ ΑΓΑΡΟΖΗΣ ΣΤΟΙΧΕΙΟΜΕΤΡΙΑ ΚΑΙ ΠΡΩΤΟΚΟΛΛΟ ΑΝΤΙΔΡΑΣΗΣ PCR ΣΤΟΙΧΕΙΟΜΕΤΡΙΑ, ΠΡΩΤΟΚΟΛΛΟ ΚΑΤΑΤΜΗΣΗΣ ΚΑΙ ΗΛΕΚΤΡΟΦΟΡΗΣΗΣ ΓΙΑ ΤΟΝ rs ΑΠΟΤΕΛΕΣΜΑΤΑ.88 3.Α.rs (A>C)..89 5

6 3.Β.rs (T>C) Γ.SHORT TANDEM REPEAT (GCGCG) ΣΤΟΝ ΥΠΟΚΙΝΗΤΗ ΤΟΥ MAP3K ΣΥΖΗΤΗΣΗ ΠΕΡΙΛΗΨΗ ABSTRACT ΒΙΒΛΙΟΓΡΑΦΙΑ

7 ΣΥΝΤΜΗΣΕΙΣ ΚΑΙ ΞΕΝΟΓΛΩΣΣΟΙ ΟΡΟΙ O 2 : ξ CO 2: ξ ά θ N 2: άζω LT-HSC: long-term β ύ, long-term hematopoietic stem cell ST-HSCs: short-term β ύ, short-term hematopoietic stem cells CLP: φ ύ, common lymphoid progenitor CMP: ύ ύ, multipotent common myeloid progenitor MEP: ά θ ά ύ, megakaryocyte-erythroid progenitors GMPs: ά ύ - φά, granulocyte-macrophage progenitors CFU-E: ω ύ ά θ ά, Colony- Forming Unit Erythroid BFU-E: ά ύ ύ θ ά, Burst-Forming Unit Erythroid EPO: θ ΝΟ: ξ ζ HbF : β φ ( 2 2 ) HbA 2 : φ Α 2 ( 2 2 ) HbA: φ Α ( 2 β 2 ) HPFH: β φ, hereditary persistence of fetal hemoglobin 7

8 HbS: φ S SCD: HbC: φ C MCV: Ο μέσος όγκος ερυθρών, Mean Corpuscular Volume MCH: μέση περιεκτικότητα αιμοσφαιρίνης, mean corpuscular hemoglobin HBB: o ω β- IVS1: 1 HBB ( bp) IVS2: 2 HBB ( bp) LCR: locus contro lregion, ύ HSs: θ θ, erythroid-specific DNAse hypersensitive sites KLF1: θ ά Krüppel 1 5' 3' UTR: 5 3 άφ SNPs: φ HU: ξ CAR: Central African Republic Bantu, ζ β S ά ξ BAN: Bantu Central African Republic (CAR), ζ β S ά ξ BEN: Benin, ζ β S ά ξ CAM: Cameroon, ζ β S ά ξ SEN: Senegal, ζ β S ά ξ MAP3K5: ω ά ά ά, mitogen-activated protein kinase kinase kinase 8

9 9

10 1. ΕΙΣΑΓΩΓΗ 1.1ΓΕΝΙΚΑ ΣΤΟΙΧΕΙΑ ΓΙΑ ΤΟ ΑΙΜΑ Τ θ ά φ ά, ά ά ω ύ ά. Τ ά : Ν ( ά 90%) Ο ω : o ω ΐ ( ω β, φ, ω ) φ ά ω ω ά o ζ o ξ o ύ o άφ ζ o o o β ω ύ β ύ Α ω ξ (O 2 ), ξ ά θ (CO 2 ) άζω (N 2 ) Σ φ ά : θ ά φ ( θ ύ ) φ ω ω φ ά O 2 CO 2. ά φ ( ύ ) βά. ά θ ύ ά ω βά ξ ω (Vander, 1997). 10

11 1.2.ΕΡΥΘΡΟΚΥΤΤΑΡΟ ΚΑΙ ΕΡΥΘΡΟΠΟΙΗΣΗ Η ω θ ά ω φ ά O 2, β ύ CO 2, ά ύ β ω. Η ω ξύ ύ βά ζ φ. Η φ ύ ω ΐ ω ω θ ά ω. Η Ο 2 ά φ ύ CO 2. Σ φ ύ, Ο 2 CO 2 ύ. Κ ά ω ω, φ β ύ CO 2 βά Ο 2 φ φ. Τ θ ύ φ, ά ά θ ά. Η ά 8 m ύψ 2 m. Χ ζ ψ φά ω ύ. Η β ά θ ά θ, ύ φ ά. Τ θ ύ ά ζω 120, ω ά θ. Η ω ω θ ά ω ά ζω ω. Τ ύ ά ύ ω θ ά ω ά ω ω ά ω ά ω φ ύ. Η φ ω θ ά ω θ ύ (Vander, 1997). Σύ φω, long-term β ύ (long-term hematopoietic stem cell, LT-HSC) ύ short-term β ύ (short-term hematopoietic stem cells, ST-HSCs). Α ST- HSCs ύ ά ά ύ ύ (multipotent common myeloid progenitor, CMP) ά ά φ ά ύ (common lymphoid progenitor, CLP). Τ CMP φ ά θ ά ύ (megakaryocyte-erythroid progenitors, MEP), ά ύ - φά (granulocyte-macrophage progenitors, GMPs). Έ ω 11

12 MEP φ, ά, ά ύ ύ θ ά (Burst-Forming Unit Erythroid, BFU-E), ω άζ ω ύ ά θ ά (Colony-Forming Unit Erythroid, CFU- E), φ ύ ύ (Π θ β ά, Β φ Ε θ β ά, Π ω φ Ε θ β ά Ο θ ω Ε θ β ά ). Α θ ω θ β ά,, ύ ύ (Retic) θ φ θ ύ (Εικόνα 1) (Sankaran V., 2015). Τ ω θ ά ω ω θ ά ω, θ (EPO). Η θ ω ΐ 166 ξ ω, ά φ ύ ω ά ξ. Η EPO ω θ ά ω ω, φ θ Ο 2 ά ψ ω ω ω. Α θ ω, ύ Ο 2 φ ύ ω EPO (Jelkmann W, 1992). Εικόνα 1: Π. Σ ά ζ φ ύ ά ω ω θ ά ω (Sankaran V., 2015). 12

13 1.3.ΟΙ ΦΥΣΙΟΛΟΓΙΚΕΣ ΑΝΘΡΩΠΙΝΕΣ ΑΙΜΟΣΦΑΙΡΙΝΕΣ ΤΥΠΙΚΗ ΔΟΜΗ ΚΑΙ ΛΕΙΤΟΥΡΓΙΑ ΤΗΣ ΑΙΜΟΣΦΑΙΡΙΝΗΣ Ή 1950, άθ ω ύ φ. Η άθ θ 1960 Max Perutz, θ β β Ν Τ ω ϊ θ φ, ά ύ. Τ ύ φ ά ω ύ ω ϊ θ φ, θ ξ ω ά φ ξ. Π, - φ 141 ξ β- φ 146 ξ. Δύ - ύ β- ζ ά ά. Ε ζ 7 φ φ - β- (Marengo-Rowe, 2006). Σ θ 4 ύ φ, ζ ά, - ω φ ΙΧ, - ά. Έ, ύ φ βά. Τ ω ζ θ ά (Fe II ). Η φ θ ά, ξ ω θ ά ω, ω φ O 2 ύ ύ φ, ά ξ ά θ (CO 2 ), ξ ά θ (CO) ξ ζ (ΝΟ). Η φ ά ω ω (O 2, CO NO) ά ω ω φ. H φ ά CO 2, ά CO 2 ά θ ύ β. Μ O 2, ξ ω θ ύ (Fe III ). Η ύ φ O 2 φ άζ φ θ φ ω ξύ ω ω, ξ ω,. (Εικόνα 2) 13

14 Εικόνα 2: Α)Α ω ά ω ω ά, ά ω ω ω ά φ ά ω ω. Β ύ β- ω. Ε ζ θ ύ φ θ. Κ β ά ω φ άθ θ φ ( 34g/dL), φ ά O 2. Β)Α φω φ ξ ξ - φω. Τ ά ζ ά (Alan N. Schechter, 2008) ΕΙΔΗ ΑΙΜΟΣΦΑΙΡΙΝΩΝ Η θ ω ϊ ύ φ ά ά ω φ ω ά ξ θ. Κ ά ά ζω θ ζ ξ φ φ, ω ϊ ά ύ ύ ζ ά ω φ, ω ύ ω ω ύ ά φ. Σ άθ ά ά ξ φ άζ φ ύ ω φ. 14

15 Σ φ ά θ ύ 97% φ ζ φ HbA ( θ ύ ύ β, 2β 2 ), 2% HbA 2 ( θ ύ ύ, 2 2 ) 2% ά β φ HbF ( θ ύ ύ -, 2 2 ). Ο - ύ ω ω φ HbF. Σ φ - φ άζ β- - φ, άζ - φ HbF. Σ ά β ά ξ, ζ ζ- ( ά - ) άζ - φ ύ φ HbPortland (ζ 2 2 ), - φ ύ φ HbGower1 ( ζ 2 2 ) - φ ζ HbGower2 ( 2 2 ). Η φ ω ω ζ ζ ά ά ξ θ ύ ά θ φ ύ ( 1 2) ύ ω ( G Α ) HbF. Ο ύ - ύ ά. Η φ ά ζ ω ά θ 136. Μ ά θ φ ω ω φ. Π ύθ φ ά ά ξ. Έ, ω ύ - ζ φ άζ ω θ, ω θ φ ω ω. Α ξά φ ω ω β ( - β ), ά HbF HbA HbA 2 ά ζω, φ θ HbF, ζ ά ύ 2% φ. Τ ύ θ ζω ω (Εικόνα 3 και Εικόνα 4). Φ ω ά φ άζ βά ξ, ω ύ ά 15

16 φ ζ 5 3 ά DNA, ά άβ β ζω. Τ ύ - ύ ζ ω ω 16, ύ β- ύ ζ ω ω 11 (Εικόνα 3). Εικόνα 3:Τ ύ - ύ ω ω 16 ύ β- ύ ω ω 11. Τ β ύ θ θ DNA ζ θ ύθ. Τ G Α ω ϊ - φ φ ά ω θ 136 ϊ ζ ξύ. Σ ά ζ θ φ ά ζω ά. Ε φ ά ύ θ ύ ά ά ά ξ (Weatherall D.J., 2001). 16

17 Εικόνα 4: Τ ύ β ύ ω Τ ύ 2/3 β ύ. Σ ά ω ζ φ φ ά φ ά ά ά ξ. Π ύ ω HbF ω ύ ύ ύ φ (Alan N. Schechter, 2008) ΚΛΗΡΟΝΟΜΙΚΕΣ ΔΙΑΤΑΡΑΧΕΣ ΤΗΣ ΑΙΜΟΣΦΑΙΡΙΝΗΣ ΚΑΤΗΓΟΡΙΟΠΟΙΗΣΗ ΤΩΝ ΔΙΑΤΑΡΑΧΩΝ ΤΗΣ ΑΙΜΟΣΦΑΙΡΙΝΗΣ Γ φ ά ύ β ϋ θ : ( ) θ ω ω φ (β) ω ω ω φ, ζ ω ω θ ά ω. Ό ϋ θ ά, ύ θ ά ύ β ά ά β. 17

18 Π 7% θ ύ φ φ, θ ω φ ω θ ω. Ο ω φ ξ ά ω φ ω ω φ, ω φ β ύ θ φ. Ο φ : ( ) β άβ ύ θ ά ύ ω ύ φ ( ) (β) β άβ ύ β ω ω άζ ( ). Υ ά, ύ ά ω φ β, β φ (hereditary persistence of fetal haemoglobin, HPFH). Α,, φ φ ύ φ ΠΟΙΟΤΙΚΕΣ ΔΙΑΤΑΡΑΧΕΣ Πά ω 700 φ θ. Μ ξύ ω HbS (SCD) ( ά µ ύ ξ β θ 6 β- φ ), φ C ( ά ύ ξ θ β- φ, HbC) φ Ε ( ά µ ύ ξ θ 26 β- φ ) φ ζ ψ φ ύ θ ύ ( 18

19 Η HbS ζ ω Μ, Μ Α Ι, HbC ζ Δ Αφ Μ. Η HbE φ ζ ψ Ι Ν Α Α. ΔΡΕΠΑΝΟΚΥΤΤΑΡΙΚΗ ΑΝΑΙΜΙΑ H SCD β ω άθ. Τ φ ά ω θ ά ω ά θ ξ. Π ά ξ GAG GTG ω 6 ά ύ ξ ( φ φ ) β ( φ θ φ ) θ 6 β- φ (Kolliopoulou A, 2017). Η ύ θ ω - ω φ ά ύ ω - ω θ β S - ζ φ S (HbS). Η HbS, ζ ά θ ζά θ ύ θ ξ. Τ θ ύ φ ά. Σ θ ύ HbS φ β ά ( θ φω φ ) θ ζ ω ά ω ω ξ. Η ξ ω β άβ ω β ω ϊ ω θ ά ω HbS, θ βά ω β ά. Τ θ ύ HbS ά θ ά ύ φ ά ξω ω ω ά ω ά ύ. (Εικόνα 5). Τ φ θ ω ζ ά. Σ, ω, ύ ύ ά θ βω φ ξ φ, ζ φ ά (Deepa Manwani, 2013). Η φ ά ω ω ά ω ύ ύ, 19

20 ξ θ β ά, ύ φά. Ά ά ά ω, άθ ξ, φ, ω, φ β άθ (Kanter J, 2013). Εικόνα 5:Ε θ ά φ HbS φ φ (Telen Marilyn J, 2016) ΠΟΣΟΤΙΚΕΣ ΔΙΑΤΑΡΑΧΕΣ Σ ά θ. Ο θ ξ ύ ξ : ) -θ β) β-, ) β-θ ) β-θ, βά φ θ ά. Κάθ φ ζ ά. Σ θ ύ θ HPFH. Η -θ θ ζ ά ά ω ω ω ύ θ - φ. 20

