Pengantar Proses Stokastik

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Pengantar Proses Stokastik"

Transcript

1 Bab 3: Diskrit Statistika FMIPA Universitas Islam Indonesia

2 Ilustrasi 1 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Perilaku bunuh diri kini kian menjadi-jadi. Hesti (nama sebenarnya) adalah sebuah contoh. Dia pernah melakukan percobaan bunuh diri, namun gagal. Menurut pakar, kalau pada suatu waktu seseorang melakukan percobaan bunuh diri maka besar kemungkinan dia akan melakukannya lagi di masa mendatang. Jika seseorang belum pernah melakukan percobaan bunuh diri, di masa mendatang orang tersebut akan mungkin melakukan percobaan bunuh diri. Deskripsikan fenomena diatas sebagai model peluang (probability model).

3 Ilustrasi 2 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Loyalitas konsumen terhadap suatu merek barang. Wilkie (1994) mendefinisikan brand loyalty as a favorable attitude toward and consistent purchase of a particular brand. Lyong (1998): brand loyalty is a function of a brands relative frequency of purchase in both time-independent and time-dependent situations. Seorang konsumen pembeli merek barang A diharapkan akan terus membeli barang A. Mungkinkah ini terjadi? Apakah model statistika yang dapat dengan tepat (atau mendekati tepat) merinci peluang terjadinya hal ini? Apakah model ini membantu dalam strategi pemasaran suatu barang?

4 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Misalkan sebuah proses stokastik {X t } dengan t = 0, 1, 2,.... Nilai yang mungkin dari X t adalah hingga atau terhitung Memiliki peluang transisi atau peluang berpindahnya keadaan i (pada waktu t) ke keadaan j (pada waktu t + 1) adalah P ij yaitu P(X t+1 = j X t = i, X t 1 = i t 1,..., X 1 = i 1, X 0 = i 0 ) = P ij Distribusi bersyarat X t+1 diberikan keadaan-keadaan lampau X 0, X 1,..., X t 1 dan keadaan sekarang X t, hanya bergantung pada keadaan sekarang (Sifat Markov) Maka proses stokastik demikian dikenal dengan nama Rantai Markov.

5 Matriks Peluang Transisi Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat P ij adalah peluang bahwa proses akan berada di keadaan j dari keadaan i P ij 0, i, j 0; P ij = 1, i = 0, 1,... j=0 Perhatikan P(X t+1 = j X t = i, X t 1 = i t 1,..., X 1 = i 1, X 0 = i 0 ) = P(X t+1 = j X t = i) = P ij disebut peluang transisi satu langkah.

6 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Misalkan P menyatakan matriks peluang transisi satu langkah P ij, maka P 00 P 01 P P 10 P 11 P P =... P i0 P i1 P i

7 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Atau dapat pula digambarkan sebagai berikut

8 Contoh 1 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Jika hari ini hujan, peluang besok hujan adalah α. Jika hari ini tidak hujan, peluang besok hujan adalah β. Misal: 0 : hujan 1 : tidak hujan Maka matriks peluang transisinya adalah ( ) α 1 α P = β 1 β

9 Contoh 2 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Dalam suatu hari, Gary bisa ceria (C), biasa saja (B), atau murung (M). Jika hari ini ceria, maka dia akan C, B, atau M besok dengan peluang masing-masing 0.5, 0.4, 0.1. Jika dia merasa biasa saja hari ini, maka dia akan C, B, atau M besok dengan peluang masing-masing 0.3, 0.4, 0.3. Jika dia merasa murung hari ini, maka dia akan C, B, atau M besok dengan peluang masing-masing 0.2, 0.3, 0.5.

10 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Misalkan keadaan 0 = C, keadaan 1 = B, dan keadaan 2 = M, maka matriks peluang transisinya adalah P =

11 Contoh 3 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Keadaan pada suatu hari: Jika dua hari terakhir hujan, peluang besok hujan 0.7 Jika hari ini hujan dan kemarin tidak hujan, peluang besok hujan 0.5 Jika hari ini tidak hujan dan kemarin hujan, peluang besok hujan 0.4 Jika hari ini dan kemarin tidak hujan, peluang besok hujan 0.2

12 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Misal: 0 : hujan 1 : tidak hujan Maka matriks peluang transisinya adalah P =

13 Contoh 4 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Sebuah penelitian dilakukan untuk mengetahui efek pemberian zat X untuk menangani penyebaran virus A pada tubuh manusia. Penelitian tersebut diujicobakan pada seekor mencit yang diberi suntikan virus A kemudian setelah 6 jam pertama mencit tersebut diberi suntikan zat X. Selanjutnya mencit tersebut akan diamati perubahan kondisinya setiap 6 jam selama 1 minggu. Berdasarkan pengamatan diperoleh data sebagai berikut:

14 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Keterangan: S menyatakan kondisi sehat, L menyatakan kondisi lemas, dan P menyatakan kondisi pingsan.

15 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Matriks peluang transisinya adalah P =

16 Matriks Stokastik Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Perhatikan matriks-matriks berikut: P = , P =

17 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Matriks-matriks tersebut memiliki sifat-sifat berikut: Memiliki jumlah baris dan kolom sama, atau matriks bujursangkar Jumlah unsur-unsur di setiap baris adalah satu Tidak selalu memiliki jumlah unsur-unsur di setiap kolom sama dengan satu Nilai setiap unsurnya diantara nol dan satu Matriks dengan sifat-sifat tersebut dikatakan sebagai matriks stokastik.

18 Contoh 5 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Suatu rantai Markov dengan keadaan-keadaan 0, 1, 2 mempunyai matriks peluang transisi P = dan P(X 0 = 0) = 0.3, P(X 0 = 1) = 0.4, P(X 0 = 2) = 0.3. Hitung P(X 0 = 0, X 1 = 1, X 2 = 2).

19 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Penyelesaian: P(X 0 = 0, X 1 = 1, X 2 = 2) = P(X 2 = 2 X 1 = 1, X 0 = 0)P(X 1 = 1, X 0 = 0) = P(X 2 = 2 X 1 = 1, X 0 = 0)P(X 1 = 1 X 0 = 0)P(X 0 = 0) = P(X 2 = 2 X 1 = 1)P(X 1 = 1 X 0 = 0)P(X 0 = 0) = 0(0.2)(0.3) = 0

20 Contoh 6 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Suatu rantai Markov dengan keadaan-keadaan 0, 1, P = Hitung P(X 2 = 1, X 3 = 1 X 1 = 0) dan P(X 1 = 1, X 2 = 1 X 0 = 0).

21 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Penyelesaian: a. P(X 2 = 1, X 3 = 1 X 1 = 0) = P(X 3 = 1 X 2 = 1)P(X 2 = 1 X 1 = 0) = 0.6(0.2) = 0.12 b. P(X 1 = 1, X 2 = 1 X 0 = 0) = P(X 2 = 1 X 1 = 1)P(X 1 = 1 X 0 = 0) = 0.6(0.2) = 0.12

22 Contoh 7 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Suatu matriks stokastik dengan keadaan-keadaan 0, 1, 2 Hitung E(X 2 X 1 = 2) P =

23 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Penyelesaian: 2 E(X 2 X 1 = 2) = x 2 P(X 2 = x 2 X 1 = 2) x 2 =0 = 0 + (1) P(X 2 = 1 X 1 = 2) + (2) P(X 2 = 2 X 1 = 2) = 0

24 Matriks Stokastik n-langkah Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Pandang matriks stokastik satu-langkah: ( ) P = Selanjutnya, kita dapat menentukan matriks stokastik dua-langkah yaitu matriks yang didefinisikan pada ruang keadaan yang sama namun ruang waktu dua-langkah atau {t, t + 2}.

25 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Ingat kembali matriks stokastik satu-langkah P ij = P(X t+1 = j X t = i) Kita dapat menentukan matriks stokastik dua-langkah yaitu Pij 2 = P(X t+2 = j X t = i) Dalam kasus ini ( P 2 P 2 = 00 P01 2 ) P10 2 P11 2

26 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Kita bisa menggunakan law of total probability yaitu P00 2 = P(X t+2 = 0 X t = 0) = P(X t+2 = 0, X t+1 = 0 X t = 0) + P(X t+2 = 0, X t+1 = 1 X t = 0) = P(X t+2 = 0 X t+1 = 0, X t = 0)P(X t+1 = 0 X t = 0) + P(X t+2 = 0 X t+1 = 1, X t = 0)P(X t+1 = 1 X t = 0) = P(X t+2 = 0 X t+1 = 0)P(X t+1 = 0 X t = 0) + P(X t+2 = 0 X t+1 = 1)P(X t+1 = 1 X t = 0) = P 00 P 00 + P 10 P 01 = P 00 P 00 + P 01 P 10

27 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Penyelesaian tersebut berlaku pula untuk P 2 01, P2 10 dan P2 11. Atau sama saja dengan mengalikan dua matriks P yaitu P 2 = P.P ( ) ( ) P00 P = 01 P00 P. 01 P 10 P 11 P 10 P 11 ( ) P00 P = 00 + P 01 P 10 P 00 P 01 + P 01 P 11 P 10 P 00 + P 11 P 10 P 10 P 01 + P 11 P 11

28 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Jadi, untuk contoh di atas P 2 00 = P 00 P 00 + P 01 P 10 = 0.3(0.3) + 0.7(0.5) = 0.44 atau, matriks stokastik dua-langkahnya adalah ( ) ( ) P = ( ) =

29 Chapman-Komogorov Equations Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Misalkan P n ij menyatakan peluang bahwa proses pada keadaan i akan berada pada keadaan j setelah n-transisi, P n ij = P (X t+n = j X t = i), n 0, i, j 0

30 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Persamaan Chapman-Kolmogorov memberikan metode untuk menghitung peluang transisi n + m-langkah, yaitu P n+m ij = k=0 P n ik Pm kj untuk semua n, m 0, semua i, j P n ik Pm kj menyatakan peluang bahwa proses bermula pada keadaan i akan berpindah ke keadaan j dalam n + m transisi melalui keadaan k pada transisi ke-n.