21 Ο β-θ ύ ω β 0 -θ, ά β- θ β + β ++, ζ β ω ω β- φ. Ο β- β-θ, ά ά, ύ ά φ ω β- φ, ω β ω Α. ΚΛΗΡΟΝΟΜΙΚΗ ΠΑΡΑΜΟΝΗ ΤΗΣ ΕΜΒΡΥΙΚΗΣ ΑΙΜΟΣΦΑΙΡΙΝΗΣ Σ HbF ζ ά φ. Ο ά HbF 0,8-5%, ά ω ω β φ (HPFH) (Menzel S, 2007). Η ψ ω φ HbF ά, 1960 θ ύ ω ω Ε ω. Η HPFH φ ω άξ ω. Ο άξ άξ ω - ω ( ω ά θ -117 θ ξ φ ) φ ω ω ψ (Meera Berry, 1992). Η HPFH ά ω HbF ζ ξ θ ά -. Ά ζ ά ξ SCD ά β φ β- ζ άξ ύ ύ θ β- φ ύ ά ξ HPFH φ ζ φ. (Weatherall D.J., 2001). Η ω ξ ω ω HbF SCD β-, ω ά φ ω ω ω ύ φ ά ά ω ω 3 (Nienhuis AW, 1978) (Pembrey ME, 1978). Η φ β φ φ θ ζ ά θ cis- θ ά φ ύ ά. Ο άξ HPFH άξ ψ. Έ 21

22 φ άξ ω G A ω, ξύ ω θ ω -141 ω -202 ά θ ξ φ ω - ω. Ε, άξ ύ ω θ ω GATA-1 NFE4 ά ζ CAAT. Σ ζ ά άξ G, HbF ξύ 10-30% ξύ 4-20% ζ ά άξ A. Ε ψ ξύ ω θ ω ά Α ξ ύ 3 ά Α HbF 30%. Ε ψ 3 ά β φ ζ ξ φ ω - ω ζω ξ HbF HPFH ω ω HPFH φ ύ ύ. Τ φ 3 ά θ ά - (Arthur Bank, 2006) (Katsantoni EZ, 2003) (Ugo Testa, 2009). Ε, ψ ύ ξ φ ω - ω ζ β ύ θ. Ο ψ ξ ύ ξύ, ά ύ φ ω - ω HPFH. Η φ ά ξύ HPFH β φ ά φ ω ω φ ύ ψ. Μ ά ψ, φ Corfu φ 2 θ ζ φ Corfu φ ζ HbF 88% 90%. Η ψ ξ ά 7,2 kb ά 5 ά (Chakalova L, 2005). Η ξύ ω ω φ ζ φ ω - ω φ β ά (Εικόνα 6) (Arthur Bank, 2006). 22

23 Εικόνα 6:Σ άξ φ ύ β- ύ. Τ x ά ξ ψ. Η ψ β ύ ψ ζ HPFH (Arthur Bank, 2006) Β. β-μεσογειακη ΑΝΑΙΜΙΑ Β1. ΙΣΤΟΡΙΚΗ ΑΝΑΔΡΟΜΗ Τ 1925, Thomas Cooley Pearl Lee άφ β φ ά Ι ω φ ζ φ. Μ άφ ά, ά. Η θ ά «β-θ» «β-μ Α», θ ζ ξ «θά», ύ θ ω θ ζ ά Μ. Σ φ ω ζ ύ ω Μ θά, ά ω. Σ β- ω ω. Ε ζ ύ θ ύ Μ, Μ Α Α. Ε ά θ ύ φ ω. Σ Κύ φ 14% θ ύ, Σ 12% Ν - Α ζ ά ψ. 23

24 Η ψ β- ζ θ Plasmodium falciparum. Σ φ β- β Plasmodium falciparum. Ω, ξ ά θ ύ, β- ζ ά ά Β Ε, Β Ν Α Α (Cao A., 2010) Β2. ΟΡΙΣΜΟΣ ΤΟΥ ΦΑΙΝΟΤΥΠΟΥ ΤΗΣ β-μεσογειακησαναιμιασ Σ ά β- ζ β θ, ω θ ύ ά ω φ θ ύ ω φ φ ύ ω. Δ, ά. Π ά ω ύ ω φ ύ ω β (major) (mild), ά ά ύ θ ύ. Ο φ, φ ά ά ω ά ω ω, ω θ, φ θ β ύ ύ. Π θ β- ω θ, θ ω θ ξ θ ά φ θ, ά ύ ύ φω φ. Η β- φ ζ ξ β : ά, ά ζ β-. Η β θ ξ ά ξύ ω β- ω φ, β θ. 24

25 1.4.3.Β3. ΠΑΘΟΦΥΣΙΟΛΟΓΙΑ ΤΗΣ β-μεσογειακησ ΑΝΑΙΜΙΑΣ Σ β- ω ψ ω β- ω φ ά φ, ω ύ θ ω - ω, ύ ω ω β- ω θ ύ φ. Ω, - ύζ. Η ύζ ω - ω φ ω ω θ ά ω ά ω - ω, ω ά ω (hemichromes), ύ β άβ β ά (Εικόνα 7). Τ ά ω ύζ ω - ω ύ ά θ β ά ω ω ΐ band 3, ω ΐ band 4.1. Α θ ω ω β άβ β ά ω θ φ ω. Η θ ξ ά ύ φ. Η ξ ω ω β ω ϊ ω " " φά ω θ ά ω, ω φω φ, ά θ ά ύ ά φω, ω ά ύ φ. Η φω φ ξ (Taher Ali, 2017). Η β άβ β ά ω θ ά ω, θ ύ ω, ω θ ά ω φ φ φ ω θ φ ω. Ά θ θ β β ά ά ξ ω ά ω. Η ύ ω ξ ω ω, ύξ ω ω θ ύξ ύ ω ω θ ά ω ω. Ο ξ ω ω θ ά ω ω ύξ ύ ω θ φ. 25

26 Ο θ θ ύ φ, ξά φ, φ ω. Ε άζ. Η ύ θ φω φ β ά ω φ θ ά ω θ βω (Εικόνα 8). Σ θ, ω ΐ ύ ω, φ ψ. Η φ ύ ω ΐ - θ ξ ω. Η φ ζ φά ω ά ω, ω φά ω. Μ ά θ ω φ, φ ά ά φ. Η ψ 25 ξ, ω HAMP ύ θ. Τ ύ ύ θ ζ ω ψ. Η ψ ά φ. Μ ψ φ, ά φ ω ά θ ω φ. Ό ψ ά, ύ θ ψ ξά θ ω ύ. Α θ,, ύ θ ψ ξά θ ω ύ (Rossi, 2005). Ε ψ ξά θ ξ. ω ω θ ά ζ β-, ψ β θ ά. Η ω φ ψ β φ ω ά, ύξ φ ω. Ό φ, ω ΐ,, φ ζ ω φ, ω ύ ύθ ω ζ ω Fenton. Ο ύθ ζ ξ ω β άβ,, ω ΐ φω φ β ά ω ά ω, β β β ζω ά θ ζω, ω ά, (Εικόνα 9) (Origa Raffaella, 2017). 26

27 Εικόνα 7: Σ ω ά ω ω ύζ ω - ω (hemichromes) (Rund D., 2005) Εικόνα 8: Σ ύ ω ά ω ω ύζ ω - ω. Ο ω ά ω ω - ω θ. Λ ω ω ξ ω ω ξά θ, φ. Κ φ ω ύ (Nancy F. Olivieri MD, 1999). 27

28 Εικόνα 9: Σ ω θ φ β-. Σ β- -, - β- (Rund D., 2005) Β4. ΚΛΙΝΙΚΗ ΕΙΚΟΝΑ ΤΩΝ ΑΣΘΕΝΩΝ ΜΕ Β-ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ Β4.1. Μείζων β-μεσογειακή αναιμία (major b-thalassemia) Η ζω β- β ά φ β- θ ζ HbA ω ω β- ω φ. Κ ύ φ β- φ φ άξ. Π ζ ά ξ ζ άξ ω, άζ ύ θ β- (β + /β 0, β 0 /β 0 β + /β + ). Τ 28

29 ά φ ζ ύ ζω ά, θ ά ω HbF. Τ ά ω, άζ β ψ φ, ά, θ, β ξά ύ ω φ θ ύ, ω ω. Ι, ω ψ ω, θ ά θ ζ ά, ζ β- ζ θ ά ξ, ω,, φ ω ϊ ύ,, ω ά ω ά ω, ά ξ ζ ω ξω β, ω ύ ω. Α β βά ω ά ά ω ά ω ά ω ω. Έ, ά ά θ φ ζ ά ξ ά ω ω. Α ξ ά β φ ω, ά ω φ 9,5-10,5 g/dl, ά ξ φ ω ύ. Σ, θ ζ β- άζ φ ω ύ ά θ ω. Α θ, ζ ά, θω 2-3 ζω. Η β ω ω ω ά ζ βά θ ω ά ω 40 (Cao A., 2010) (Origa Raffaella, 2017) Β4.2. β-μεσογειακη ΑΝΑΙΜΙΑ ΜΗ ΕΞΑΡΤΩΜΕΝΗ ΜΕΤΑΓΓΙΣΕΩΝ (intermedia b- thalassemia) Μ ω ύ ξ ω β- φ. Τ ά ά ω ύ β φ άζ β ύ ζ β-. Σ β- ξ ω ύ ύ φ β- φ (β + /β + β 0 /β). Σ θω ω ω β- ω. 29

30 Τ β ά ά ω ζ θ β- ξ ω ύ ζ : i. θ φά ω ω ά ω ii. φ iii. ά ω ω. Α ύ θ, ά ά θω θ ψ ά HbF, θ ζ ψ HbA. Σ ά ά ω φά. Ό φ ά β ύ β- ξ ω, φ ζ θ 2-6, θ β ω, άζ θ ά ξ. Κ ά ά, θ β ύ φ φ, φ ζ ά θ ζ β-, ω ά φ ύ ω. Α ά, φ ά φ, θ ω ζω. Χ φ ά ω ω ξ ά ω (Galanello and Origa, 2010) Β4.3. Ετερόζυγη β-μεσογειακή αναιμία/στίγμα (β-thalassemia trait/ β-thalassemia minor) Χ ζ ω ζ ά β 0 β + -θ Π ω ά ύ ά ά. Π ά ω, ω ω ω θ φ ω (Mean Corpuscular Volume, MCV) φ (Μean corpuscular hemoglobin, MCH) ζ ξ HbA 2 φ ξ HbF 50% ω ω. Λ φ άζ ζ -. Σ MCH MCV ύ ά φ, HbA 2 ά ξ (Stamatoyannopoulos George, 2001). 30

31 1.4.3.Β5. ΔΙΑΓΝΩΣΗ ΤΗΣ β-μεσογειακησ ΑΝΑΙΜΙΑΣ Ο β- φ ω ά θ ύ ύ - ζ HbA. Τ β- φ ύ ά, β- -. Λ ω ύ ω ω β- ω, φ ζ ω ύ θ HbA. Η ζ φ β- β φ ά ω 2. Τ ά φ ζ β,. Η β- ξ ω ά φ ζ ά. Σ ζ φ β-θ ύ Hb ω 7 g/dl, θ ά ω (mean corpuscular volume, MCV) ξύ fl Hb (mean corpuscular Hb, MCH) ξύ pg. Σ ά φ β- θ Hb ξύ 7 10 g/dl, MCV ξύ fl MCH ξύ pg. Η ά ω φ β-θ ζ ω MCV MCH, ξ HbA 2. Ο ζ β0-θ θ ζ β- φ HbF 92-95% Hb. Σ ζ β + ζ β + /β 0 HbF 70-90% HbA 10-30% Hb ΡΥΘΜΙΣΤΙΚΑ ΣΤΟΙΧΕΙΑ ΤΟΥ HBB Τ ω β- φ (HBB) άζ β ύ ω 11, ύ β- ύ. Ε άζ ω - φ, ω - ύ ά ά β ύ, β ά ψ ψβ1. Τ ά φ ά ξ φ (Εικόνα 3). Α G 31

32 Τ HBB, 1,6 Kb, ξ, ύ IVS1 ( bp) IVS2 ( bp), ξύ ω ω ω 30 31, ' 3' άφ (untranslated regions, UTRs) (Εικόνα 10). Σ ύθ HBB ζ ζ 5 ά ( ζ TATA, CAAT, CACCC ) ά θ άζ 50 kb ά HBB. Α, άζ ύ (locus control region, LCR), θ θ DNA 1 (erythroid-specific DNAse hypersensitive sites, HSs). Μ θ ύ φ ά ω GATA-1, θ ά 2 θ ά Krüppel 1 (KLF1) (Origa Raffaella, 2017). Μ ω β- φ θ β-, θ ά ω 200 άξ. Ο άξ ψ ω ύ βά ω, ψ ω βά ω. Ο ψ άζ HBB ύ ά, ξ ψ 619 bp ζ 3 ά. Η ά ξ θ ύ Sind Punjab Ι Π ά. Ε, ψ LCR, ω β- φ. (Cao A., 2010) Ο άξ ύ β-θ ύ ξ θ ύ ω ξ : i. Μ άξ ii. Μ άξ θ ω mrna iii. Μ άξ iv. Μ άξ ά ω v. Μ άξ άζ ξ RNA H φ β 0, β-, ύ ψ ω ξ, άξ, άξ ύ ά ω άξ. Α θ, φ β +, ζ ω ω ω β- ω, ύ 32

33 ω άξ ω ( CACCC ΤΑΤΑ ) άξ θ ω. Ο άξ β- ύ θ ύ ω β, ω ά β θ ω ύ θ β- φ. (Origa Raffaella, 2017). Σ 10 φ ά άξ ζ HBB ζ β-. Εικόνα 10: Τ HBB. )Μ φ 5 3 άφ. Μ ζ ξ. Ο θ θ ξ ω ά ξω β)σ ύ ω άξ ω φ β- ύ (Origa Raffaella, 2017). Π ά ά ω άξ ω, άξ θ θ ύ (Εικόνα 11 και Εικόνα 12). 33