31 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat P n+m ij = P(X n+m = j X 0 = i) = P(X n+m = j, X n = k X 0 = i) = = k=0 P(X n+m = j X n = k, X 0 = i)p(x n = k X 0 = i) k=0 Pkj m Pn ik = k=0 k=0 P n ik Pm kj

32 Contoh 8 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Misalkan pada Contoh 1 diketahui α = 0.7 dan β = 0.4, maka tentukan peluang bahwa akan hujan pada empat hari dari hari ini diberikan bahwa hari ini hujan!

33 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat [ ] [ ] [ ] P 2 = = [ ] [ ] [ ] P 4 = = Jadi, P00 4 =

34 Contoh 9 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Perhatikan Contoh 3, diberikan pada hari Senin dan Selasa hujan, berapa peluang bahwa pada hari Kamis akan hujan?

35 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat P 2 = = Senin Selasa Rabu Kamis atau 1 0

36 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Peluang bahwa Kamis hujan adalah: P P P P = P P = = 0.61

37 Peluang Transisi Tak Bersyarat Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Peluang transisi P n ij yang sudah kita hitung di atas merupakan peluang bersyarat. Jika kita ingin menghitung peluang transisi tak bersyaratnya yaitu P(X n = j), maka kita bisa menggunakan law of total probability yaitu P(X n = j) = = P(X n = j X 0 = i) P(X 0 = i) i=0 Pij n α i i=0 dengan α i = P(X 0 = i), i 0 adalah peluang tak bersyarat pada keadaan awal atau t = 0, dan α i = 1 i=0

38 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Sebagai contoh, berdasarkan Contoh 8, jika α 0 = 0.4, α 1 = 0.6, maka peluang (tak bersyarat) bahwa akan hujan empat hari setelah kita mempunyai data perubahan cuaca adalah P(X 4 = 0) = P(X 4 = 0 X 0 = 0)P(X 0 = 0) + P(X 4 = 0 X 0 = 1)P(X 0 = 1) = P 4 00 α 0 + P 4 10 α 1 = 0.4P P 4 10 = (0.4)(0.5749) + (0.6)(0.5668) = 0.57

39 Kebebasan dalam Matriks Stokastik Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Misalkan P = ( 0.4 ) Maka, P(X t = 0 X t 1 = 0) = P(X t = 0 X t 1 = 1) = 0.4 Kemudian, dengan law of total probability P(X t = 0) = P(X t = 0 X t 1 = 0)P(X t 1 = 0) + P(X t = 0 X t 1 = 1)P(X t 1 = 1) α = 0.4 α (1 α) Jadi, α = 0.4

40 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Dengan kata lain P(X t = 0 X t 1 = 0) = 0.4 = P(X t = 0) Ini berarti bahwa peubah acak X t saling bebas.

41 Contoh-contoh Lain Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat 1. Jika pada waktu t, Vanes mengajukan klaim asuransi, maka Vanes akan mengajukan klaim pada waktu t + 1 dengan peluang α; jika Vanes tidak mengajukan klaim asuransi saat ini maka di masa depan Vanes akan mengajukan klaim asuransi dengan peluang β. Matriks peluang transisinya adalah Keadaan: 0 : tidak mengajukan klaim 1 : mengajukan klaim ( ) 1 β β P = 1 α α

42 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat 2. Percobaan-percobaan dilakukan secara berurutan. Jika dalam dua percobaan terakhir SUKSES, maka peluang GAGAL pada percobaan berikut adalah 0.8. Dalam keadaan YANG LAIN, peluang GAGAL adalah 0.4.

43 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat Keadaan-keadaan: 0 (SS) : kemarin S, sekarang S 1 (SG) : kemarin S, sekarang G 2 (GS) : kemarin G, sekarang S 3 (GG) : kemarin G, sekarang G P =

44 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat 3. Tim sepakbola IKS UII akan memainkan tujuh rangkaian pertandingan. Hasil setiap pertandingan saling bebas. Setiap pertandingan akan dimenangkan oleh tim A dengan peluang α dan oleh tim B dengan peluang 1 α. Misalkan keadaan suatu sistem direpresentasikan oleh pasangan (a, b) di mana a menyatakan banyak pertandingan yang dimenangkan oleh A dan b adalah banyak pertandingan yang dimenangkan B. Bentuklah untuk masalah tersebut. Catatan: a + b 7 dan rangkaian pertandingan akan berakhir jika a = 4 atau b = 4.

45 Matriks Peluang Transisi Matriks Stokastik Chapman-Komogorov Equations Peluang Transisi Tak Bersyarat

46 Keadaan j dikatakan dapat diakses dari keadaan i jika P n ij > 0 untuk suatu n 0. i j Perhatikan bahwa hal ini mengakibatkan keadaan j dapat diakses dari keadaan i jika dan hanya jika, dimulai pada keadaan i, proses akan pernah masuk ke keadaan j. Dua keadaan i dan j yang dapat diakses satu sama lain dikatakan dapat berkomunikasi. i j

47 Contoh: P = ( ) Apakah keadaan 1 bisa berkomunikasi dengan dirinya sendiri? Solusi: Jadi, 1 1 P 11 = 0 P 2 11 = P 10 P 01 + P 11 P 11 = 1(0.3) + 0 = 0.3 > 0

48 Jenis keadaan: 1 Keadaan i berkomunikasi dengan keadaan i untuk semua i 0 2 Jika keadaan i berkomunikasi dengan keadaan j, maka keadaan j berkomunikasi dengan keadaan i 3 Jika keadaan i berkomunikasi dengan keadaan j dan keadaan j berkomunikasi dengan keadaan k, maka keadaan i berkomunikasi dengan keadaan k.

49 Dua keadaan yang saling berkomunikasi dikatakan berada dalam kelas yang sama. dikatakan tidak dapat direduksi jika hanya terdapat satu kelas keadaan, yaitu jika semua keadaan saling berkomunikasi satu sama lain. Sebuah keadaan yang tidak bisa berpindah ke keadaan yang lain dikatakan sebagai keadaan absorbing.

50 Contoh 10 Tentukan kelas keadaan dari dengan peluang transisi P =

51 a. 0 1 P 01 = 0 P01 2 = P 00 P 01 + P 01 P 11 + P 02 P 21 = (0.4) = 0.12 > P 10 = 0.5 > Jadi, 0 1

52 b. 1 2 P 12 = 0.5 > 0 P 21 = 0.4 > 0 Jadi, 1 2 c. 2 3 Jadi, 2 3 P 23 = 0.6 > 0 P 32 = 0 P 2 32 = P 30 P 02 + P 31 P 12 + P 32 P 22 + P 33 P 32 = (0.5) = 0.1 > 0

53 Karena 0 1, 1 2, dan 2 3, maka masing-masing keadaan saling berkomunikasi sehingga kelas keadaannya adalah {0, 1, 2, 3} dan tersebut tidak dapat direduksi.

54 Contoh 11 Tentukan kelas keadaan dari matriks peluang transisi berikut P = 1/2 1/4 1/4 1/4 1/4 1/2

55 Solusi: Kelas keadaannya: {0} dan {1, 2}. Keadaan {0} bersifat absorbing.

56 Keadaan Recurrent dan Transient Untuk setiap keadaan i, misalkan f i peluang bahwa dimulai dari keadaan i proses akan pernah kembali ke keadaan i. Keadaan i dikatakan recurrent jika f i = 1 dan dikatakan transient jika f i < 1. Jika keadaan i recurrent, maka proses akan terus kembali ke keadaan i dengan peluang satu. Dengan definisi Rantai Markov, proses akan dimulai lagi ketika kembali ke keadaan i, dan seterusnya, sehingga keadaan i akan dikunjungi lagi. Jika keadaan i recurrent maka dimulai dari keadaan i maka proses akan kembali ke keadaan i terus dan terus sebanyak tak hingga kali.

57 Misalkan keadaan i transient. Setiap kali proses kembali ke keadaan i terdapat kemungkinan (peluang yang positif) sebesar 1 f i bahwa proses tidak pernah kembali ke keadaan i. Dengan demikian, dimulai dari keadaan i, peluang bahwa proses berada di i sebanyak tepat n periode/kali adalah (1 f i ), n 1. Jika keadaan i transient maka, dimulai dari keadaan i, banyak periode/kali bahwa proses akan berada di keadaan i adalah peubah acak geometri dengan parameter 1 f i f n 1 i

58 Keadaan i recurrent jika dan hanya jika, dimulai dari keadaan i, maka banyak periode/kali yang diharapkan (expected number of time periods) bahwa proses akan berada di keadaan i adalah tak hingga.

59 Misalkan I n = { 1, X n = i 0, X n i Misalkan I n menyatakan banyak periode/kali bahwa proses n=0 berada dalam keadaan i, dan [ ] E I n X 0 = i = n=0 = = E[I n X 0 = i] n=0 P(X n = i X 0 = i) n=0 n=0 P n ii

60 Proposisi Keadaan i adalah Recurrent jika Pii n = n=1 Transient jika Pii n < n=1

61 Contoh 12 Misalkan yang terdiri atas keadaan-keadaan 0, 1, 2, 3 mempunyai matriks peluang transisi 0 0 1/2 1/2 P = Tentukan keadaan mana yang transient dan mana yang recurrent.

62 Solusi: Semua keadaan saling berkomunikasi dan semua keadaan bersifat recurrent

63 Contoh 13 Matriks peluang transisi 1/2 1/ /2 1/ P = 0 0 1/2 1/ /2 1/2 0 1/4 1/ /2 Tentukan kelas keadaan dan sifat-sifatnya

64 Solusi: tersebut terdiri atas tiga kelas yaitu {0, 1}, {2, 3}, dan {4}. Sifat-sifatnya: Kelas {0, 1} dan {2, 3} bersifat recurrent Kelas {4} bersifat transient

65 Misalkan matriks peluang transisi pada adalah ( ) P = Maka matriks peluang transisi 4 dan 8 langkahnya adalah ( ) P = P 8 = ( )

66 Perhatikan bahwa matriks P 8 hampir identik dengan matriks P 4. Selain itu, setiap baris dari P 8 memiliki unsur yang identik. Pada kenyataannya, sepertinya P n ij konvergen ke suatu nilai, untuk n, yang sama untuk semua i. Dengan kata lain, terdapat limit peluang bahwa proses akan berada di keadaan j setelah sekian langkah (transisi). Nilai limit ini saling bebas dengan nilai pada keadaan awal.

67 Jika waktu kembali yang pertama dari keadaan i hanya dapat berupa kelipatan dari integer d > 1, keadaan tersebut disebut periodik. Keadaan yang memiliki periode 1 disebut aperiodik. Contoh periodik: P =

68 Jika keadaan i recurrent, maka keadaan tersebut akan dikatakan positive recurrent jika, dimulai dari keadaan i, waktu harapan hingga proses kembali ke i adalah hingga. Pada yang memiliki keadaan hingga, semua keadaan recurrent adalah positive recurrent. Suatu keadaan yang positive recurrent dan aperiodik disebut ergodik.

69 Teorema Untuk yang ergodik dan tidak dapat direduksi, lim n Pn ij ada dan saling bebas dari i. Misalkan π j = lim n Pn ij, j 0, maka π j adalah solusi nonnegatif tunggal dari dengan π j = 1. j=0 π j = π i Pij n, j 0, i=0

70 Catatan: Perhatikan bahwa P(X n+1 = j) = = P(X n+1 = j X n = i) P(X n = i) i=0 P ij P(X n = i) i=0 Misalkan n dan asumsikan kita bisa menambahkan limit di dalam persamaan, maka π j = P ij π i i=0

71 Limit peluang π j adalah peluang jangka panjang (long-run proportion of time) bahwa suatu proses akan berada di keadaan j. Jika tidak dapat direduksi, maka terdapat solusi untuk π j = lim n Pn ij, j 0,, dengan π j = 1, jika dan j hanya jika bersifat positive recurrent. Jika solusinya ada, maka solusi tersebut tunggal dan π j adalah proporsi jangka panjang bahwa berada dalam keadaan j. Jika aperiodik, maka π j adalah limit peluang bahwa rantai akan berada di keadaan j.

72 Contoh 14 Jika hari ini hujan, peluang besok hujan adalah α. Jika hari ini tidak hujan, peluang besok hujan adalah β. Misal: 0 : hujan 1 : tidak hujan Maka matriks peluang transisinya adalah ( ) α 1 α P = β 1 β dan kita mempunyai persamaan-persamaan π 0 = απ 0 + βπ 1 π 1 = (1 α)π 0 + (1 β)π 1 π 0 + π 1 = 1

73 Maka diperoleh peluang hujan dan tidak hujan dalam jangka panjang adalah β π 0 = 1 + β α dan π 1 = 1 α 1 + β α

74 Contoh 15 Misalkan keadaan mood Gary disajikan dalam matriks peluang transisi P = Berapa peluang jangka panjang untuk masing-masing keadaan?

75 Kita mempunyai persamaan: π 0 + π 1 + π 2 = 1 dan diperoleh solusinya yaitu π 0 = 0.5π π π 2 π 1 = 0.4π π π 2 π 2 = 0.1π π π 2 π 0 = 21 62, π 1 = 23 62, π 2 = 18 62

76 Contoh-Contoh Lain 1. Innod adalah mahasiswa semester 6 di Statistika UII. Dia tinggal tidak jauh dari kampus, cukup berjalan kaki saja dari tempat kos ke kampus dan sebaliknya. Akhir-akhir ini hujan datang hampir setiap hari. Mau tidak mau, Innod menggunakan payung dalam perjalanan kos-kampus atau kampus-kos. Jika hari hujan dan payung ada di tempat Innod berada, maka Innod akan menggunakan payung tersebut. Jika hari tidak hujan, Innod selalu lupa untuk membawa payung. Misalkan θ adalah peluang hujan setiap kali Innod akan menuju kampus atau kos. Jika Innod memiliki 3 buah payung, bentuklah suatu rantai Markov dari proses di atas!

77 Keadaan-keadaan: Matriks peluang transisi: 0 : 0 payung di tempat Innod berada 1 : 1 payung di tempat Innod berada 2 : 2 payung di tempat Innod berada 3 : 3 payung di tempat Innod berada P = θ θ 0 1 θ θ 0 1 θ θ 0 0

78 2. Tiga bola putih dan tiga bola hitam diletakkan ke dalam dua kotak sedemikian rupa sehingga masing-masing kotak terdiri atas tiga bola. Kita katakan bahwa sistem berada pada keadaan i, i = 0, 1, 2, 3, jika kotak pertama terdiri atas i bola putih. Pada masing-masing langkah, kita ambil sebuah bola dari masing-masing kotak dan meletakkan bola dari kotak kedua ke kotak pertama dan sebaliknya. Buatlah matriks peluang transisi dari kejadian tersebut!

79 Keadaan-keadaan: 0 : terdapat 0 bola putih di kotak pertama 1 : terdapat 1 bola putih di kotak pertama 2 : terdapat 2 bola putih di kotak pertama 3 : terdapat 3 bola putih di kotak pertama

80 P 10 = P(X n = 0 X n 1 = 1) = P(P 12 H 21 ) = = 1 9 P 11 = P(P 12 P 21 ) + P(H 12 H 21 ) = = 4 9 P 12 = P(H 12 P 21 ) = = 4 9

81 Jadi matriks peluang transisinya adalah: P =

82 3. Ninda baru saja mendengar gosip bahwa sebuah KDrama baru akan dirilis bulan ini. Ninda ingin menyebarkan gosip ini kepada teman-teman gengnya. Model penyebaran gosip ala Ninda adalah sbb: Jumlah orang dalam geng Ninda adalah N = 5, sebagian sudah dengar gosip dan sisanya belum. Dalam setiap waktu, 2 orang akan dipilih secara acak dari geng tersebut dan keduanya (diasumsikan) berinteraksi. Pemilihan orang-orang tersebut dilakukan s.d.h interaksi antara setiap pasangan adalah sama. Jika satu orang dari suatu pasangan sudah dengar gosip, yang lain belum, maka gosip akan disebarkan ke orang yang belum dengan dengan peluang 0.1. Misalkan X n menyatakan jumlah orang yang dengar gosip di akhir periode ke-n. Bentuklah suatu matriks peluang transisi yang mungkin.

83 Keadaan-keadaan: 0, 1, 2, 3, 4, 5 menyatakan jumlah orang yang mendengar gosip. P 00 = 1 dan P 55 = 1. Jelas. Jika tidak ada/semua orang dengar gosip pasti keadaan berubah ke keadaan yang sama dengan sebelumnya. P i,i+1 = 0.1 C 1 i C 1 5 i C2 5 = 0.01(i)(5 i) P ii = (i)(5 i) untuk i = 1, 2, 3, 4

84 P =

85 4. Sebuah {X n, n 0} dengan keadaan-keadaan 0, 1, 2 mempunyai matriks peluang transisi sebagai berikut: P = Jika P(X 0 = 0) = P(X 0 = 1) = 1 4, tentukan E(X 2).