34 Εικόνα 11: Η ω άξ ω β- θ. Μ ά άξ. Σ ω ζ β-, ά φ ω ω (Weatherall D.J., 2001). Εικόνα 12: Κ ω άξ ω β- Σ ά ω άξ ξύ ύ θ ύ (Cao A., 2010). 34

35 1.6. ΓΕΝΕΤΙΚΟΙ ΤΡΟΠΟΠΟΙΗΤΕΣ ΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ β- ΑΛΥΣΙΔΑΣ ΣΦΑΙΡΙΝΗΣ Η φ ω ω ω ύ β- φ, άζ ύ β ω ω ύ β- ύ (in cis), ω ω 11, β ω 11 ύ ύ β- ύ (in trans). 1.6.Α.Cis-ρυθμιστικά στοιχεία Σ cis- φ ύ ύξ ω ω HbF ά rs (C>Τ) θ -158 bp θ Cap XmnI- G γ (HBG 2 ). Φ ά Xmnl- G γ ξ ω ω G ω ά β-. Ε, ά (C>G) θ -202 bp ά θ Cap HBG 2 θ ζ ξ HbF ά G -β+-hpfh (Collins FS., 1984). Ε θ ω, Shen et al β θ ά (C>G) θ -369 bp, ψ HbF (Barbosa CG, 2010) (Shen SH, 1981). Ε, ψ ά ω ζ βά ω (AGCA) ξύ ω θ ω -222 bp -225 bp HBG1, φ ζ φ HBG 1 (Gilman JG J. M., 1988), θ SNP θ -271 bp HBG1 HbF (Barbosa CG, 2010). Ε, άξ θ θ 2 ω DNA Ι ύ β- φ (LCR-HS2) ζ ψ φ HbF θ β- ύ ύ ύξ θ ω F- ά ω φ XmnI- G (Taha Merghoub, 1997). 1.6.Β. Trans-ρυθμιστικά στοιχεία Π ω β ω cis- θ ω ύ ω ω HbF, φ trans- θ ά (Thein SL, 1990) (Steinberg MH,2009). 35

36 Σ άθ ω φ άζ HbF, ω β- (trans- ά ). Μ ξύ «ω ά ω» (Quantitative Trait Loci - QTL) ζ ω Xp22, 6q23, 8q 2p Β1.Γονιδιακοί τόποι ποσοτικών γνωρισμάτων (QTL) Ο ω ά ω DNA,, ζ φ. Έ φ ά QTLs φ ξ ω HbF. Ε, QTL φ ύ φ ζ φ ά ω. Η ω QTL ω φ ά, ω ά ω - Η άφ βά, ω HbF, (molecular tags), ω φ (SNPs). Ο ω QTL, ά ω ω, φ trans- ά φ β φ ω ω, ω, ά ξ ω ω φ HbF, ψ ά HbF ά θ β Β1.1. QTL στo χρωμόσωμα 6q23 Ο Craig ά, 1996, ά Ι, βά ά HPFH, άφ θ ζ ά ω. Τ ά ύ (D6S262 D6S314) θ 6q22.3- q24. Έ, ξ ά ά ω β φ ζ ω ω 6q, QTL ω ω 6q (Craig JE, 1996). Α, ά HPFH, β- -, 36

37 , ά ξ ύ QTL ύ ύ (D6S976 D6S270). Ε, ά ύ θ QTL 1-2 cm (centimorgan, ά ), β 1,5 Mb ξύ ω ύ. Τ ά ξ, ω ω 6q23, QTL φ ω HbF ω F- ά ω (Garner C, 1998). Σ Sanger Centre, Cambridge, θ ύ θ ά ω ά ά ψ β ω ω ά ω (BAC) Ρ1 ω ω ά ω (PAC) 3 Mb 6q23 βά ω MAP3K5 (mitogen-activated protein kinase kinase kinase 5), φ άζ ύ, 800 kb, ά, ω MYB HBS1L (Game L, 2000). Η ά ω ω,, άφ θ, θ Η ά ψ ύ ψ φ άζ ζ 6q23.2, φ bp (~ 1,5 Mb) ζ D6S270 DbAD6 ( β PDE7B). Η ω θ ω ύ ω ΐ. Π, ω ύ ω ΐ AHI1, ΜΥΒ, ALDH8A1, HBS1L PDE7B. Σ ά ζ άξ, ά (HBS1L, ΜΥΒ AHI1) φ άζ θ ά ύ (Close J, 2004). Ε, Wyszynski ά, 2004, ω 180 SNPs άζ θ. Ο θ ύ HbF θ. Η HbF β θ SNP ά QTL 6q22.3-q23.2. Α ά, ύ SNP ά ύ QTL θ ύθ ύ HbF ά άξ θ 20%. Σ, θ ά 44 SNP ω ξύ 136,1 Mb 137,5 Mb ω ω 6q. Δ SNP, ζ φ ά 20-30% HbF, β ω ω PDE7B, MAP7, MAP3K5 PEX7. Α, ά 37

38 6q22.3-q23.2 QTL, ω ύ trans-, βά φω β ύ HbF (Wyszynski DF, 2004). Ε, 6q22-23 φ ζ θ ξ (hydroxyurea, HU), φ ύξ ω ω ΗbF, θ SCD. Ω, QTL ω ω 6q22-23 άζ HbF θ HU ά ω (Ma Q, 2007) ΚΛΙΝΙΚΗ ΑΝΤΙΜΕΝΤΩΠΙΣΗ ΠΡΟΓΡΑΜΜΑ ΜΕΤΑΓΓΙΣΕΩΝ Σ ζ β-, βά ω ω ά ω ξ φ. Π ξ ω ω, β ά Β - φά ω θ φ ω. Σ ω ζ β- άθ 2 ω 5 β ά Hb ά ω g/dl. Η ζ ξ ά ml/kg/per day θ ά (5 ml/kg/hr) άξ θ. ΣΠΛΗΝΕΚΤΟΜΗ Η ω θ ω ξ ύ φ β θ βω, ά ω ύ ω. Η ύ ξ ω ζ -β ξ ( ζ ύ ω ml/kg/year). Α ύ ω άζ ά φ ω, θ θ β θ (Rund D., 2005). 38

39 ΘΕΡΑΠΕΙΑ ΤΗΣ ΥΠΕΡΦΟΡΤΩΣΗΣ ΣΙΔΗΡΟΥ Α φ ω ω φ ω ύ, θ θ β. Η φ ω ύ ά, ω, β ά ά ξ ω. Γ φ ω ω φ ω ύ ά ά. Η φ ξ Β, φ ζ ά 50. Λ ω ύ φ ξ, θ ά, φ. Τ, ύ θ φ ξ, ύ ω θ. ΜΕΤΑΜΟΣΧΕΥΣΗ ΜΥΕΛΟΥ ΤΩΝ ΟΣΤΩΝ Η ω ά ω θ β-. Η φ, ά β ξύ ύ ( β HLA). Δ θ ω β, ά ά θ ψ ύ. Μ ω θ, ά ά θ. Γ φ ψ ύ ά ά θ, θ. Η θ ά ω HSCs θ. Η ω HSCs θ, ύ φ, ω ά ά ω ύ β-. Τ β θ ζ ύ ά φ φ ά θ ύ, θ θ ω θ ύ ω, άζ φ. Π ά ύ ά ξ. 39

40 ΕΠΑΓΩΓΗ ΤΗΣ ΣΥΝΘΕΣΗΣ ΤΗΣ HbF Η ύ ύ φ ω. Μ θ β- SCD, ά ξ φ ά ω θ ύ ύξ ω ω HbF. Σ φ ω β ψ θ ξ φ ω, άφ ύ φ. Η ά ξ φ ω ά φ ω φ θ ζ φ ω ω ω ω θ ω ύ θ φ β-. Ό ω φ θ ά β- ύ, φ ζ HU θ β-. Η β- άθ ύ β- ω - ω, ά ω ά ά β ζω. Η φ HbF ά θ θ β θ ύ ά ω ω ω θ β-. Ο ω ω θ ά β ω ζω ω θ β-. Η ύξ ω ω HbF φ β ω β ύ β- SCD (Higgs DR, 2001). Φ ω 5- ζ, ξ ά ω β ύ ξ βά ύθ (Atweh GF, 2001). Η ξ φ ωφ ά θ SCD (Steinberg MH, 2003). Σ ύ θ β- ά, ύ ξ ά 20 (Brandai M, 2003). Σ θ, άθ ξ ω ω φ β θ ύ ω HbF. Σ άφ ά ά ά. 40

41 Πίνακας I: Κ ω ξ ζ ω ω ω ω HbF (Ng NY, 2014) ΚΑΤΗΓΟΡΙΑ ΠΑΡΑΓΟΝΤΩΝ ΕΠΑΓΩΓΗΣ ΠΑΡΑΔΕΙΓΜΑ ΜΗΧΑΝΙΣΜΟΣ ΔΡΑΣΗΣ Χ θ ά ( ω ά HU ω ά β ω ) β ω 5-Azacytidine Χ θ ά ( θ φ ά DNA) Decitabine Υ θ ω DNA Citarabine Butyrates Λ ά ξ β ά ω Tricostatin A ω ( ω ) Apicidine ω ω (HDAC) Scriptaid Mithramycin cisplatin Π ά DNA Δ ω DNA tallimustine angelicin Α mtors Rapamycin Thalidomide Α θ ά φά revlimid Pomalidomide Ε θ (EPO) Κ TGF-β Σ ω FRAPmTOR Α ω - φ Αύξ ω ω θ θ φ F ύ Ε ω φ ά FDA ύξ ω ω HbF ξ β ( ξ, HU). Η HU φ ύξ ω ω HbF ω SCD (Steinberg MH, 1997), ά ά ά ζ θ SCD/β-, β. Ε, θ ά β- φ θ HU (Dixit A, 2005). Η HU ω ω θ ά ξ. O β ά HU, ύ. 41

42 Φ ω ά ω β ω, ά ύ θ DNA ύ. Β β ω, ύ φθ ύ HU, β ω ω ξύ ω ω βά φά,. Σ βά ω,, ύξ βά, θ ά ψ φ ά ω ύ. Η ξ φ ω ά ά ά φ ω - ω. Π, ά ά ά ω: p38 ά ω camp ά sgc/cgmp ύ ύ ω ύ ΝΟ Mitogen-Activated Protein Kinase (MAPK) ω φω φ ω CREB1 Gia/JNK/Jun ω SAR1 (secretion-associated and ras-related protein), φ ξά HU Ε φ ά cmyb, GATA1, GATA2, NF-E2, EKLF, ω ά φ θ, φ ζ ά HU (Cokic VP,2003) (Ramakrishnan V.,2011) (Zhu J., 2014). Π ά θ ύ ύ ξ ω θ ζ φ ω θ HU, ύ ύ SNPs ύ β- φ φ ζ φ ω HU ύξ ω ω HbF. Π β HU, o Collins ά, ξ ω θ ά φ o-β ύ ( ά θ ύ ω β φ, SPB), ά ψ ά ύ EPO (Anne F., 1995). Ε, φά ω ά ά ύ EPO, EPO β ύ ά ύ ζω ω θ ά ω ά άθ θ ύ ά ξ ω ά. Η ξω ύ EPO, θ ύ ω β θ 42

43 ά β ω ά ω θ. Μ β θ ά EPO β ω, φ θ β- ω ω ω θ ά ω (Perrine, 2005). Σ ά θ Κ562 GM979 φ ω β ξ ω β (SCFADs) ω φ β φ, φ ω θ ά ω ά β ω ω ω θ ά ω (Rishikesh Mankidy, 2006). Τ, ξά ά θ φ ύ ά θ ύ ω φ ύ θ SCD β-. Τ ύ Aegle Marmelos bergatene ξ βά φ ω θ ά ω ω HbF θ ά ύ Κ562. Τ Citropten bergatene ά ά ύ. Φ ω φ ω θ ά ω, φ - φ ύ θ HbF. Έ, ά ω θ β- (Guerrini A., 2009). Η, ω θ Streptomyces hygroscopicus, β ζ φ ύ Πά, ξά ω HbF ω θ ά ω θ β-, ω ξ ά ξ. Ε, Streptomyces, ωθ ύ θ, DNA, ά mrna - φ ω HbF θ ύ ω ω β- (Fibach N., 2003). 43

44 Π φ φ θ ά Ι, άζ Terminalia catappa, ω β θ SCD Ν (Ameh SJ., 2012). Ο Aimola et al. ξ ω ω ά ύ ω φύ ω Terminalia catappa ( ω ω Terminalia catappa distilled water active fraction, TCDWF) ω HbF β ά ύ θ ά ω (EPSCs). Η Terminalia catappa φ β, θ. Μ ω ω φ -φ άζ (GCMS), φά ω ά ξ ω ά,.. ξ ϊ ξύ, 10- ϊ ξύ ϊ ξύ TCDWF (Aimola IA., 2014). Π φ, ω cucurbitacin D (Cu D), Fructus trichosanthis (FT), άζ ύ ύ ω HbF ξ ξ, βά ά ω ύ K562 (Liu K., 2010). Α ω ξ ζ θ ύ ά ω HbF, HU ά ω ξ ζ ύ ά φ ΓΕΝΕΤΙΚΟΙ ΒΙΟΔΕΙΚΤΕΣ ΕΝΤΟΣ ΤΟΥ ΣΥΜΠΛΕΓΜΑΤΟΣ ΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ β- ΑΛΥΣΙΔΑΣ ΣΦΑΙΡΙΝΗΣ Ο Steinberg et al. 150 θ ζ ω HbS θ HU. Β ω ω θ φά ύξ ω ω HbF ά 40% ύ HU. Κ ξ ω θ ά ά ά ζ. Έ, θ ύ ά φ άζ φ ω ω HBG1 HBG2, ω ω - β- φ Χ ω ω φ ω F- ά ω (FCP) (Chang YC., 1995). Μ βά ά FCP HbF, φά ω ά HU HbF. Ε, ύ CAR (Central African Republic) β- 44

45 φ φ ζ ύ ύ ύξ ω ω HbF. Α Bakanay et al. θ θ β ω ζ ( θ HU), ξ θ βά ω ύ ύ β- φ (BAN, BEN, CAM, SEN). Α ξ, ω ω ζ ω ω ξ ζ BAN ω ζ ω ω CAM ζ ύ θ β (Bakanay SM., 2005). Α Alebouyeh et al. θ ύ HbF ύ HU. Η ξ θ ξύ θ ζ β- ξ ω ω ξ ω ω. Π θ 25 θ ξ ω 9 ξ. Τ ξ ω φ Xmnl (HBG2: g.-158c>t) ά ξ IVSII-1 G>A, ά ζ ω, β θ θ ύ ά θ θ. Α θ, θ θ HU θ φ ύ β ζ ω ζ ω (Alebouyeh M., 2004). Ε, Asai et al, 143 θ β- β θ θ HU, β β θ ω β ψ HU φ XmnI (Ansari SH, 2013). Ο Dixit et al. 37 θ β- ξ ω HU. Ο θ 70% θ. Κ ξ ά ξύ φ ύ XmnI, β θ ύ HU, θ ύ ξ ά ω ω (Dixit A., 2005). Ο Karimi et al., 232 θ β- ύ HU 13. Σ HU άξ HBB φ XmnI. Τ 45

46 ξ ω θ ζ ζ β ά ξ ύ HU, ά θ ζ β + ά ξ, ω ω ύψ φ ύ Xmnl HU (Karimi M, 2012) ΓΕΝΕΤΙΚΟΙ ΒΙΟΔΕΙΚΤΕΣ ΕΞΩ ΑΠΟ ΤΟ ΣΥΜΠΛΕΓΜΑ ΤΟΥ ΓΟΝΙΔΙΟΥ ΤΗΣ β-αλυσιδασ ΣΦΑΙΡΙΝΗΣ Ε ω φ ύ β β- ύ, ά ά θ θ ύ ά ω, ζ ά ω. Χ ά BCLl1A, θ ύ φ β HU. Σ Banan et al. 80 θ β-, ξ ω ω, θ SNPs ζ QTLs. Π θ SNPs rs766432, rs BCLl1A, φ Xmnl (rs ) rs , rs HBS1L-MYB. Η φ ύ XmnI, θ οι rs rs φά HU (Banan M., 2012). Ο Borg et al. ά ζ θ SCD/β-, ω, ω HU ύξ ω ω HbF. Π φ ά θ ω ω ά ω ω θ φ ω, θ HU. Τ ύ θ θ SCD/β- θ θ ξ HU. Μ HU ύ ω θ φ ω ά θ Μά ά ω KLF1. Φ KLF10, rs SNP 3 'UTR, ζ β β-, θ θ HU. Π ά φ KLF10 θ (Borg J, 2012). O Kumkhaek et al., 386 θ SCD ύ φ SAR1A 46

47 HU. Σ 5 SNPs φ ζ (Kumkhaek C, 2008). Ο Ma ά 137 θ SCD, θ HU 2, θ ύ ξ ξύ ω SNPs ύξ ω ω HbF. Π, θ ψ φ, ζ HbF, β HU ζ ω θ ά ω. Τ ζ QTLs, β ω 6 8 θ ω ω Χ ( φ 6q22.3-q23.2, 8q11-q12 και Xp22.2-p22.3). Ο φ ύ 327 tagsnps ω ω HU ω θ, HapMap. Τ rs FLT1, ζ ω ζ ω, ξ ά ύξ ω ω HbF ά θ HU. Ε, ύ ά SNPs FLT1, rs rs , β θ ζ ύξ ω ω HbF. Π ψ ά SNPs ω ω MAP3K5, PDE7B, ASS, TOX, ARG1, ARG2, NOS2A και NOS1, ψ φ ζ άφ, φ ζ HU ύξ ω ω HbF (Ma Q, 2007). Ο ω, Tafrali et al., θ ξύ SNPs ω ω MAP3K5 PDE7B β ύ β- HU. Μ θ ζ ω β- ά ζ SCD/β-, ω Δ Ε ά. Ο φ ξ ά ά ξύ ω SNPs rs rs ύ HU (Tafrali C, 2013). Ο ω φ θ ύ θ ά θ ω ύ β- ύ ύ θ HU ύξ ω ω HbF, β. Η ύ β β- ύ ύ. Τ MAP3K5, φ φ θ φ ά φ ω 47

48 β θ HU. β Α θ ω ψ ζ ψ φ SNPs φ φ ζ HbF, ω ψ Ma ω. Πίνακας II: Σ ω ω ω φ ύ φ. Υ ψ φ φ ω HU ύ φω ω Ma et. al (Ma Q, 2007). ΓΟΝΙΔΙΟ ΕΝΔΙΑΦΕΡΟΝΤΟΣ FLT1 MAP3K5 PDE7B ASS TOX ΕΞΕΤΑΖΟΜΕΝΟΙ SNPs rs rs rs rs rs rs rs rs rs rs rs rs rs rs

49 ARG1 ARG2 NOS2A NOS1 rs rs rs rs rs rs rs rs rs rs rs rs ΣΗΜΑΤΟΔΟΤΗΣΗ ΜΕΣΩ MAPKs ΜΟΝΟΠΑΤΙΩΝ Τ ά ω ω ω ϊ (Mitogen-activated protein kinase, MAPK) ύ ά ω ξω ά ω ά ω ω ω ά ω, β θ ύ ά ω. Μ β β φά ά, ύ ω, φ, ύξ ά ω. Κάθ ά MAPK ά. Π βά ω ά ά ά (ΜΑΡΚΚΚ, MAP3K, MEKK MKKK), ω ά ά (ΜΑΡΚΚ, ΜΑΡ2Κ, ΜΕΚ MKK) ω ά (MAPK). Σ ά, ά MAPKKK (ΜΑΡΚΚΚΚ, ΜΑΡ4Κ ΜΚΚΚΚ) MAPKKK. Μ MAPKKKK MAPKKK ύ θ ύ β ά (Maosong Qi, 2005). Σύ φω ω, θ ά ζ ά φ ά θ ζ ά MAPKs. Α : θ ζ ξω ά ύ ω ϊ ά (extracellular signal-related kinases, ERK), ERK1/2, Jun- ά (Junamino-terminal kinases, JNK), 49

50 JNK1/2/3, ω ΐ p38 (p38 /β/ / ) ERK5. Ό ύ MAPKKs: MEK1/2 ERK1/2, MKK3/6 p38, MKK4/7 (JNKK1/2) JNKs, MEK5 ERK5(ChangL., KarinM., 2001). Α ά ψ ω ά ERKs β ω, ά JNKs p38 ω, ω φ ά ω ω ά ω ω ω ά ω. Ω, ύθ ω ω ω MAPKs ά φ (Teiji Wada and Josef M. Penninger, 2004). Η ω MAPKs φω φ ω ύ ά ΜΑΡ2Κs. Μ ά, ω ΜΑΡΚ θ φω φ ω θ θ ω ω ά ω - ω, ω φ ά (Erwin F., 2009). Μ MAPKK θ MAPKKK, ά MAPK ύ. Γ θ ERK1/2 ξ ύ ά, άζ MAPKKK c-raf, ά -φ θ ERK1/2 θ ω φ MAPKKKs (Chang L., 2001) Α. ΣΗΜΑΤΟΔΟΤΙΚΟ ΜΟΝΟΠΑΤΙ ERK Ο ERKs ω ΐ φ άζ ύ ύ ύ ύ ύ, ω ϊ ά Raf, MAPKKKs (A-Raf,B-Raf,C-Raf/Raf-1) MEK1/MEK2. Τ ά θ ω ύ ω ω ERK1 ERK2. Ε ύ ξ ύ ά, φ β βά, φ ω ά ω. Ο ύ φά ω ά ω ά ζ G- ω ϊ. Α θ Ras, Ras-GTP άφ φ Raf, θ ύ φω φ ω ω MEK1/MEK2 ά ω ERK1, ERK2. Ο ERK1/ERK2 ά θ - 50

51 , ω φ ά AP-1, NF B, Myc ά ω Rsk, Bcl-2, cpl2 ξ (Masong Qi, 2005) Β. ΣΗΜΑΤΟΔΟΤΙΚΟ ΜΟΝΟΠΑΤΙ JNK Ο JNKs, ω ω ω ϊ ά ύ ω (stress-activated protein kinases, SAPKs), ύ ω ϊ ά ά ύ ά ω φ, ω. Φ ύ JNK ω ω ά ά θ. Τ θ β UV, ω ϊ ύ θ (. ), ω, ξ, β άβ ω, θ, ά φά (, ), ξ φ ω o ΤΝF. Ο ω ΐ JNK ω ύ : JNK1 ω ΜΑΡΚ8, JNK2 ω ΜΑΡΚ9 JNK3 ω MAPK10. Μ ά ω ω ύ ά 10 φ. Ο JNK1 JNK2 φ άζ ύ JNK3 ζ ω φ. Έ φ θ ω ΐ ά ύ ά ά θ, : MAP3K5, HPK1, MLK-3 Ste11 θ ω ΐ ω ΤΑΚ-1 ΤΡL-2 (Davis, 2000) (Teiji Wada and Josef M. Penninger, 2004). Τ JNK φ ύ ά ω c-jun, ATF2, Elk-1, 53 c-myc ά Bcl-2 and Bcl-xL (Teiji Wada and Josef M. Penninger, 2004) (Widmann C., 1999). Ο JNKs ύ φω φ ω ά θ ά MKK4 MKK7.Ο MKK4 MKK7 ζ ά MEK1 MEK2. Ο ω ύ ά JNK. Ε MKK4 MKK7 ύ ά ERK (Teiji Wada and Josef M. Penninger, 2004). Τ ά ω ω JNK φ ύ ά ω ERK ω ω MAPKKKs, ξύ ω ω MEKK1-MEKK4, ASK and MLK. 51

52 Α φ ά ά MAP3K5, ω ά ω θ ά ύ ύ ( ύ Mv1Lu), θ β ά φ ά ύ ύ 293 (HEK293), ΚΒ ά ά ύ Α673 ύ β ω φ MAP3K5, φ β ω (Teiji Wada and Josef M. Penninger, 2004). Ε, JNK ά p38 ύ ά ΤΝF- Η 2 O 2 β MAP3K5 -/- β ύ β ά, ύ θ ά ω TNF- Η 2 O 2. Α ά ύ MAP3K5 -/- θύ ω ω ω Fas, φά ω ω JNK p38 θ, ω β φ ω. Ε ω, MAP3K5 ζ θ Fas ω JNK p38, ω ύ ά ω Fas ω (Tobiume K., 2001) Γ. ΣΗΜΑΤΟΔΟΤΙΚΟ ΜΟΝΟΠΑΤΙ p38 Τ p38 ΜΑΡΚ ω θ, ύ θ ά ω β, θ, ψ ω, -, ω ϊ ύ θ, φ ( ω IL-1 ΤΝF- ). Τ ΜΑΡΚ14, ΜΑΡΚ11, ΜΑΡΚ12 ΜΑΡΚ13 ω ύ ω ΐ p38, p38β, p38 p38. Α MAPK14 ά ύψ ύ φ. Η p38 ζ ά ύ p38β φ φ άζ ύ. Ο ω ΐ p38 p38 φ άζ ά ύ θ ά ξ. Σ ξ ύ ύ βά MAPKKKs ω MAP3K5, MEKK1-MEKK4, MLK2 3, DLK, Tpl2, Tak1 Tao1/Tao2. Η ω p38 ω ϊ φω φ ω ά θ ά MKK3 ΜΚΚ6 φω φ ω. Σ 52

53 p38 ω ΐ, ύ φω φ ω ά ά ω MK2 (MAPK2), MSK1 (mitogen- and stress-activated protein kinase 1), MNK1 MNK2 (MAP kinase-interacting serine/threonine kinase 1 φ ύ ά ω p53, ATF, NF Β. Ο Tamura et al p38. Π β θ ά β ω ω ά ξ ύ. Ε, ω p38 ζ, θ ω ύθ θ mrna Ε. Α ά θ ω θ ω p38 MAPKs ζ ω ω (Tamura K.,2000) (Teiji Wada and Josef M. Penninger, 2004). Ε, ά p38 MAPK φ ζ ά ά θ (Martín-Blanco E., 2000). Γ ά, p38 MAPK ύ θ ω φ (Steinbrech DS, 2000). Π p38 -/- άζ β θ ω β άβ (Tamura K., 2000). Ε, φ ω ω θ ά ω Epo ω ω p38 MAPK JNK (Nagata Y., 1998). Τ, 38 θ mrna Ε (Dean JL, 1999). Γ ά, 38 ΜΑΡΚ ύθ φ ω φω φ ω ω φ ω CREB1 ATF-2. Η CREB1 φ φ ω ω ζ θ ά ξ ω ά ω (Sakamoto KM., 1994). Έ θ ω ά ω ά φ - φ 38 ΜΑΡΚ (Johnson J., 2005) (Pace BS., 2003). Φ ω ω 38 MAPK φ - φ ω (Witt O., 2000) (Park JI, 2001). Μ ξύ HU φ ά HbF ξ ζ ω ω cgmp (Cokic VP., 2008) 38 ΜΑΡΚ (Hsiao CH., 2006). Π φ, Aerbajinai et al. ξ θ φ - φ ω ύ θ θ ά ύ (Aerbajinai W., 2007). 53

54 Ο Pace et al., ω ω ω ω p38-mapk ύ, φ - φ, ω ύ θ HbF (apicidin). Η ά ω (HDAC inhibitors), ω 5- ζ ξ (HU). Η ω ύ θ HbF ύ K562, φά φ mrna - φ ά β β ω ά ω ω p38 ERK JNK ύ ύ (Pace BS., 2006). Ο Ramakrishnan Pace ζ ύθ ω φ ω ύ 38 ΜΑΡΚ/CREB1 CREB1/CBP ύθ φ (Ramakrishnan V, 2011). G - Π ά, ω ά ω p38 ΜΑΡΚ φ ζ ζ ω, φ, β ω, ά ξ ά, ω φ ά, ζ ύθ ύ ύ ύ θ. Κ p38 MAPK ύ ύθ φ - φ Δ. ΣΗΜΑΤΟΔΟΤΙΚΟ ΜΟΝΟΠΑΤΙ ERK5 Γ ά φ ω. Ε ά θ ω ERKs, JNKs p38 MAPKs ξύ 38 54kDa, ERK5 άζ 90 kda. Η ERK5 θ ά β ξ ά ω ω Big MAPK1 (BMK1). Ε MEK5, ά MAPKKKs MEKK2 MEKK3. Φ ζ ά ξ ω (Maosong Qi, Elaine A. Elion, 2005) (Teiji Wada and Josef M. Penninger, 2004). 54