86 Matriks peluang transisi 2-langkah nya adalah: P 2 = = Untuk menghitung E(X 2 ) maka E(X 2 ) = 2 x 2 P(X 2 = x 2 ) x 2 = = 0.P(X 2 = 0) + 1.P(X 2 = 1) + 2.P(X 2 = 2)

87 P(X 2 = 1) = P(X 2 = 1 X 0 = 0)P(X 0 = 0) + P(X 2 = 1 X 0 = 1)P(X 0 = 1) + P(X 2 = 1 X 2 = 2)P(X 2 = 2) = = 13 72

88 Jadi, E(X 2 ) = P(X 2 = 2) = P(X 2 = 2 X 0 = 0)P(X 0 = 0) + P(X 2 = 2 X 0 = 1)P(X 0 = 1) + P(X 2 = 2 X 2 = 2)P(X 2 = 2) = = x 2 P(X 2 = x 2 ) = 1.P(X 2 = 1) + 2.P(X 2 = 2) x 2 =0 = = 71 72

89 5. Tentukan kelas keadaan dan sifat-sifat dari matriks-matriks peluang transisi berikut a P = b P = 1/9 4/9 4/ /9 4/9 1/

90 a. Kelas keadaan: {0, 1}, {2}, dan {3} Sifat keadaan: keadaan 0, 1, 3 recurrent dan keadaan 2 transient. b. Kelas keadaan: {0, 1, 2, 3}, tidak dapat direduksi. Kelas keadaan: semua keadaan bersifat recurrent

91 6. Percobaan-percobaan dilakukan secara berurutan. Jika dalam dua percobaan terakhir SUKSES, maka peluang SUKSES pada percobaan berikut adalah 0.8. Dalam keadaan YANG LAIN, peluang SUKSES adalah 0.5. Hitung peluang percobaan sukses untuk jangka panjang.

92 Keadaan-keadaan: 0 (SS) : kemarin S sekarang S 1 (SG) : kemarin S sekarang G 2 (GS) : kemarin G sekarang S 3 (GG) : kemarin G sekarang G P =

93 Kita peroleh persamaan-persamaan: π 0 = π 0 P 00 + π 1 P 10 + π 2 P 20 + π 3 P 30 = 0.8π π 2 π 1 = π 0 P 01 + π 1 P 11 + π 2 P 21 + π 3 P 31 = 0.2π π 2 π 2 = π 0 P 02 + π 1 P 12 + π 2 P 22 + π 3 P 32 = 0.5π π 3 π 3 = π 0 P 03 + π 1 P 13 + π 2 P 23 + π 3 P 33 = 0.5π π 3 dan π 0 + π 1 + π 2 + π 3 = 1

94 Diperoleh: π 0 = π 1 = π 2 = π 3 = Jadi, peluang SUKSES jangka panjang adalah π 0 + π 1 = 32 50

95 7. Menurut Kemeny, Snell, dan Thompson, tanah Australia diberkahi dengan banyak hal kecuali cuaca baik. Mereka tidak pernah memiliki dua hari bercuaca baik secara berturut-turut. Jika mereka mendapatkan hari bercuaca baik, maka esok hari akan bersalju atau hujan dengan peluang sama. Jika hari ini mereka mengalami salju atau hujan, maka besok akan bercuaca sama dengan peluang separuhnya. Jika terdapat perubahan cuaca dari salju atau hujan, hanya separuh dari waktu besok akan menjadi bercuaca baik. Tentukan matriks peluang transisi dari yang dibentuk dari keadaan-keadaan di atas.

96 dengan keadaan-keadaan: 0 cuaca hujan 1 cuaca baik 2 cuaca salju P =

97 Ross, Sheldon M Introduction to Probability Models; 9th Edition. New York: Academic Press. Syuhada, Khreshna I.A. Materi Kuliah: MA4181 Pengantar Proses Stokastik. Departemen Matematika ITB, Bandung. Taylor, Howard M. dan Samuel Karlin A First Course in Stochastic Processes; Second Edition. New York: Academic Press. Virtamo, J Queueing Theory/ Probability Theory.

Kalkulus Multivariabel I

Kalkulus Multivariabel I Limit dan Statistika FMIPA Universitas Islam Indonesia Operasi Aljabar pada Pembahasan pada limit untuk fungsi dua peubah adalah memberikan pengertian mengenai lim f (x, y) = L (x,y) (a,b) Masalahnya adalah

Διαβάστε περισσότερα

Konvergen dalam Peluang dan Distribusi

Konvergen dalam Peluang dan Distribusi limiting distribution Andi Kresna Jaya andikresna@yahoo.com Jurusan Matematika July 5, 2014 Outline 1 Review 2 Motivasi 3 Konvergen dalam peluang 4 Konvergen dalam distribusi Back Outline 1 Review 2 Motivasi

Διαβάστε περισσότερα

Kalkulus Multivariabel I

Kalkulus Multivariabel I Fungsi Dua Peubah atau Lebih dan Statistika FMIPA Universitas Islam Indonesia 2015 dengan Dua Peubah Real dengan Dua Peubah Real Pada fungsi satu peubah f : D R R D adalah daerah asal (domain) suatu fungsi

Διαβάστε περισσότερα

Matematika

Matematika Sistem Bilangan Real D3 Analis Kimia FMIPA Universitas Islam Indonesia Sistem Bilangan Real Himpunan: sekumpulan obyek/unsur dengan kriteria/syarat tertentu. 1 Himpunan mahasiswa D3 Analis Kimia angkatan

Διαβάστε περισσότερα

Kalkulus 1. Sistem Koordinat. Atina Ahdika, S.Si, M.Si. Statistika FMIPA Universitas Islam Indonesia. Sistem Koordinat

Kalkulus 1. Sistem Koordinat. Atina Ahdika, S.Si, M.Si. Statistika FMIPA Universitas Islam Indonesia. Sistem Koordinat Kalkulus 1 Atina Ahdika, S.Si, M.Si Statistika FMIPA Universitas Islam Indonesia Sistem koordinat adalah suatu cara/metode untuk menentukan letak suatu titik. Ada beberapa macam sistem koordinat, yaitu:

Διαβάστε περισσότερα

Sebaran Kontinu HAZMIRA YOZZA IZZATI RAHMI HG JURUSAN MATEMATIKA FMIPA UNAND LOGO

Sebaran Kontinu HAZMIRA YOZZA IZZATI RAHMI HG JURUSAN MATEMATIKA FMIPA UNAND LOGO Sebaran Kontinu HAZMIRA YOZZA IZZATI RAHMI HG JURUSAN MATEMATIKA FMIPA UNAND Kompetensi menguraikan ciri-ciri suatu kurva normal menentukan luas daerah dibawah kurva normal menerapkan sebaran normal dalam

Διαβάστε περισσότερα

TINJAUAN PUSTAKA. Sekumpulan bilangan (rasional dan tak-rasional) yang dapat mengukur. bilangan riil (Purcell dan Varberg, 1987).

TINJAUAN PUSTAKA. Sekumpulan bilangan (rasional dan tak-rasional) yang dapat mengukur. bilangan riil (Purcell dan Varberg, 1987). II. TINJAUAN PUSTAKA 2.1 Sistem Bilangan Riil Definisi Bilangan Riil Sekumpulan bilangan (rasional dan tak-rasional) yang dapat mengukur panjang, bersama-sama dengan negatifnya dan nol dinamakan bilangan

Διαβάστε περισσότερα

S T A T I S T I K A OLEH : WIJAYA FAKULTAS PERTANIAN UNIVERSITAS SWADAYA GUNUNG JATI CIREBON

S T A T I S T I K A OLEH : WIJAYA FAKULTAS PERTANIAN UNIVERSITAS SWADAYA GUNUNG JATI CIREBON S T A T I S T I K A OLEH : WIJAYA FAKULTAS PERTANIAN UNIVERSITAS SWADAYA GUNUNG JATI CIREBON 2010 SEBARAN PELUANG II. SEBARAN PELUANG Ruang Contoh (S) adalah Himpunan semua kemungkinan hasil suatu percobaan.

Διαβάστε περισσότερα

S T A T I S T I K A OLEH : WIJAYA FAKULTAS PERTANIAN UNIVERSITAS SWADAYA GUNUNG JATI CIREBON

S T A T I S T I K A OLEH : WIJAYA FAKULTAS PERTANIAN UNIVERSITAS SWADAYA GUNUNG JATI CIREBON S T A T I S T I K A OLEH : WIJAYA FAKULTAS PERTANIAN UNIVERSITAS SWADAYA GUNUNG JATI CIREBON 2011 SEBARAN PELUANG II. SEBARAN PELUANG Ruang Contoh (S) adalah Himpunan semua kemungkinan hasil suatu percobaan.