55 Εικόνα 13: Κύ ά MAP ύ ω θ (MaosongQi, ElaineA. Elion, 2005) Εικόνα 14: Σ ζ ω ά ω ΐ ά MAPK άθ β ά ά MAPKs. Τ ά JNKs p38 ύ ά ω ω ά θ ά ω. 55

56 Ε ASK1 ά ω ω θ ά ω, JNK p38.(teijiwadaandjosefm. Penninger, 2004) MAP3K5 Η ω ά ά ά (mitogen-activated protein kinase kinase kinase, MAP3K5) ά MAP/ERK ά ά 5 (MEKK5) MAPKKK5 ά 1 θ ω (apoptosis signal-regulating kinase 1, MAP3K5) ω MAP3K5. Τ MAP3K5 ζ ω ω 6, θ QTL 6q23 ω ω ζ ύ βά ω. Ε ά MAPKKK5, MAP3K5 MEKK Α. ΔΟΜΗ ΠΡΩΤΕΪΝΗΣ Η θ MAP3K ω. Δ θ ά ά /θ ω (coiled coil) ά β ξ ά. Ω ω ζ άξ ά ύ - ξύ ύ ά (Carl Branden, 1991) Η MAP3K5 ζ, θ C ω. Σ Ν ά θ ξ (TRX) ω ΐ (Saitoh M., 1998). Η φ φ ω ξ ω ύ TRX ΜΑP3K5. Α φω φ ω ά Thr838, φ φω φ ω φω φ ω ά ά (Tobiume K., 2002). Η MAP3K5 φω φ ά MKK3/MKK6 MKK4/MKK7, ω ω p38 JNK. Έ ω ω ω MKKs MAP3K5 ω 24 ξ ω β ξ - ά ω MKKs, ω ω DVD, ά MAP3K5. Η MAP3K5 φ ζ ω ϊ ά. Σ β-φύ C, β ( ά 56

57 ) ύ β ω - β ξ - ά ( ά ). Ο ύ «hinge region» ξύ ω ύ β, ATP. Σ - ά ζ β-φύ (β 0 ), β 1 ά ά β ( ά ), ω ζ ύθ ΑΤΡ ά θ. Μ ά ψ MAP3K5 PAK1 ( ά ω ), ω ζ ω ( ά 29% ύ ω ύ ). Η ύ φ ά ω C MAP3K5 (Bunkoczi G.,2007). Εικόνα 15: Τ ά MAP3K5 PAK1 Α) Ο ω φ ζ, ά ά θ ά. Ο θ θ ω ά ω ξ ω ω ξ. Β) Ο άζ, β ω ά φύ ά, P θ φω φ ω. C) Ε ά ψ MAP3K5 ( ) PAK1 ( ) (Bunkczi G., 2007) 1.11.Β. ΛΕΙΤΟΥΡΓΙΑ ΤΗΣ MAP3K5 Η MAP3K5 ά φ ά ύ ROS, ά ω ω (TNF ), (LPS), 57

58 ύ ύ (ER) β, ά ά JNK p38 (Ε 14). Μ θ ά, ω ύ ύ JΝΚ θ p38 ΜΑΡΚ, ω φω φ ω ΜΑΡ, ά ύ p38 JNKs ά. Εικόνα 14: Α MAP3K5. Η MAP3K5 ω ξ ω ύ. Σ ξ ω, Trx (θ ξ ), θ ύ MAP3K5- JNK / p38, ω ζ MAP3K5 TRAF2 TRAF6 βά β ω ύ MAP3K5. (NagaiH, NoguchiT, TakedaK, IchijoH., 2007, pp. 1-6). Η MAP3K5 θ άφ θ θ ω ζ ά β φ. Γ ά, MAP3K5 θ θ (PolyQ), βά ά φ ω Huntington (Huntington s disease, HD) ω ϊ φ (spino bulbarmuscular atrophy, SBMA) (Harada C., 2006). Η MAP3K5 β ύ ξ ω β- ύ, Alzheimer (Hashimoto Y., 2003). 58

59 1.11.Γ. MAP3K5 ΚΑΙ ΑΝΤΑΠΟΚΡΙΣΗ ΣΤΗΝ HU Ε β ω MAP3K5 ω ά ω ω, φ, ά ξ, ύθ ύ ύ, φ ά ω φ ω - ω φ. Σ άθ ζ ω φ ζ ξ HbF, cis-acting ύ β- ύ, ω φ XmnI G γ ψ ά ω ζ βά ω HBG1. Π cisacting, φά HbF β- ύ (trans-acting) ω QTLs ω Xp22 6q23 ω ω. Σ Craig et al., 153 ά - HPFH β ω HPFH ζ ω ω 6q, ω ω 6q Μ ξύ ω ψ φ ω ω Craig ά 6q23, ω MYB, το HBS1L, θ ΜΑΡ3Κ5 (Craig JE., 1996). Ο Wyszynski et al., 289 θ SCD β φ ω ω HbF ύ άξ θ. Υ θ ω φ ξύ ω θ φ θ ύ ύ ά. Ε θ 180 SNPs 38 ω β ω HbF β θ SNPs, ζ ά QTL 6q22.3-q23.2 ω ω (Wyszynski DF, 2004). Ο Ma et al ύ ξ ξύ ω SNPs (320 tagging SNPs θ ά) ξ ύξ ω ω HbF θ θ HU 2. Ε θ ψ φ, ζ φ θ HbF ( 6q22.3-q23.2, 8q11-q12 Xp22.2-p22.3), 59

60 β HU ω ζ ω θ ά ω. Μ θ 137 θ θ HU. Η ξ ω 17 SNPs φά ύξ ω ω HbF ω θ. Μ ξύ ύ ω ά tagging SNPs MAP3K5 θ. Π rs rs MAP3K5. (Ma Q., 2007) Σ Tafrali et al., θ θ SNPs ω ω MAP3K5 (rs rs ) PDE7B (rs ) ξ HbF. Ε ύ ά ψ MAP3K5. Μ 11 θ β- ξ ω, 92 θ ζ β-, 35 ά ζ θ SCD/β-, θ HU 94 ά ω. Τ ξ ύ ά ψ ΜΑΡ3Κ5 ύ SNPs MAP3K5, θ PDE7B, ά HbF β φ. Ε, φ mrna MAP3K5 βά ψ HbF άζ HU. Τ, φ θ ΜΑΡ3Κ5 ζ θ HU (Tafrali C, 2013). 60

61 1.12. ΣΚΟΠΟΣ ΜΕΛΕΤΗΣ Ό ω ύθ ω, β- ζ ά, ω ζ φ β ά. Α ύ ξ ά ξ HBB, ω β- φ ω ω, HbA. Τ ύ θ ω β- ω. Η ω θ ζ ά φ ά ξύ θ φ ά ξ HBB. Έ θ ξ HbF, ά θ ύ, ύ ά θ. Α ω ύ θ HbF θ, βά ά. Η ξ θ ω φ ύ θ ΗU ξύ ω ω, ζ β-. Σ,, ύ θ MAP3K5, ύξ ω ω β φ θ Ε ω θ β- HU θ β ύ. Η ύ ω ω ά ω ά ω «Genomic variation in the MAP3K5 gene is associated with b thalassemia disease severity and hydroxyurea treatment efficacy» Τ φ ω. 61

62 2. ΥΛΙΚΑ ΚΑΙ ΜΕΘΟΔΟΙ 2.1. ΔΕΙΓΜΑΤΑ DNA ΤΗΣ ΜΕΛΕΤΗΣ Ο ά ω ω φθ ύ ξ : Α θ ζ β- (β-thalassemia major) Α θ ξ ω β- (β-thalassemia intermedia) Δ ά ζ β- Υ ά, θ (healthy individuals). Π, θ 38 θ ζ β-, 7 ξ ω β-, 48 ά ζ ω β- 39 ( - θ ) ω. Τ θ Π Γ Ν Π, ΑΧΕΠΑ Θ Ι ά Γ Ν. Η ψ άθ ά φ ύ θ ω ά φ άθ θ ύ άβ. Ό φ ά ά ζ, θ ω βά ύ ξ 3fold 20%. Μ βά ά ύ φ ά, θ (responders) (non-responders). Μ 3fold ζ θ HbF ά HU ά ω, 20% HbF ά HU ύ 20. Μ 3fold ύ 11 26, 20% Ο θ ω ά ζ ω θ ξ ά ά ω ά ω ω ά ζ ω θ θ, θ 11 θ ά φθ ύ ψ. 62

63 2.2. ΑΠΟΜΟΝΩΣΗ DNA ΑΠΟ ΑΙΜΑ Η ω ύ ύ θ, θ θ φ - ω φ. Π, θ ξ : RBC Lysis Solution: 1 mm EDTA, ph 8 NaCl Solution, 1 M Cell Lysis Solution: 10 mm Tris HCl, 26 mm EDTA, 17.3 mm (0.5%) SDS RNase A Sodium Acetate, 3M Phenol: chloroform: isoamyl alcohol 25:24:1 Isopropanol 100% Ethanol 70% TE Buffer: 10 mm Tris -HCl, 1 mm EDTA Η θ θ ξ : Κ θ θ ω DNA Μ φ ά (3-5ml) ω φ (falcon) 6ml RBC Lysis Solution Κ 2 min θ ω. Α θ 5 φ Φ 2000 g 10min θ ω θ ζ ω ά ω Π ψ, φ ύ ζ Α ά vortex ζ Π θ 10 ml RBC Lysis Solution, ύ β ά ω θ φ ω. Α φ 2000g 10min θ ω Π ψ Π θ 1ml NaCl Solution, 1M Έ ά vortex ω φ ω φ ύ ω. 63

64 Π θ 6ml Cell Lysis Solution ύ β ά ω φ ω Π θ 50 l RNase A Solution φ ω ω RNA, θ θ ω ω ά ω ω ύ ω β. Ή ά vortex 37 C, ύ ω φ ω Π θ 1ml Sodium Acetate Solution, 3M ύ ά vortex Π θ 1ml Phenol:chloroform: isoamyl alcohol 25:24:1. Έ ά vortex ά 10sec falcon ά. Φ 1500g 5min θ ω, ύψ ω φά ω. To DNA ζ φά Μ φ ά falcon 5ml 100%. Α φ ύ ω DNA. Φ 2000g 5min θ ω Π ψ Π θ 10ml 70% θ ζ Φ 2000g 3 min θ ω Π ψ θ. Αφ ζ (air-dry) min Π θ 300 l TE Buffer ά vortex 5-10 sec. Αφ ω 18hr 37 C θ ω ζ Αφ ύ θ ω ζ, θ θ ΠΡΟΣΔΙΟΡΙΣΜΟΣ ΣΥΓΚΕΝΤΡΩΣΗΣ ΚΑΙ ΚΑΘΑΡΟΤΗΤΑΣ ΤΟΥ DNA Γ ω θ ω ω ω ά ω DNA, θ NanoDrop Spectrophotometer. Μ φ φω ά ά ω, άξ 1 l. Ο ύ 230nm, 260nm 280nm. Τ, θ ύ φ ζ 260nm/280nm 260 nm/230nm θ ω ω. 64

65 Π θ θ, ά DNA. Έ, 1 L DNA θ βά. Ο β ά ω ζ ω β θ. Σ άθ, ύ. Η φω DNA ύ 260nm, DNA φ, Nanodrop ζ ω DNA (opticaldensity, O.D.). Τ φω 280nm ( ύ φ ύ ω ΐ ), θ ω ΐ. Ο O.D.260nm/O.D.280nm φ άζ θ DNA. Τ θ DNA 1,8-2,0.Η ω ϊ ξ ω, O.D.260nm/O.D.280nm 1,8. Ε, O.D. 260nm/O.D.230nm φ άζ θ ύ ύ, θ ω DNA ΠΟΛΥΜΟΡΦΙΣΜΟΙ ΠΟΥ ΜΕΛΕΤΗΘΗΚΑΝ Σ ύ ξ ά ύ φ (rs rs ), ζ o MAP3K5 άζ ύ β ω 6. Ε, ξ ά ά ψ 5 βά ω ( 5 -GCGCG-3 ) MAP3K5. Π ύ ψ ω («Short Tandem Repeat», STR). Η ύ (Linkage Disequilibrium, LD) ξύ ω φ rs rs MAP3K5 θ βά ω SNAPLD BroadInstitute ( 2.4.Α. rs (g C>A) (MAP3K5- Chr. 6) Σύ φω βά ω Ensembl ( o φ ζ MAP3K5 φ ά θ ω 6. Η ζ. Η ω φω ύ θ ύ ά Κ ά, άζ

66 Εικόνα 14: Σ ω φω Κ ά θ 2.4.Β. rs (g T>C) (MAP3K5- Chr. 6) Σύ φω βά ω Ensembl ( o φ ζ MAP3K5 φ ά ά θ θ ω 6. Η ζ. Η ω φω ύ θ ύ ά Κ ά, άζ 15. Εικόνα 15: Σ ω φω Κ ά θ. 2.4.Γ. PROMOTER STR (GCGCG) X (MAP3K5- Chr. 6) [ (GCGCG) 4 >(GCGCG) 5 ] Η β (GCGCG) ζ ω ω 6 MAP3K5. Π ύ ψ ω («Short Tandem Repeat», STR). Σ 5 -GCGCG-3 βά, φ, β ξύ ω θ ω ά ξ φ. Γ 66

67 ά ξ ά ω βά Ensembl ( ΣΧΕΔΙΑΣΜΟΣ ΕΚΚΙΝΗΤΩΝ Τ ζ ύ ω ά, θ ύ ω ύ. Χ θ θ Τ φ ά. Γ άθ ζ ύ ω θ ω ύ φω βά ω BLAST, ξ β θ ά ύ θ. Ε, ύ βά ζ ύ βά ω (bp) ϊ ύ PCR. Σ ω ά ω UCSC ζ θ «In Silico PCR». Μ β θ ύ ψ ϊ βά PCR, β ω φ ύ. Α θ ψ ζ ζ ύ ω θ θ ϊ PCR ά φ. Πίνακας III: Σ ω ζ ύ ω θ ϊ PCR άθ ξ ζ φ. ΠΟΛΥΜΟΡΦΙΣΜΟΣ ΖΕΥΓΟΣ ΕΚΚΙΝΗΤΩΝ ΜΕΓΕΘΟΣ PCR ΠΡΟΪΟΝΤΟΣ rs F: GTTCCACCTGCAGTGAAAAACAT R: CATCTCAGGGAAACAAGGAAAGAA 411 bp rs F: TTCCCTGGCACACCATTG R: ATCTCCCACTGCTCCACAAA 575bp 67

68 PROMOTER STR (GCGCG) X F: GAGGCGATCGAAAGAGAAAC R: CGGAGCTTCCTTTTCTTGG 352bp rs (g C>A) Τ ζ ύ ω rs PCR ϊ ύ θ 411bp PCR ϊ θ ζ ύ ω ξ : CATCTCAGGGAAACAAGGAAAGAActgtccccaggctgtgctgtaaacccagctctctggatcattctagaga aaggctagttttggtctatcgcagtccatctaaccatcatgcccaggaaacagcccaagacttgcctgaagaaagcccaacttacaactt aaggccaagcaactggcaaccactattgagttggctcccttgttgacactgatcgaaaaaggtaagtcagttttctgattaagatgtcact aaaatctgctagcaagagggaatcagaagttgtgtgactactatgactcttcctcataataataactgccatcgtggaacaaaatattaga actgatcctcttaaacagaatatgtagttcaaaatgttttgaaatgtttttcactgcaggtggaac Σ φ ύ θ ύ R F, ω Εικόνα 16: Ε Α φ. Μ β θ rs

69 Εικόνα 13: Ε Ε θύ. Μ β θ rs rs (g T>C) Τ ζ ύ ω rs PCR ϊ ύ θ 575bp PCR ϊ θ ζ ύ ω ξ : ATCTCCCACTGCTCCACAAAgaaagtgtgaaccaattttatcctgcaaaccagaaacaggaactgaatgggcctcta accagacctctgaaacaggaagtagggcacagttcttatagccaccagaggggaactgccctataaacagagaactcccaaaaggct ggctccagccaaggccacgggtgagacaagcctgtgttatgcgcttatataatgcacaggcttcacccagagatggaaccagctcgaa ctaccaactgataatgtctcaagcagacaacaggtgaccaaattaaggaaagaaaccaggatcctggcagcccaggaagcagagcc ggtcatgacaacatgcagctgatgatgtggggtaagaaattggtactctaaaaactaattttgtgctctggagttttctttttgattttgcttttt tccgtccgattttctagttaagctcttttaaaaaaattatagttttgccttaattgacccattatccaagaaagcaagaagcagcagtgctgtc agtttgtgtgcggtgggtggcagctgctacaatggtgtgccagggaa Σ 18 19, θ ύ, φ F R rs ω. 69

70 Εικόνα 18: Ε Ε θύ. Μ β θ rs Εικόνα 19: Ε Α φ. Μ β θ rs

71 PROMOTER STR (GCGCG) X Τ ζ ύ ω β (GCGCG) x PCR ϊ ύ θ 352bp PCR ϊ θ ζ ύ ω ξ : GAGGCGATCGAAAGAGAAACgaggccaggcaaggaggaggaaatccacccgatgaaggcgagctgccgccta agagggaggagggtcctttcggctgccgctgctgctgttccgggacgccgcctggggagccagcccgctcgtaaggtgcgcgcca ggtagctccgcacccagggggcgcccttcctggcccctcccagagcggccgggacggaaggagctgcgcggcgcggc gcggcgcggcgcggcgggtggcgagggcgggctgcaccccgagcgcggcgcccttgagctgcaccgcggcgcaggtt tgcgagccgacttgtcagccggccaagaaaaggaagctccg Σ φ ύ θ ύ F R, ω. Εικόνα 20: Ε Ε θύ. Μ β θ β (GCGCG) x 71

72 Εικόνα 21: Εκκινητής Α φ. Μ β θ β (GCGCG) x 72

73 2.6. ΑΛΥΣΙΔΩΤΗ ΑΝΤΙΔΡΑΣΗ ΠΟΛΥΜΕΡΑΣΗΣ (PCR) Τ 1983, Kary Mullis ξ, ω ω ά (polymerase chain reaction, PCR). Μ ζ ύ ά ω DNA άζ (, 20 bp ) θ θ ά, ά θ DNA-. Η ζ ξ β θ θ, ά θ RNA. Σ ω RNA RNA cdna, ζ φ φά (RT-PCR) ω ά ά RNA ω άθ θ. Τ ά ξ DNA PCR άφ ά ω: DNA ά Ο, ά Γ Ρ θ ά Mg 2+ Δ ξ (dntps) Αφ ύ θ ω ω ω, PCR άθ θ, φ ύ ά θ (thermal cycler), ξ ά θ ύ ύ. Ο θ θ ά ύ β ω θ ύ ά ά. Δ ά φ ζ ω PCR, ω ύ θ θ, ω ά φ θ. Η ω ά β ά ά : 1. Α ά ξ (denaturation) ω ω ω DNA ω ω 73

74 2. Υβ (annealing) ω ω DNA-, θ ξ ά ω. 3. Ε (elongation) ω θ ω ω. Α ϋ θ ύ θ ά θ 72 C, β θ ά Taq ά. Η ά ύ ά ξ β (dntps) ω DNA ω. Η ύ ύ θ άξ ω 1000 bp ά. Τ β βά θ ύ ω. Σ άθ ύ θ DNA ύ ύ, ύ ω. Η ύξ θ ύ ω άφω θ ύ 2 n, n θ ω ύ ω. Εικόνα 22: Α ω ω PCR 2.7. ΑΛΛΗΛΟΥΧΙΣΗ DNA Γ ύ ω ά θ promoter STR (GCGCG) x ά ύ rs θ ύ ω PCR ϊ ω ά Sanger. Η θ β ζ ω 2,3 ξ ω (ddntps). Η ζ ζ, ω ddntps DNA-. Τ ddntps φ 3 ά ξ ά, φω φ ύ ύ (Sanger F, 1977). Τ ddntps, φθ ζ ά, ύ. Γ θ ύ : 74

75 ω DNA θ θ ύ PCR DNA- ά ξ (dntp) φω φ ά 2,3 - ξ (ddntps) Τ DNA ά, ω ζ φ (capillary electrophoresis) ω, φ ω ύ ά ω ύ ύ φ ά. Σ, ά, ά ξ laser θ ω, ύ φθ ω ω θ 2,3 - ξ ά άθ. Ο φθ ύ ύ. Τ ψ ω φ ζ ω βά ω DNA β θ φ ω ά ω ά (Εικόνα 23). Η ά θ Τ Π θ Π ω Η ω ω Α β Ε ά ω Anne John β ψ Κ θ Μ Γ Ι Bassam R. Ali. 75

76 Εικόνα 23: Σ ά sequencing ω φ. Η DΝΑ ά ω DΝΑ θ ω DNA ( ). Ό DNA ά ω ddntp, ύ θ ζ. Π ύ θ ω DΝΑ ω φ, θ ω φ. Τ φ ζ ύ φ, άθ βά ω ύ φ φ (Chial, 2008) PCR-RFLP (Restriction Fragment Length Polymorphism) Μ θ ύ ω ά ω ω ξ ζ φ ά ω PCR ϊ ω ά ζ (Restriction Fragment Length Polymorphism, PCR-RFLP). Η θ ζ ω DNA (θ ύ) ά. Μ ύ θ ύ ξ PCR ϊ, θ ω ζύ ω θ ά θ θ. Α θ φ ω ζ, β θ ύ ά ξ ζ (Wong, Linder, Valdes, 2010). 76

77 Β ϋ θ φ θ, ξ ζ φ ύ θ ύ, ζ ω ω ζ ά ά. Ό SNP ζ ω θ ύ ω ζ ζ, ω θ ύ SNP θ ζ, ζ θ. Α, SNP φ ύ, ά φ ω ζ. Μ ύ φ ζ ά. Γ ύ ω ά ω ω φ rs θ ζ PvuII-HF NEB (NEW ENGLAND BioLabs Inc.). Η ω ζ ζ ξ : Εικόνα 24: Μ φ ξ SNP. Ό ω φ, φ C ζύ θ φ Τ. Κάθ ζ ύ ά θ ά (1XCutSmart Buffer) β θά ω ζύ. Μ ά ά ω PCR ϊ ω ζύ θ θ 20 min 80 ºC. Τ β άθ ξ ω PCR ϊ ω Gel Loading Dye, Purple (6x) ά ά. Η θ ά φ ω ύ ω, ω 1 ( ζ/ ) ω 2 ( ). Η ω 1 ύ ω ω θ ά φ. Ο ύ ω ω ζ ά φ. Η ζ ύ ύ ω β ω φ 77

78 ζ. Δ φ ά φω. Π SDS, ζ ά φ. Ε, ω EDTA ω ( ω 10 mm), ζ ά. Η ω φ, φ ά ύ φω ζ. Σ θ, άφ ά θ ύ ύ ά ζύ ά (1x CutSmart Buffer) ά ω ζύ ξ ά (1x Buffer Components): Πίνακας IV: Σ ά ω 1xCutSmart Buffer 1xBufferComponents, ω ω ά PvuII-HF. ΣΥΣΤΑΤΙΚΑ 1x CutSmart Buffer 1x Buffer Components 50mM Potassium Acetate 2.5% Ficoll mM Tris-acetate 10mM EDTA 10mM Magnesium Acetate 3.3mM Tris-HCl 100 g/ml BSA 0.08% SDS 0.02% Dye % Dye 2 Μ ά, PCR, άζ ζ ά θ ά θ ω ά ω θ. 2.9.ΑΝΑΛΥΣΗ ΕΤΕΡΟΔΙΜΕΡΩΝ (heteroduplex analysis, HDA) Ο ύ promoter STR, θ ύ ω ψ ω (GCGCG) θ θ ά (Heterodublex analysis, HDA). Σ θ HDA 78

79 ά ω DNA ά ω DNA. Μ ζ ξύ ά ύ φ ω ζ φ ω ζ. Η θ ϊ ω ά ξ ύ ξ. Αρχή της μεθόδου των ετεροδιμερών Α ά PCR θ. Μ ά - PCR, θ ά ξ ά - ύ DNA, β θ θ ύ ά ξ - β ω ω. Α, 5 L ϊ PCR θ, ύ ϊ PCR ύ. Τ ά 95 C ψύ ά θ ω (Whiteet ϊ., 1992). Α ά ξ - β ύ ύ ϊ ω. Π ύ ύ, φ, ύ. Η ω φ HPLC φ ύ ω ύ ω φ ύ ω ϊ ω ύ. Ό φ ά φ, φ ύ ϊ ω DΝΑ ω ζ ά φ ω ζ, φ ζ ω φ ω ά ά φ. Α θ φ φ ω φ ύ ω ϊ ω βά HDA. 79

80 Εικόνα 25: Σ. Α ά φ ύ (HA-CAE, capillary array electrophoresis) (Velasco E, 2007) ΗΛΕΚΤΡΦΟΡΗΣΗ ΣΕ ΠΗΚΤΗ ΑΓΑΡΟΖΗΣ Η φ ζ ω ύ θ ω ύ. Ε ά θ ω ά ω DNA. Η ζ φύ ω ά ω φ. Τ ζ φ θ, ω ω ω ω ά ω ω DNA RNΑ. Γ 80

81 ω ζω φ ξύ θ ω,. Η β θ ζ ά φ DNA ύθ φ θ ω ω ω, ύ. Π ύ ζ ζ βά βά ω θ β ω ύ θ /Midori Green ά ζ. Τ ω ω β ω ύ θ /Midori Green β (UV), φθ ζ ζ. Η ω ά ω DNA, άζ θ ω ά ω DNA ύ θ ω ζ. Η ζ θ ζ θ ω ω ω ω ω ύ θ DNA. Τ DNA ύ βά ύ ύ ά ω ω ω ζ. Η ω ζ ζ θ ύ ά θ φ DNA ( ) ω ( ): log = log 0 K, 0 ύθ DNA Κ ξ ά θ ω ύ ω ω, θ. Η φ ζ ά ύ ύ, θ θ ύ ύ φ, ύ φ φ. Γ ζ θ ά ω : Ρ θ ά ΤΑΕ (1x) Σύ (50 ): 242g Tris, 100 ml 0,5 MEDTA (ph 8,0), 57,1 ml Glacial acetic acid, Η 2 Ο (dd Η 2 Ο) ω ύ 1000 ml Α ζ Biorad (Molecular Biology Agarose) Β ω ύ θ (10 mg/ml) Midori Green Γ φ θ : Ρ θ ά ΤΑΕ (1x) (Running buffer) 81