Διαβάστε περισσότερα

Transformasi Koordinat 2 Dimensi

Transformasi Koordinat 2 Dimensi Transformasi Koordinat 2 Dimensi RG141227 - Sistem Koordinat dan Transformasi Semester Gasal 2016/2017 Ira M Anjasmara PhD Jurusan Teknik Geomatika Sistem Koordinat 2 Dimensi Digunakan untuk mempresentasikan

Διαβάστε περισσότερα

Persamaan Diferensial Parsial

Persamaan Diferensial Parsial Persamaan Diferensial Parsial Turunan Parsial f (, ) Jika berubah ubah sedangkan tetap, adalah fungsi dari dan turunanna terhadap adalah f (, ) f (, ) f (, ) lim 0 disebut turunan parsialpertama dari f

Διαβάστε περισσότερα

Bilangan Euler(e) Rukmono Budi Utomo Pengampu: Prof. Taufiq Hidayat. March 5, 2016

Bilangan Euler(e) Rukmono Budi Utomo Pengampu: Prof. Taufiq Hidayat. March 5, 2016 Bilangan Euler(e) Rukmono Budi Utomo 30115301 Pengampu: Prof. Taufiq Hidayat March 5, 2016 Asal Usul Bilangan Euler e 1 1. Bilangan Euler 2 3 4 Asal Usul Bilangan Euler e Bilangan Euler atau e = 2, 7182818284...

Διαβάστε περισσότερα

ANALISIS LITAR ELEKTRIK OBJEKTIF AM

ANALISIS LITAR ELEKTRIK OBJEKTIF AM ANALSS LTA ELEKTK ANALSS LTA ELEKTK OBJEKTF AM Unit Memahami konsep-konsep asas Litar Sesiri, Litar Selari, Litar Gabungan dan Hukum Kirchoff. OBJEKTF KHUSUS Di akhir unit ini anda dapat : Menerangkan

Διαβάστε περισσότερα

Perubahan dalam kuantiti diminta bagi barang itu bergerak disepanjang keluk permintaan itu.

Perubahan dalam kuantiti diminta bagi barang itu bergerak disepanjang keluk permintaan itu. BAB 3 : ISI RUMAH SEBAGAI PENGGUNA SPM2004/A/S3 (a) Rajah tersebut menunjukkan keluk permintaan yang mencerun ke bawah dari kiri ke kanan. Ia menunjukkan hubungan negatif antara harga dengan kuantiti diminta.

Διαβάστε περισσότερα

Klasifikasi bagi Kumpulan-Dua dengan Dua Penjana yang Mempunyai Kelas Nilpoten Dua

Klasifikasi bagi Kumpulan-Dua dengan Dua Penjana yang Mempunyai Kelas Nilpoten Dua Matematika, 1999, Jilid 15, bil. 1, hlm. 37 43 c Jabatan Matematik, UTM. Klasifikasi bagi Kumpulan-Dua dengan Dua Penjana yang Mempunyai Kelas Nilpoten Dua Nor Haniza Sarmin Jabatan Matematik, Fakulti

Διαβάστε περισσότερα

SMK SERI MUARA, BAGAN DATOH, PERAK. PEPERIKSAAN PERCUBAAN SPM. MATEMATIK TAMBAHAN TINGKATAN 5 KERTAS 1 Dua jam JUMLAH

SMK SERI MUARA, BAGAN DATOH, PERAK. PEPERIKSAAN PERCUBAAN SPM. MATEMATIK TAMBAHAN TINGKATAN 5 KERTAS 1 Dua jam JUMLAH 72/1 NAMA :. TINGKATAN : MATEMATIK TAMBAHAN Kertas 1 September 201 2 Jam SMK SERI MUARA, 6100 BAGAN DATOH, PERAK. PEPERIKSAAN PERCUBAAN SPM MATEMATIK TAMBAHAN TINGKATAN 5 KERTAS 1 Dua jam JANGAN BUKA KERTAS

Διαβάστε περισσότερα

ANALISIS KORELASI DEBIT BANJIR RENCANA UNTUK BERBAGAI KONDISI KETERSEDIAAN DATA DI DAERAH KHUSUS IBUKOTA JAKARTA ABSTRAK

ANALISIS KORELASI DEBIT BANJIR RENCANA UNTUK BERBAGAI KONDISI KETERSEDIAAN DATA DI DAERAH KHUSUS IBUKOTA JAKARTA ABSTRAK ANALISIS KORELASI DEBIT BANJIR RENCANA UNTUK BERBAGAI KONDISI KETERSEDIAAN DATA DI DAERAH KHUSUS IBUKOTA JAKARTA Agung M Alamsyah NRP : 9521037 NIRM : 41077011950298 Pembimbing : Dr. Ir. Agung Bagiawan

Διαβάστε περισσότερα

PERENCANAAN JALAN ALTERNATIF & PERKERASAN LENTUR TANJUNG SERDANG KOTABARU,KALIMANTAN SELATAN KM KM 7+000

PERENCANAAN JALAN ALTERNATIF & PERKERASAN LENTUR TANJUNG SERDANG KOTABARU,KALIMANTAN SELATAN KM KM 7+000 PERENCANAAN JALAN ALTERNATIF & PERKERASAN LENTUR TANJUNG SERDANG KOTABARU,KALIMANTAN SELATAN KM 4+000 KM 7+000 LATAR BELAKANG TUJUAN DAN BATASAN MASALAH METODOLOGI PERENCANAAN HASIL Semakin meningkatnya

Διαβάστε περισσότερα

DAFTAR LAMPIRAN. Lampiran 2. Penetapan derajat infeksi mikoriza arbuskular

DAFTAR LAMPIRAN. Lampiran 2. Penetapan derajat infeksi mikoriza arbuskular DAFTAR LAMPIRAN Lampiran 1. Data analisis awal tanah Jenis Analisis Satuan Nilai Kriteria ph H 2 O - 4,56 Masam C-Organik % 1,75 Rendah N-Total % 0,22 Sedang C/N Ratio - 7,95 Rendah P-tersedia (ppm) ppm

Διαβάστε περισσότερα

Unit PENGENALAN KEPADA LITAR ELEKTRIK OBJEKTIF AM OBJEKTIF KHUSUS

Unit PENGENALAN KEPADA LITAR ELEKTRIK OBJEKTIF AM OBJEKTIF KHUSUS PENGENALAN KEPADA LITAR ELEKTRIK OBJEKTIF AM Memahami konsep-konsep asas litar elektrik, arus, voltan, rintangan, kuasa dan tenaga elektrik. Unit OBJEKTIF KHUSUS Di akhir unit ini anda dapat : Mentakrifkan

Διαβάστε περισσότερα

TOPIK 1 : KUANTITI DAN UNIT ASAS

TOPIK 1 : KUANTITI DAN UNIT ASAS 1.1 KUANTITI DAN UNIT ASAS Fizik adalah berdasarkan kuantiti-kuantiti yang disebut kuantiti fizik. Secara am suatu kuantiti fizik ialah kuantiti yang boleh diukur. Untuk mengukur kuantiti fizik, suatu

Διαβάστε περισσότερα

SULIT 3472/2 SMK SERI MUARA, BAGAN DATOH, PERAK. PEPERIKSAAN PERCUBAAN SPM MATEMATIK TAMBAHAN TINGKATAN 5 KERTAS 2. Dua jam tiga puluh minit

SULIT 3472/2 SMK SERI MUARA, BAGAN DATOH, PERAK. PEPERIKSAAN PERCUBAAN SPM MATEMATIK TAMBAHAN TINGKATAN 5 KERTAS 2. Dua jam tiga puluh minit MATEMATIK TAMBAHAN Kertas 2 September 2013 2½ Jam SMK SERI MUARA, 36100 BAGAN DATOH, PERAK. PEPERIKSAAN PERCUBAAN SPM MATEMATIK TAMBAHAN TINGKATAN 5 KERTAS 2 Dua jam tiga puluh minit JANGAN BUKA KERTAS

Διαβάστε περισσότερα

HMT 221 FONETIK DAN FONOLOGI BAHASA MALAYSIA

HMT 221 FONETIK DAN FONOLOGI BAHASA MALAYSIA UNIVERSITI SAINS MALAYSIA Peperiksaan Semester Kedua Sidang Akademik 2006/2007 April 2007 HMT 221 FONETIK DAN FONOLOGI BAHASA MALAYSIA Masa : 3 jam Sila pastikan bahawa kertas peperiksaan ini mengandungi

Διαβάστε περισσότερα

Pelajaran 9. Persamaan Bernoulli. Setelah selesai mempelajari Pelajaran ini anda sepatutnya dapat

Pelajaran 9. Persamaan Bernoulli. Setelah selesai mempelajari Pelajaran ini anda sepatutnya dapat Pelajaran 9 Persamaan Bernoulli OBJEKTIF Setelah selesai memelajari Pelajaran ini anda seatutnya daat Mentakrifkan konse kadar aliran jisim Mentakrifkan konse kadar aliran Menerangkan konse halaju urata

Διαβάστε περισσότερα

LITAR ARUS ULANG ALIK (AU)

LITAR ARUS ULANG ALIK (AU) TA AUS UANG AK (AU) TA AUS UANG AK (AU) OBJEKTF AM Memahami litar asas arus Ulang alik dan litar sesiri yang mengandungi, dan. Unit OBJEKTF KHUSUS Di akhir unit ini anda dapat : Menjelaskan bahawa dalam