82 Δ ά φ ω /Gel Loading Buffer (6 ) NEB Σύ (1 ): 2,5% Ficoll 400, 11mM EDTA, 3,3mM Tris-HCl, 0,017% SDS 0,015% β ω φ ph 8 25ºC Μά θ θ ύ β 100 bp DNA (Ladder) New England Biolabs (NEB) ΣΤΟΙΧΕΙΟΜΕΤΡΙΑ ΚΑΙ ΠΡΩΤΟΚΟΛΛΟ ΑΝΤΙΔΡΑΣΗΣ PCR rs (g C>A) Σ θ άφ, θ ω ω θ ά ύ φ ύ rs Πίνακας V: Σ θ ά θ rs Α Τ Ό ά Α ω ω ( L) Η2Ο (PCR-grade) KAPA2G Fast HotStart ReadyMix ,5 Ε θύ 10 Μ 0,7 Μ 1,75 Α φ 10 Μ 0,7 Μ 1,75 DNA- 50 ng/ l 50 ng/ l 1 Τ 25 Η ά θ KAPA2G KAPABIOSYSTEMS. Π ζ ύ ά, ά ύ θ ύ ω θ ω ω θ ύ ά ύ Taq DNA ά (wild-type Taq DNA polymerase). Έ ά 5 ->3 ά, ά 3 ->5 ξω ά ά ά 3 ->5 ξω ά. Έ άθ 1 άθ ά ω ά ω 1.7 x 10 5 ω. Τ ζ ύ ά θ ά, ά β ά. Έ, ReadyMix kit ά KAPA2G Fast DNA (0,5U ά 25 L ) θ ά dntps (0,2 mm άθ dntp 1X), MgCl2 (1,5 mm 1X) θ. Μ KAPA2G Fast HotStart ReadyMix ά ω PCR 82

83 70%, PCR ύ Taq DNA ά. Τ ω ά ξ ω PCR θ ά ύ ω ω ά ω φ rs ξ : Πίνακας VI: Π ω PCR θ ά θ rs ΣΤΑΔΙΟ ΑΝΤΙΔΡΑΣΗΣ ΘΕΡΜΟΚΡΑΣΙΑ ΧΡΟΝΟΣ Ε ζύ 95 º C 1 min Α ά ξ 95 º C 10 sec Υβ 60 º C 10 sec Ε 72 º C 1 sec Ε ά ψ ω ω ά ξ, β 40 ύ Τ 72 º C 30 sec rs (g T>C) Σ θ άφ, θ ω ω θ ά ύ φ ύ rs Πίνακας VII: Σ θ ά θ rs Α Τ Ό ά Α ω ω ( L) Η2Ο (PCR-grade) KAPA2G Fast HotStart ReadyMix ,5 Ε θύ 10 Μ 0,7 Μ 1,75 Α φ 10 Μ 0,7 Μ 1,75 DNA- 50 ng/ l 50 ng/ l 1 Τ 25 Τ ω ά ξ ω PCR θ ά ύ ω ω ά ω φ rs ξ : Πίνακας VIII: Π ω PCR θ ά θ rs ΣΤΑΔΙΟ ΑΝΤΙΔΡΑΣΗΣ ΘΕΡΜΟΚΡΑΣΙΑ ΧΡΟΝΟΣ Ε ζύ 95 º C 1 min Α ά ξ 95 º C 10 sec Υβ 65 º C 10 sec 83

84 Ε 72 º C 1 sec Ε ά ψ ω ω ά ξ, β 40 ύ Τ 72 º C 30 ec PROMOTER STR (GCGCG) X Σ θ άφ, θ ω ω θ ά ύ θ ύ ω ψ ω (GCGCG) MAP3K5. Πίνακας IX: Σ θ ά θ STR (GCGCG) X Α Τ Ό ά Α ω ω ( L) Η2Ο (PCR-grade) KAPA2G Fast HotStart ReadyMix ,5 Ε θύ 10 Μ 0,7 Μ 1,75 Α φ 10 Μ 0,7 Μ 1,75 DNA- 50 ng/ l 50 ng/ l 1 Τ 25 Τ ω ά ξ ω PCR θ ά ύ ω ω ά ω φ promoter STR (GCGCG) X ξ : Πίνακας X: Π ω PCR θ ά θ STR (GCGCG) X ΣΤΑΔΙΟ ΑΝΤΙΔΡΑΣΗΣ ΘΕΡΜΟΚΡΑΣΙΑ ΧΡΟΝΟΣ Ε ζύ 95 º C 1 min Α ά ξ 95 º C 15 sec Υβ 60 º C 15 sec Ε 72 º C 15sec Ε ά ψ ω ω ά ξ, β 40 ύ Τ 72 º C 30 sec 84

85 Μ ξ PCR φ ύ ύ, άζ 10 L 5 L ω 25 L ϊ PCR ψ ά ξ ζ, ύ PCR tubes. Σ o PCR tube 5 L ά ω θ ω 5 L θ ω ω ω PCR β. Τ ά ξ ά ω ύ, ω ζ ω ζ ψ ξ ζ GCGCG MAP3K5. Τ PCR tubes θ ύ θ θ ω : ΘΕΡΜΟΚΡΑΣΙΑ ΧΡΟΝΟΣ 95 C 5min 68 C 1hr 4 C Κ ά ά ά ά ξ ω ω ω ά ω - β θ. Μ ω φ ω ά ω ω ζ ω 3,5% ύ ΣΤΟΙΧΕΙΟΜΕΤΡΙΑ, ΠΡΩΤΟΚΟΛΛΟ ΚΑΤΑΤΜΗΣΗΣ ΚΑΙ ΗΛΕΚΤΡΟΦΟΡΗΣΗΣ ΓΙΑ ΤΟΝ rs ΑΝΤΙΔΡΑΣΤΗΡΙΟ ΌΓΚΟΣ ΑΝΑ ΑΝΤΙΔΡΑΣΗ( L) PCR ϊ 8 1X CutSmart Buffer (10X) 1,5 PvuII-HF 0,5 Τ 10 Μ ά ξ PCR ϊ, ζύ ά θ ύ ύ, θ ω ά ω 37 ºC 3 hrs. Τ ά ζύ 20 min 80 ºC φθ, ω θ ζύ ξ ά ( ά ύ 85

86 ά ζ ) Gel Loading Dye, Purple (6x). Γ άθ PCR ϊ ύ 10 L, θ 1 L Gel Loading Dye, Purple (6x). Ο ω ω ϊ ω ά θ φ ω ζ 2%. Μ ξ φ ω ζ θ ά ζ β. Η βά θ ω θ ά ω ψ ά. Έ, SNP ζ ω, ύ θ ύ, θ 196bp 356bp. Π ύ φ ζ ω ύ ά PCR ϊ 576bp, ω ζ ω φ ζ θ ύ ( 576bp, 356bp 196bp). Μ Μ Εικόνα 26: Π ω ζ ά ά PvuII-HF. Σ 1,2,4,7,12,13,14 β ζ ά βά 576bp, 356bp 196bp, ω ω ζ T/C. Σ 3,6,9,10,11 φ ζ ζ 576bp, βά ά ϊ, ω ω ζ ω T Τ/Τ. Σ 5, 8 β ύ ζ ά θ 356bp 196bp, ω ζ ω ξ ζ SNP φ ζ C/C. Σ ά άθ ά φ ωθ Ladder (100bp). Γ ξ βω θ θ ά ω ύ T/C ( 15). 86

87 3. ΑΠΟΤΕΛΕΣΜΑΤΑ Η ω θ ύ ω ω ά ω ά ω «Genomic variation in the MAP3K5 gene is associated with b thalassemia disease severity and hydroxyurea treatment efficacy» Tafrali ω. Π, θ SNPs rs rs , ω 1 MAP3K5 6q θ ζ β- ξά ω β-, ω ζ ω /β- (compound heterozygous SCD/βthalassemia) ( θ ) ω. Σ ύ θ ω rs rs β ύ ω ω ά ω β- θ. Μ ξ ω ά ω DNA ω ά ζ ω /β- (compound heterozygous SCD/β-thalassemia), θ HU, ύ θ ω rs rs ύξ ω ω HbF ω ύ HU θ. Τ, άθ ύ φά ω ψ ω ( φ ) φ (GCGCG) MAP3K5 ά DNA. Μ ω, ά ω φά ω ψ ω (GCGCG) ά θ. Γ θ ύ ω ψ ω (GCGCG) θ DNA θ ζ β-, θ ξά ω β-, ω ά ζ ω β-, θ HU ( -θ ) ω, ω. Σ ύ θ θ ύ ω ψ ω (GCGCG) MAP3K5 β ύ ω ω ά ω β-. Ε θ, ξ ω ά ω DNA ω ά ζ ω /β- (compound heterozygous SCD/βthalassemia), θ HU, ύ θ 87

88 θ ύ ω ψ ω (GCGCG) ύξ ω ω HbF ω ύ HU θ. Αξ ζ ω θ ύ ω ά ω DNA ω SNPs φ, rs rs ω ψ ω (GCGCG), ω ω SNPs (GCGCG) ω φ ω ύ. Σ ω ά ω, άζ ά ξ φ ζ φ θ ύ άθ φ (SNP), ω ψ ω (GCGCG). 3.Α. rs (C>A) Η ύ ω ά ω ω rs φ ζ ύ ά Sanger. Η ά ω ζ ϊ ύ ά ω ά ω DNA, φ ά ω PCR θ ύ φ ω ζ 1%. Η φ θ β β ψ ϊ ω ά PCR θ ω ω ω ϊ ω. Έ ύθ ύ ά Sanger. Α, 27 άζ φ PCR ϊ ω 9 θ ά ζ ω β-, ύ ά Sanger. 88

89 Μ Εικόνα 27: Η φ ω ζ 1% ϊ ω PCR ξ ω Sanger sequencing rs ά ω DNA 9 θ ά ζ ω β-. Μ: θ β 100bp. Σ 1,2,3,4,5,6,7,8,9 ω θ, 10 φ. Ε ά ά ω ( 28 29) ζ ω φ ά ύ ά Sanger. Εικόνα 28:Α ω φ θ φ ύ rs DNA θ ά ζ β-. Ε ω άφ ψ θ φ, ά ξύ θ β ύ. Η θ φ ύ 5 -AGGCAAGTCTTG-3 FinchTV. Γ ω ζ βά θ PCR ϊ ω ύ θ ω ω θ. Μ φ ω ω β θ φ. Σ ξ θ 89

90 ζ ά K. Α ω ζ θ φ ύ. Ε ω A/C. Εικόνα 29:Α ω φ θ φ ύ rs DNA θ ύ ζ β-. Ε ω άφ ψ θ φ, ά ξύ θ β ύ. Η θ φ ύ 5 -AGGCAAGTCTTG-3 FinchTV. Γ ω ζ βά θ PCR ϊ ω ύ θ ω ω θ. Μ φ ω ω β θ φ. Σ ξ θ ζ ά Τ. Α ω ζ θ φ ύ. Ε ω Τ/Τ. Σ θ ύ φ ω ά ψ ω ω ά rs MAP3K5. Πίνακας XI: Ο ω ω θ ά ω θ ω rs MAP3K5 ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ ΓΟΝΟΤΥΠΟΙ Α/Α C/A C/C Υ ά Α θ ζ β Α θ β- ξά ω ΚΡΙΤΗΡΙΟ 20% Α HU Μ HU ΚΡΙΤΗΡΙΟ 3FOLD Α HU Μ HU

91 Πίνακας XII: Ο % ω ύ ω ω ω θ ά ω θ ω rs MAP3K5 ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ % ΣΥΧΝΟΤΗΤΕΣ ΓΟΝΟΤΥΠΩΝ Α/Α C/A C/C Υ ά n= Α θ ζ β- n= Α θ β- ξά ω n= ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD Α HU n= Μ HUn= Α HU n= HU n=26 19,2 42,3 38,5 Πίνακας XIII: Ο % ω φω ω ω θ ά ω θ ω rs MAP3K5 % ΣΥΧΝΟΤΗΤΕΣ ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ ΑΛΛΗΛΟΜΟΡΦΩΝ A C ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD Υ ά n=39 Α θ ζ β- n=38 Α θ β- ξά ω n=7 Α HU n=17 Μ HUn=20 Α HU n=11 Α HU n= ,5 57,

92 Εικόνα 30: Γ άφ ω % ω ω ύ ω rs ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 3fold Εικόνα 31: Γ άφ ω % ω ω φω rs ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 3fold 92

93 Εικόνα 32: Γ άφ ω % ω ω φω rs ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 20% Εικόνα 33: Γ άφ ω % ω ω φω rs ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 20%. 93

94 Εικόνα 34: Γ άφ ω % ω ω ύ ω rs ά ω θ ζ β-. Εικόνα 35: Γ άφ ω % ω ω φω rs ά ω ω θ ζ β-. 94

95 % ΣΥΧΝΟΤΗΤΕΣ ΓΟΝΟΤΥΠΩΝ ΥΓΙΗ ΑΤΟΜΑ/ΑΣΘΕΝΕΙΣ ΜΕ ΜΗ ΕΞΑΡΤΩΜΕΝΗ ΜΕΤΑΓΓΙΣΕΩΝ Β- ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ rs υγιή άτομα ασθενείς με μη εξαρτώμενη μεταγγίσεων β-μεσογειακή αναιμία A/A C/C A/C Εικόνα 36: Γ άφ ω % ω ω ύ ω rs ά ω θ ξ ω β-. Εικόνα 37: Γ άφ ω % ω ω φω rs ά ω θ ξ ω β-. 95

96 % ΣΥΧΝΟΤΗΤΕΣ ΑΛΛΗΛΟΜΟΡΦΩΝ % ΣΥΧΝΟΤΗΤΕΣ ΓΟΝΟΤΥΠΩΝ ΑΣΘΕΝΕΙΣ ΜΕ ΜΕΙΖΟΝΑ β-μεσογειακη ΑΝΑΙΜΙΑ/ΑΣΘΕΝΕΙΣ ΜΕ ΜΗ ΕΞΑΡΤΩΜΕΝΗ ΜΕΤΑΓΓΙΣΕΩΝ β-μεσογειακη ΑΝΑΙΜΙΑ ασθενείς με μείζονα β- θαλασσαιμία 14 0 ασθενείς με μη εξαρτώμενη β- μεσογειακή αναιμία Α/Α C/C A/C Εικόνα 38: Γ άφ ω % ω ω ύ ω rs ά ω ζ β- θ ξ ω β ΑΣΘΕΝΕΙΣ ΜΕ ΜΕΙΖΟΝΑ β-μεσογειακη ΑΝΑΙΜΙΑ/ΑΣΘΕΝΕΙΣ ΜΕ ΜΗ ΕΞΑΡΤΩΜΕΝΗ ΜΕΤΑΓΓΙΣΕΩΝ β-μεσογειακη ΑΝΑΙΜΙΑ A C ασθενείς με μείζονα β- θαλασσαιμία ασθενείς με μη εξαρτώμενη β- μεσογειακή αναιμία Εικόνα 39: Γ άφ ω % ω ω φω rs ά ω ζ β- θ ξ ω β-. 96