Διαβάστε περισσότερα

LATIHAN. PENYUSUN: MOHD. ZUBIL BAHAK Sign. : FAKULTI KEJURUTERAAN MEKANIKAL UNIVERSITI TEKNOLOGI MALAYSIA SKUDAI JOHOR

LATIHAN. PENYUSUN: MOHD. ZUBIL BAHAK Sign. : FAKULTI KEJURUTERAAN MEKANIKAL UNIVERSITI TEKNOLOGI MALAYSIA SKUDAI JOHOR 1. a) Nyatakan dengan jelas Prinsip Archimedes tentang keapungan. b) Nyatakan tiga (3) syarat keseimbangan STABIL jasad terapung. c) Sebuah silinder bergaris pusat 15 cm dan tinggi 50 cm diperbuat daripada

Διαβάστε περισσότερα

Institut Pendidikan Guru, Kampus Tuanku Bainun, Bukit Mertajam, Pulau Pinang. Diterima untuk diterbitkan pada: 1 April 2012

Institut Pendidikan Guru, Kampus Tuanku Bainun, Bukit Mertajam, Pulau Pinang. Diterima untuk diterbitkan pada: 1 April 2012 41 PERBANDINGAN KAEDAH MENGGUNAKAN KAD PERMAINAN DAN BUKU BESAR BAGI MENINGKATKAN PENCAPAIAN MURID TAHUN 4 DALAM TOPIK PENYESUAIAN TUMBUHAN TERHADAP CUACA MELAMPAU 1 Lim Carol Amir Hamzah Sharaai 1 Institut

Διαβάστε περισσότερα

TOPIK 2 : MENGGAMBARKAN OBJEK

TOPIK 2 : MENGGAMBARKAN OBJEK 2.1 SIMETRI Definisi paksi simetri : Satu garis lipatan pada suatu bentuk geometri supaya bentuk itu dapat bertindih tepat apabila dilipat. Sesuatu bentuk geometri mungkin mempunyai lebih daripada satu

Διαβάστε περισσότερα

Katakunci : faktor, minat, matematik

Katakunci : faktor, minat, matematik Faktor-Faktor Yang Mempengaruhi Minat Terhadap Matematik Di Kalangan Pelajar Sekolah Menengah Johari Bin Hassan & Norsuriani Binti Ab Aziz Fakulti Pendidikan Universiti Teknologi Malaysia Abstrak : Matematik

Διαβάστε περισσότερα

Amalan Pengajaran Guru Pelatih UTM Dalam Pendidikan Sains Aziz Nordin & Md.Norakmal Bin Abdul Latip Fakulti Pendidikan Universiti Teknologi Malaysia

Amalan Pengajaran Guru Pelatih UTM Dalam Pendidikan Sains Aziz Nordin & Md.Norakmal Bin Abdul Latip Fakulti Pendidikan Universiti Teknologi Malaysia Amalan Pengajaran Guru Pelatih UTM Dalam Pendidikan Sains Aziz Nordin & Md.Norakmal Bin Abdul Latip Fakulti Pendidikan Universiti Teknologi Malaysia Abstrak : Kajian ini dijalankan untuk meninjau maklumat

Διαβάστε περισσότερα

EPPD1023: Makroekonomi Kuliah 1: Pengenalan Kepada Makroekonomi

EPPD1023: Makroekonomi Kuliah 1: Pengenalan Kepada Makroekonomi EPPD1023: Makroekonomi Kuliah 1: Pengenalan Kepada Makroekonomi - Pengenalan - Skop Kajian Makroekonomi - Contoh Analisis Makroekonomi - Objektif Kajian Makroekonomi - Pembolehubah Makroekonomi - Dasar

Διαβάστε περισσότερα

UNIT 5 PENUKAR AU-AT (PENERUS)

UNIT 5 PENUKAR AU-AT (PENERUS) PENUKAR AU-AT (PENERUS) E4140/UNIT 5/1 UNIT 5 PENUKAR AU-AT (PENERUS) OBJEKTIF Objektif am : Mengenali dan memahami jenis-jenis litar penukaran penukar AU-AT (Penerus) Objektif khusus : Di akhir unit ini

Διαβάστε περισσότερα

L A M P I R A N. Universitas Sumatera Utara

L A M P I R A N. Universitas Sumatera Utara L A M P I R A N LAMPIRAN I PENILAIAN POSTUR KERJA AKTUAL Postur Kerja Memindahkan Biscuit ke Mesin Timbang Manual Tabel A Tabel B Bagian Tubuh Skor Bagian Tubuh Skor Lengan Atas 1 Batang Tubuh 2 Lengan

Διαβάστε περισσότερα

DAFTAR ISI. BAB I PENDAHULUAN Latar Belakang Rumusan Masalah Tujuan Batasan Masalah dan Ruang Lingkup...

DAFTAR ISI. BAB I PENDAHULUAN Latar Belakang Rumusan Masalah Tujuan Batasan Masalah dan Ruang Lingkup... DAFTAR ISI Halaman HALAMAN JUDUL... i LEMBAR PENGESAHAN... ii KATA PENGANTAR... iii ABSTRAK... v DAFTAR ISI... vi DAFTAR NOTASI... ix DAFTAR TABEL... x DAFTAR GAMBAR... xii DAFTAR LAMPIRAN... xiv BAB I

Διαβάστε περισσότερα

Pemerihalan Data. Pemerihalan Data. Sukatan kecenderungan memusat. Pengenalan. Min. Min 1/14/2011

Pemerihalan Data. Pemerihalan Data. Sukatan kecenderungan memusat. Pengenalan. Min. Min 1/14/2011 Pemerihalan Data Pemerihalan Data PM DR KMISH OSMN Sukatan kecenderungan memusat Sukatan kedudukan Sukatan serakan Sukatan serakan relatif Ukuran korelasi G603 1 G603 Pengenalan Mengeluarkan maklumat daripada

Διαβάστε περισσότερα

BAB 9 PENENTUAN KEDUDUKAN

BAB 9 PENENTUAN KEDUDUKAN Pengenalan BAB 9 PENENTUAN KEDUDUKAN Penentuan Kedudukan Tujuan Penentuan Kedudukan Titik persilangan antara 2 garis Mendapatkan kedudukan bot atau titik di mana kedalaman akan diambil Stn 3 Stn 1 Stn

Διαβάστε περισσότερα

DAFTAR ISI. Halaman Judul Pengesahan Persetujuan Persembahan Abstrak Abstact Kata Pengantar

DAFTAR ISI. Halaman Judul Pengesahan Persetujuan Persembahan Abstrak Abstact Kata Pengantar DAFTAR ISI Halaman Judul i Pengesahan ii Persetujuan iii Persembahan iv Abstrak v Abstact vi Kata Pengantar vii Daftar Isi viii Daftar Tabel xi Daftar Gambar xii Daftar Lampiran xiii Notasi dan Singkatan

Διαβάστε περισσότερα

Panduan Pengguna User manual

Panduan Pengguna User manual Panduan Pengguna User manual Sistem Penjadualan Sekolah School Scheduling System (dengan keupayaan Jadual Waktu secara online) Copyright 2013 Dr. Ng Kok Fu Isu Compatibility Jika anda menghadapi masalah

Διαβάστε περισσότερα

BAB 1 PENGENALAN. 1.1 Pendahuluan

BAB 1 PENGENALAN. 1.1 Pendahuluan BAB 1 PENGENALAN 1.1 Pendahuluan Menurut Webster s New Collegiate Dictionary (1981): " Oseanografi merupakan suatu ilmu yang berhubungan dengan maritim yang merangkumi pelbagai aspek seperti luas, kedalaman,

Διαβάστε περισσότερα

BAB 8 PENENTUAN KEDALAMAN

BAB 8 PENENTUAN KEDALAMAN Pengenalan BAB 8 PENENTUAN KEDALAMAN Proses penentuan kedalaman/penentudalaman perlulah dijalankan dengan seberapa tepat yang boleh kerana jika berlaku kesilapan, ianya akan memberikan gambaran yang salah

Διαβάστε περισσότερα

Katakunci : salam, pelajar Islam

Katakunci : salam, pelajar Islam Amalan Memberi Salam Dikalangan Pelajar Islam Tahun 4, Fakulti Pendidikan, Universiti Teknologi Malaysia, Skudai, Johor Nasir Bin Ripin & Harpah Binti Bohri Fakulti Pendidikan, Universiti Teknologi Malaysia.

Διαβάστε περισσότερα

Katakunci : pelajar Islam, isu penukaran agama

Katakunci : pelajar Islam, isu penukaran agama Persepsi Pelajar Islam Fakulti Pendidikan Terhadap Isu Penukaran Agama (Murtad) Aminuddin Ruskam Al-Dawamy & Masrinah Maslih Fakulti Pendidikan, Universiti Teknologi Malaysia Abstrak : Kajian ini dilakukan

Διαβάστε περισσότερα

Ekonomi (944) Gred A A B+ B B C+ C C D+ D F Peratusan

Ekonomi (944) Gred A A B+ B B C+ C C D+ D F Peratusan Ekonomi (944) PRESTASI KESELURUHAN Pada tahun ini, bilangan calon yang mengambil mata pelajaran ini ialah 16 501 orang calon. Peratusan calon yang lulus penuh ialah 59.19%, iaitu meningkat sebanyak 3.94%

Διαβάστε περισσότερα

BAB 4 ANALISIS DATA DAN PERBINCANGAN. Seramai 100 orang responden telah dipilih secara rawak dalam kajian ini.

BAB 4 ANALISIS DATA DAN PERBINCANGAN. Seramai 100 orang responden telah dipilih secara rawak dalam kajian ini. BAB 4 ANALISIS DATA DAN PERBINCANGAN 4.1 Maklumat Demografi Responden Seramai 100 orang responden telah dipilih secara rawak dalam kajian ini. Antaranya terdiri daripada 50 orang lelaki dan 50 orang perempuan

Διαβάστε περισσότερα

Katakunci : persepsi pelajar, makanan berlogo halal

Katakunci : persepsi pelajar, makanan berlogo halal Persepsi Pelajar Fakulti Pendidikan Terhadap Makanan Berlogo Halal Abdul Basit Samat@Darawi & Sahilah Mohd Rodzi Fakulti Pendidikan, Universiti Teknologi Malaysia Abstrak : Kajian ini dilakukan bagi mengetahui

Διαβάστε περισσότερα

BAB EMPAT SISTEM FONETIK DAN FONOLOGI BAHASA MALAYSIA

BAB EMPAT SISTEM FONETIK DAN FONOLOGI BAHASA MALAYSIA BAB EMPAT SISTEM FONETIK DAN FONOLOGI BAHASA MALAYSIA 4.0 PENDAHULUAN Yunus Maris dalam bukunya The Malay Sound System (1980) telah menyenaraikan 9 bunyi vokal BM yang terdiri daripada 6 fonem vokal standard

Διαβάστε περισσότερα

FAKULTI PENDIDIKAN BAHASA PROGRAM PENSISWAZAHAN GURU SEMESTER MEI / 2012 HBML1203 PENGENALAN FONETIK DAN FONOLOGI BAHASA MELAYU

FAKULTI PENDIDIKAN BAHASA PROGRAM PENSISWAZAHAN GURU SEMESTER MEI / 2012 HBML1203 PENGENALAN FONETIK DAN FONOLOGI BAHASA MELAYU FAKULTI PENDIDIKAN BAHASA PROGRAM PENSISWAZAHAN GURU SEMESTER MEI / 2012 HBML1203 PENGENALAN FONETIK DAN FONOLOGI BAHASA MELAYU NO. MATRIK : 780206125731002 NAMA : HERMAN BIN HASSAN NO. KAD PENGENALAN

Διαβάστε περισσότερα

Katakunci : persepsi pelajar, Pendidikan Islam

Katakunci : persepsi pelajar, Pendidikan Islam Persepsi Pelajar Sekolah Agama Terhadap Mata Pelajaran Pendidikan Islam : Kajian Di Sekolah Menengah Al-Amin Gombak, Selangor Othman Bin Napiah & Munada Binti Mohamad Rodi Fakulti Pendidikan Universiti

Διαβάστε περισσότερα

Katakunci : proses pengajaran dan pembeljaran, sekolah Bandar, sekolah luar Bandar.

Katakunci : proses pengajaran dan pembeljaran, sekolah Bandar, sekolah luar Bandar. Perbandingan Faktor Faktor Yang Mempengaruhi Proses Pengajaran Dan Pembelajaran Antara Sekolah Di Bandar Dan Luar Bandar Shahrin Bin Hashim & Herdy Bin Bailun Fakulti Pendidikan, Universiti Teknologi Malaysia.

Διαβάστε περισσότερα

Perbandingan ayat per ayat antara TR/KJV dengan ITB/CT

Perbandingan ayat per ayat antara TR/KJV dengan ITB/CT Lukas Pasal 11 TR / KJV ITB/CT Perbedaan Catatan/komentar Ayat 1 1 And it came to pass, that, as he was praying in a certain place, when he 1 Pada suatu kali Yesus sedang berdoa di salah satu tempat. Ketika

Διαβάστε περισσότερα

BAB 1 PENDAHULUAN. 1.1 Pengenalan

BAB 1 PENDAHULUAN. 1.1 Pengenalan BAB 1 PENDAHULUAN 1.1 Pengenalan Ekonomi adalah satu bidang ilmu sains sosial yang mengkaji tentang individu dan masyarakat dalam membuat pilihan yang cekap bagi menggunakan sumber ekonomi yang terhad

Διαβάστε περισσότερα

KAITAN FAKTOR PENYUMBANG DENGAN KECEMERLANGAN AKADEMIK PELAJAR ASRAMA HARIAN

KAITAN FAKTOR PENYUMBANG DENGAN KECEMERLANGAN AKADEMIK PELAJAR ASRAMA HARIAN KAITAN FAKTOR PENYUMBANG DENGAN KECEMERLANGAN AKADEMIK PELAJAR ASRAMA HARIAN Nuremelia Binti Mohamad Rawan dan Tn Hj Meor Ibrahim Bin Kamaruddin Fakulti Pendidikan Universiti Teknologi Malaysia ABSTRAK

Διαβάστε περισσότερα

Khotbah Jum at CATATAN. Vol. II, Nomor 3 16 Hijrah/Mei Pemimpin Redaksi & Penanggung Jawab: Ahmad Supardi

Khotbah Jum at CATATAN. Vol. II, Nomor 3 16 Hijrah/Mei Pemimpin Redaksi & Penanggung Jawab: Ahmad Supardi CATATAN Khotbah Jum at Vol. II, Nomor 3 16 Hijrah/Mei 2008 Diterbitkan oleh Sekretariat Pengurus Besar Jemaat Ahmadiyah Indonesia Badan Hukum Penetapan Menteri Kehakiman RI No. JA/5/23/13 tgl. 13 Maret

Διαβάστε περισσότερα

PENDEKATAN ISTIHALAH DALAM PRODUK YANG BERUNSURKAN BABI

PENDEKATAN ISTIHALAH DALAM PRODUK YANG BERUNSURKAN BABI PENDEKATAN ISTIHALAH DALAM PRODUK YANG BERUNSURKAN BABI Oleh: Dr Saadan Man Jabatan Fiqh & Usul, Akademi Pengajian Islam Universiti Malaya 1. Pengenalan Kepesatan pembangunan teknologi dalam dunia moden

Διαβάστε περισσότερα

Katakunci : amalan solat sunat, pelajar tahun akhir SPI

Katakunci : amalan solat sunat, pelajar tahun akhir SPI Amalan Solat Sunat Di Kalangan Pelajar Tahun Akhir SPI. Satu Kajian Di Universiti Teknologi Malaysia Ramli Awang & Rosmaziah Abdul Kadir @ Ismail Fakulti Pendidikan, Universiti Teknologi Malaysia Abstrak

Διαβάστε περισσότερα

BAB 5 RINGKASAN, IMPLIKASI DAN KESIMPULAN. Bab ini akan merumuskan dapatan penting daripada analisis kajian dan seterusnya

BAB 5 RINGKASAN, IMPLIKASI DAN KESIMPULAN. Bab ini akan merumuskan dapatan penting daripada analisis kajian dan seterusnya BAB 5 RINGKASAN, IMPLIKASI DAN KESIMPULAN 5.1 Pengenalan Bab ini akan merumuskan dapatan penting daripada analisis kajian dan seterusnya perbincangan melewati aspek implikasi kajian serta lontaran cadangan

Διαβάστε περισσότερα

FIZIK. Daya dan Gerakan TINGKATAN 4. Cikgu Khairul Anuar. Cikgu Desikan SMK Changkat Beruas, Perak. Bab 2. SMK Seri Mahkota, Kuantan.

FIZIK. Daya dan Gerakan TINGKATAN 4. Cikgu Khairul Anuar. Cikgu Desikan SMK Changkat Beruas, Perak. Bab 2. SMK Seri Mahkota, Kuantan. FIZIK TINGKATAN 4 Bab 2 Daya dan Gerakan Disunting oleh Cikgu Desikan SMK Changkat Beruas, Perak Cikgu Khairul Anuar Dengan kolaborasi bersama SMK Seri Mahkota, Kuantan FIZIK TINGKATAN 4 2016 Bab 2 Daya

Διαβάστε περισσότερα

eprosiding Seminar Fiqh Semasa (SeFis) 2015 eisbn:

eprosiding Seminar Fiqh Semasa (SeFis) 2015 eisbn: PENERIMAAN MASYARAKAT TERHADAP SKIM GADAIAN ISLAM DI KOTA BHARU KELANTAN Fathi Syakirin Hassan, Sanep Ahmad & Hairunnizam Wahab Abstrak Kewujudan skim gadaian Islam (Ar-Rahnu) di Malaysia telah mendapat

Διαβάστε περισσότερα

BAB 2 KONSEP ASAS KUALITI

BAB 2 KONSEP ASAS KUALITI BAB 2 KONSEP ASAS KUALITI DEFINISI KUALITI KUALITI: Merupakan sifat/ciri-ciri produk atau perkhidmatan yang boleh menyumbangkan kepada kepuasan /kehendak pengguna. Menurut ANSI/ASQC- Kualiti merupakan

Διαβάστε περισσότερα

ASAS PENGUKURAN -FIZIK- SULAIMAN REJAB Penolong Pegawai Sains Pusat Asasi Sains, Universiti Malaya