97 Η % φά ω φ θ ω φω, ύ φω βά ω Ensembl, Κ ά 65% Α 35% C. Π ά ω ά ω, θ φ ύ Hardy Weinberg ξ θ ά. Γ ύ Hardy Weinberg, φ Pearson s goodness of fit chi-square, log likelihood chi-square exact test. Μ 0,05, 0,05 ύ 0,05 ύ β Hardy Weinberg. Η ω p β θ βά Human Institute Genetics ( φθ ά θ ά άφ θ. Πίνακας XIV: Τ ω ω Hardy-Weinberg ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ ΚΡΙΤΗΡΙΟ ΕΛΕΓΧΟΥ ΙΚΑΝΟΠΟΙΗΣΗΣ ΙΣΟΡΡΟΠΙΑΣ HARDYWEINBERG p pearson p likelihood p exact Υ ά n=39 0,60 0,60 0,72 Α θ ζ β- n=38 0,24 0,25 0,26 Α θ β- ξά ω n=7 0,05 0,02 0,16 Α HU n=17 0,76 0,76 1 Μ HUn=20 0,03 0,03 0,03 Α HU n=11 0,22 0,22 0,23 Α HU n=26 0,54 0,54 0,68 Λ ω ά θ ύ ω θ ω ά ω ω θ ξά ω β-, φ 2 ύ, φ Fisher s exact test p ά θ ά. 97

98 Σ ά φ ά ά ω ω ζ β-, ψ p 0,18 ( ύ 95%),, ά ά ω φ ύ β ά φ θ. Α φ ά ά ω ω ω ξά ω β-, ψ p<0,0,1 ( ύ 95%) ά rs θ. Ε, ύ ω θ ζ β- ω θ ξ ω β- ψ p<0,001, β β ξ ζ SNP β ύ θ. Τ, φ ά ύ ω «ω» «ω» HU ά ζ ω θ β-, ψ p 0, , % 3fold, ύ ά rs θ ω HU. Αξ ω ψ ύ, ζ ά φ (C/C) ά ω θ ξ ω β-. Ε ζ C/C ω «ω» θ ύ HU 3fold 20%. Τ, θ ζ A/A ά ω «ω» θ 3fold. 98

99 3.Β. rs (T>C) Η ύ ω ά ω ω rs φ θ ά ά PvuII-HF. Α ά, θ ω ά ω DNA ά ω PCR ύθ ά ω PCR ϊ ω ά PvuII-HF, φ ά ω ά. Τ, ύθ φ ω ϊ ω ά ω ζ 2%. Α, 38 άζ φ ϊ ω ά 9 θ ω 39 φ ά 12 ω ά ζ ω /β-. Μ Εικόνα 40: Η φ ω ζ 2% ϊ ω ά ά PCR ά ω DNA 9, ύ ω rs Μ: θ β 100bp. Σ 2,3,5,6,7 9 ζ (T/C), 1, 4 8 ζ ύ (T/T). 99

100 Μ Εικόνα 41: Η φ ω ζ 2% ϊ ω ά ά PCR ά ω DNA 12 ω ά ζ ω β-, ύ ω rs Μ: θ β 100bp. Σ 1,3,8 9 ζ (T/C), 2,4, 5, 6, 7 12 ζ ύ (T/T), ζ (C/C). Σ θ ύ άζ ω ά ψ ω ω ά rs MAP3K5. Σ, θ % ω ύ ω % φω ά θ ά β θ ά ω. Πίνακας XV: Ο ω ω θ ά ω θ ω rs MAP3K5 ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ ΓΟΝΟΤΥΠΟΙ Τ/Τ Τ/C C/C Υ ά n= Α θ ζ β- n= Α θ β- ξά ω n= Α HU n= ΚΡΙΤΗΡΙΟ 20% Μ HU n= ΚΡΙΤΗΡΙΟ Α HU n= FOLD HU n=

101 Πίνακας XVI: Ο % ω ύ ω ω ω θ ά ω θ ω rs MAP3K5 ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ % ΣΥΧΝΟΤΗΤΕΣ ΓΟΝΟΤΥΠΩΝ Τ/Τ Τ/C C/C Υ ά n= Α θ ζ β- n= Α θ β- ξά ω n= ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD Α HU n= Μ HUn= Α HU n= HU n= Πίνακας XVII: Ο % ω φω ω ω θ ά ω θ ω rs MAP3K5 % ΣΥΧΝΟΤΗΤΕΣ ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ ΑΛΛΗΛΟΜΟΡΦΩΝ Τ C ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD Υ ά n=39 Α θ ζ β- n=38 Α θ β- ξά ω n=7 Α HU n=17 Μ HUn=20 Α HU n=11 Α HU n=

102 Εικόνα 42: Γ άφ ω % ω ω ύ ω rs ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 3fold Εικόνα 43: Γ άφ ω % ω ω φω rs ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 3fold 102

103 Εικόνα 44: Γ άφ ω % ω ω ύ ω rs ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 20% Εικόνα 45: Γ άφ ω % ω ω φω rs ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 20% 103

104 Εικόνα 46: Γ άφ ω % ω ω ύ ω rs ά ω θ ζ β-. Εικόνα 47: Γ άφ ω % ω ω φω rs ά ω θ ζ β-. 104

105 Εικόνα 48: Γ άφ ω % ω ω ύ ω rs ά ω θ ξ ω β-. Εικόνα 49: Γ άφ ω % ω ω φω rs ά ω θ ξ ω β-. 105

106 % ΣΥΧΝΟΤΗΤΕΣ ΑΛΛΗΛΟΜΟΡΦΩΝ % ΣΥΧΝΟΤΗΤΕΣ ΓΟΝΟΤΥΠΩΝ ΑΣΘΕΝΕΙΣ ΜΕ ΜΕΙΖΟΝΑ β-μεσογειακη ΑΝΑΙΜΙΑ/ΑΣΘΕΝΕΙΣ ΜΕ ΜΗ ΕΞΑΡΤΩΜΕΝΗ ΜΕΤΑΓΓΙΣΕΩΝ β-μεσογειακη ΑΝΑΙΜΙΑ ασθενείς με μείζονα β- θαλασσαιμία 14 0 ασθενείς με μη εξαρτώμενη β- μεσογειακή αναιμία Τ/Τ C/C Τ/C Εικόνα 50: Γ άφ ω % ω ω ύ ω rs ά ω ζ β- θ ξ ω β ΑΣΘΕΝΕΙΣ ΜΕ ΜΕΙΖΟΝΑ β-μεσογειακη ΑΝΑΙΜΙΑ/ΑΣΘΕΝΕΙΣ ΜΕ ΜΗ 72 ΕΞΑΡΤΩΜΕΝΗ ΜΕΤΑΓΓΙΣΕΩΝ β-μεσογειακη ΑΝΑΙΜΙΑ Τ C 10 0 ασθενείς με μείζονα β-θαλασσαιμία ασθενείς με μη εξαρτώμενη β- μεσογειακή αναιμία Εικόνα 51: Γ άφ ω % ω ω φω rs ά ω ζ β- θ ξ ω β-. 106

107 Η % φά ω φ θ ω φω, ύ φω βά ω Ensembl, Κ ά 65% T 35% C. Π ά ω ά ω, θ φ ύ Hardy Weinberg ξ θ ά. Γ ύ Hardy Weinberg, φ Pearson s goodness of fit chi-square, log likelihood chi-square exact test. Μ 0,05, 0,05 ύ 0,05 ύ β Hardy Weinberg. Η ω p β θ βά Human Institute Genetics ( φθ ά θ ά άφ θ. Πίνακας XVIII: Τ ω ω Hardy-Weinberg ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ ΚΡΙΤΗΡΙΟ ΕΛΕΓΧΟΥ ΙΚΑΝΟΠΟΙΗΣΗΣ ΙΣΟΡΡΟΠΙΑΣ HARDYWEINBERG p pearson p likelihood p exact Υ ά n=39 0,93 0,93 1 Α θ ζ β- n=38 0,93 0,93 1 Α θ β- ξά ω n=7 0,05 0,02 0,16 Α HU n=17 0,39 0,37 0,61 Μ HU n=20 0,96 0,96 1 Α HU n=11 0,78 0,78 1 Α HU n=26 0,39 0,39 0,69 Λ ω ά θ ύ ω θ ω ά ω ω θ ξά ω β-, φ 2 ύ, φ Fisher s exact test p ά θ ά. 107

108 Σ ά φ ά ά ω ω ζ β-, ψ p 0,97 ( ύ 95%),, ά ά ω φ ύ β ά φ θ. Α φ ά ά ω ω ξά ω β-, ψ p <0,01 ( ύ 95%) ά rs θ. Ε, ύ ω θ ζ β- ω θ ξ ω β- ύ ά ξ SNP β θ. Τ, φ ά ύ ω «ω» «ω» HU ά ζ ω θ β-, ψ p 0,009 0, % 3fold, ύ ά rs θ ω HU. Αξ ω ψ ύ, ζ ά φ (C/C) ά ω θ ξ ω β-. Ε, θ T/T ά ω «ω» θ 3fold 20%. 3.Γ. SHORT TANDEM REPEAT (GCGCG) ΣΤΟΝ ΥΠΟΚΙΝΗΤΗ ΤΟΥ MAP3K5 Η ύ ω ά ω θ ύ ω ψ ω (GCGCG) MAP3K5 φ θ ά ω (heteroduplex analysis, HDA). Α ά, θ ω ά ω DNA ά ω PCR. Α ύθ ξ ά ω ύ ω ζ ψ (GCGCG) MAP3K5 φ ά ξ β ω ω. Τ, ύθ φ ω ϊ ω HDA ω ζ 3,5%. Α, 48 άζ φ ϊ ω HDA 8 θ ζ β- 49 φ 3 ω. 108

109 Μ Εικόνα 52: Η φ ω ζ 3,5% ϊ ω HDA ά ά ξ ω ύ ύ ά ω DNA, ά ξ β. Π 8 θ ζ β- ύ ω STR. Μ: θ β 100bp.Α ά ύ φ ύ ά ω, Ο (1,2), (7,8), (9,10), (13,14) (15,16) ύ ω 5 θ ζ 4 ψ (GCGCG). Ο (3,4), (5,6), (11,12) ύ ω 3 θ ζ 4 ψ. Σ 18 φ. Μ Εικόνα 53: Η φ ω ζ 3,5% ϊ ω HDA ά ά ξ ω ύ ύ ά ω DNA, ά ξ β. Π 3 ά ύ ω STR. Μ: θ β 100bp.Α ά ύ φ ύ ά ω. Ο (1,2), (3,4) ύ ω 2 ά ζ 4 ψ (GCGCG). Ο (5,6) ύ ω ά ζ 4 ψ. Σ 8 φ. 109

110 Σ θ ύ φ ω ά ψ ω ω ά θ ύ ω ψ ω (GCGCG) MAP3K5. Σ, θ % ω ύ ω % φω ά θ ά β θ ά ω. Πίνακας XIX:Ο ω ω θ ά ω θ ω STR MAP3K5 ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ ΓΟΝΟΤΥΠΟΙ (GCGCG)4/(GCGCG)4 (GCGCG)4/(GCGCG)5 (GCGCG)5/(GCGCG)5 ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD Υ ά n= Α θ ζ β- n= Α θ β- ξά ω n= Α HU n= Μ HUn= Α HU n= Μ HUn= Πίνακας XX: Ο % ω ύ ω ω ω θ ά ω θ ω ά ψ (GCGCG) STR MAP3K5 ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ % ΣΥΧΝΟΤΗΤΕΣ ΓΟΝΟΤΥΠΩΝ (GCGCG)4/(GCGCG)4 (GCGCG)4/(GCGCG)5 (GCGCG)5/(GCGCG)5 Υ ά n=39 43,6 48,7 7,7 Α θ ζ β- n= ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD Α θ β- ξά ω n= Α HU n= Μ HUn= Α HU n= Μ HUn=

111 Πίνακας XXI: Ο % ω φω ω ω θ ά ω θ ω ά ψ (GCGCG) STR MAP3K5 ΠΛΗΘΥΣΜΙΑΚΗ ΟΜΑΔΑ ΜΕΛΕΤΗΣ % ΣΥΧΝΟΤΗΤΕΣ ΑΛΛΗΛΟΜΟΡΦΩΝ ΚΡΙΤΗΡΙΟ 20% ΚΡΙΤΗΡΙΟ 3FOLD Υ ά n=39 Α θ ζ β- n=38 Α θ β- ξά ω n=7 Α HU n=17 Μ HUn=20 Α HU n=11 Α HU n=26 (GCGCG) 4 (GCGCG)

112 Εικόνα 54: Γ άφ ω % ω ω ύ ω STR ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 3fold Εικόνα 55: Γ άφ ω % ω ω φω STR ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 3fold 112

113 Εικόνα 56: Γ άφ ω % ω ω ύ ω STR ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 20% Εικόνα 57: Γ άφ ω % ω ω ύ ω STR ά «ω» «ω» θ ά ζ ω β- ύ HU. Κ 20% 113

114 %ΣΥΧΝΟΤΗΤΕΣ ΑΛΛΗΛΟΜΟΡΦΩΝ Εικόνα 58: Γ άφ ω % ω ω ύ ω STR ά ω ω ζ β-. ΥΓΙΗ ΑΤΟΜΑ/ΑΣΘΕΝΕΙΣ ΜΕ ΜΕΙΖΟΝΑ Β-ΜΕΣΟΓΕΙΑΚΗ ΑΝΑΙΜΙΑ STR υγιή άτομα ασθενείς με μείζονα β-μεσογειακή αναιμία Εικόνα 59: Γ άφ ω % ω ω φω STR ά ω ω ζ β-. 114

115 Εικόνα 60: Γ άφ ω % ω ω ύ ω STR ά ω ω ξ ω β-. Εικόνα 61: Γ άφ ω % ω ω φω STR ά ω ω ξ ω β-. 115