ASAS PENGUKURAN -FIZIK- SULAIMAN REJAB Penolong Pegawai Sains Pusat Asasi Sains, Universiti Malaya ASAS PENGUKURAN -FIZIK- SULAIMAN REJAB Penolong Pegawai Sains Pusat Asasi Sains, Universiti Malaya NHB_Jun2014 1 Objektif: Adalah diharapkan diakhir kursus ini peserta akan : 1. Mengenal pasti alat-alat

Διαβάστε περισσότερα

Bab 3. Kajian Persepsi Masyarakat terhadap Keperluan Ilmu Faraid dalam Kurikulum Pendidikan Islam KBSM

Bab 3. Kajian Persepsi Masyarakat terhadap Keperluan Ilmu Faraid dalam Kurikulum Pendidikan Islam KBSM Bab 3 Kajian Persepsi Masyarakat terhadap Keperluan Ilmu Faraid dalam Kurikulum Pendidikan Islam KBSM Noor Lizza Mohamed Said, Zulquarnain bin Ali, Md Yazid Ahmad & Ahmad Muhammad Husni Ilmu faraid atau

Διαβάστε περισσότερα

BAB TIGA METODOLOGI KAJIAN. terperinci tentang reka bentuk kajian, populasi dan sampel kajian, tempat kajian, tata

BAB TIGA METODOLOGI KAJIAN. terperinci tentang reka bentuk kajian, populasi dan sampel kajian, tempat kajian, tata BAB TIGA METODOLOGI KAJIAN 3. Pengenalan Tumpuan utama bab ini adalah untuk membincangkan dan menghurai secara terperinci tentang reka bentuk kajian, populasi dan sampel kajian, tempat kajian, tata cara

Διαβάστε περισσότερα

DAFTAR ISI. Halaman. HALAMAN JUDUL... i LEMBAR PENGESAHAN... LEMBAR PERSETUJUAN... iii. KATA PENGANTAR... iv. ABSTRAK... vi. DAFTAR ISI...

DAFTAR ISI. Halaman. HALAMAN JUDUL... i LEMBAR PENGESAHAN... LEMBAR PERSETUJUAN... iii. KATA PENGANTAR... iv. ABSTRAK... vi. DAFTAR ISI... DAFTAR ISI Halaman HALAMAN JUDUL... i LEMBAR PENGESAHAN...... ii LEMBAR PERSETUJUAN...... iii KATA PENGANTAR... iv ABSTRAK... vi DAFTAR ISI... vii DAFTAR TABEL... x DAFTAR GAMBAR... xi DAFTAR LAMPIRAN...

Διαβάστε περισσότερα

PENGERTIAN VOKAL: Vokal ialah bunyi-bunyi bersuara, dan apabila membunyikannya udara daripada paru-paru keluar melalui rongga mulut tanpa sekatan dan

PENGERTIAN VOKAL: Vokal ialah bunyi-bunyi bersuara, dan apabila membunyikannya udara daripada paru-paru keluar melalui rongga mulut tanpa sekatan dan PENGERTIAN VOKAL: Vokal ialah bunyi-bunyi bersuara, dan apabila membunyikannya udara daripada paru-paru keluar melalui rongga mulut tanpa sekatan dan gangguan. Bunyi-bunyi vokal mempunyai ciriciri kelantangan

Διαβάστε περισσότερα

Katakunci : peranan pengurusan kolej kediaman, pembangunan pembelajaran pelajar

Katakunci : peranan pengurusan kolej kediaman, pembangunan pembelajaran pelajar Penilaian Terhadap Peranan Pihak Pengurusan Kolej Kediaman Dalam Mempertingkatkan Pembangunan Pembelajaran Pelajar : Tinjauan Di Lima Buah Kolej Kediaman Di Universiti Teknologi Malaysia Lokman Bin. Mohd

Διαβάστε περισσότερα

Lukisan Bergambar. Lukisan Skematik 2.1 NAMA, SIMBOL DAN FUNGSI KOMPONEN ELEKTRONIK

Lukisan Bergambar. Lukisan Skematik 2.1 NAMA, SIMBOL DAN FUNGSI KOMPONEN ELEKTRONIK 2.1 NAMA, SIMBOL DAN FUNGSI KOMPONEN ELEKTRONIK Satu litar elektronik dikenali juga sebagai sistem. Satu sistem elektronik terdiri daripada beberapa komponen. Setiap komponen elektronik mempunyai fungsinya

Διαβάστε περισσότερα

2. Penyelesaian Masalah & Pengenalan Kepada Pengaturcaraan

2. Penyelesaian Masalah & Pengenalan Kepada Pengaturcaraan 2. Penyelesaian Masalah & Pengenalan Kepada Pengaturcaraan 2.0 Penyelesaian masalah dgn komputer 10 Dari Bab 1 : Komputer boleh menyelesaikan masalah tertentu jika diberi arahan dgn menulis aturcara. Pengaturcaraan

Διαβάστε περισσότερα

Prasyarat Kejayaan HAKARAH ISLAMIYYAH

Prasyarat Kejayaan HAKARAH ISLAMIYYAH Abul A la Al Maududi Prasyarat Kejayaan HAKARAH ISLAMIYYAH Siri Tarbiyyah KONSIS Media DAFTAR KANDUNGAN PRASYARAT KEJAYAAN HARAKAH ISLAMIYAH BAB PERTAMA Pra-syarat kejayaan harakah Islamiyyah 4 BAB KEDUA

Διαβάστε περισσότερα

E513 : TEKNIK ELEKTRONIK BAB 1 : 13

E513 : TEKNIK ELEKTRONIK BAB 1 : 13 E513 : TEKNIK ELEKTRONIK BAB 1 : 13 BAB 1 ( Bahagian 2) TAJUK : PENGKELASAN LITAR BERSEPADU OBJEKTIF Di akhir topik ini pelajar akan dapat : a. Mengklasifikasikan Litar Bersepadu berdasarkan kaedah pembikinan,

Διαβάστε περισσότερα

SIMBOL FONOLOGI. Vokal Konsonan Diftong Konsonan gandingan SIMBOL FONETIK BAHASA MELAYU.

SIMBOL FONOLOGI. Vokal Konsonan Diftong Konsonan gandingan SIMBOL FONETIK BAHASA MELAYU. SIMBOL FONETIK BAHASA MELAYU. Sistem ejaan bertujuan untuk mewakili bunyi yang digunakan oleh penutur sesuatu bahasa. Untuk mencapai tujuan tersebut, berikut disenaraikan bunyi dalam bahasa bahasa Melayu

Διαβάστε περισσότερα

PENGABAIAN TANGGUNGJAWAB SUAMI TERHADAP HAK ISTERI DI KALANGAN ORANG-ORANG MELAYU. Azhar Muhammad Kamarul Azmi Jasmi

PENGABAIAN TANGGUNGJAWAB SUAMI TERHADAP HAK ISTERI DI KALANGAN ORANG-ORANG MELAYU. Azhar Muhammad Kamarul Azmi Jasmi PENGABAIAN TANGGUNGJAWAB SUAMI TERHADAP HAK ISTERI DI KALANGAN ORANG-ORANG MELAYU Azhar Muhammad Kamarul Azmi Jasmi Pusat Pengajian Islam dan Pembangunan social, Universiti Teknologi Malaysia Skudai Johor

Διαβάστε περισσότερα

Laman Web Rasmi Lembaga Hasil Dalam Negeri Malaysia Agensi Di Bawah Kementerian Kewangan Bersama Membangun Negara

Laman Web Rasmi Lembaga Hasil Dalam Negeri Malaysia Agensi Di Bawah Kementerian Kewangan Bersama Membangun Negara Ahad. 25 Sept, 2011 Cari Help A++ A+ A English Laman Web Rasmi Lembaga Hasil Dalam Negeri Malaysia Agensi Di Bawah Kementerian Kewangan Bersama Membangun Negara Laman Utama Profil Korporat Borang Perkhidmatan

Διαβάστε περισσότερα

KAJIAN KE ATAS KEUPAYAAN GOLONGAN BERPENDAPATAN SEDERHANA DALAM MEMILIKI RUMAH DI KAWASAN JOHOR BAHRU. VOT UPP: 71693

KAJIAN KE ATAS KEUPAYAAN GOLONGAN BERPENDAPATAN SEDERHANA DALAM MEMILIKI RUMAH DI KAWASAN JOHOR BAHRU. VOT UPP: 71693 KAJIAN KE ATAS KEUPAYAAN GOLONGAN BERPEAPATAN SEDERHANA DALAM MEMILIKI RUMAH DI KAWASAN JOHOR BAHRU. VOT UPP: 71693 ROSADAH BT. MAHAMUD KHADIJAH BT. HUSSEIN FAKULTI KEJURUTERAAN DAN SAINS GEOINFORMASI

Διαβάστε περισσότερα

FAKULTI PENDIDIKAN DAN BAHASA SEMESTER MEI / 2012 HBML1203SMP FONETIK DAN FONOLOGI BAHASA MELAYU(SMP)

FAKULTI PENDIDIKAN DAN BAHASA SEMESTER MEI / 2012 HBML1203SMP FONETIK DAN FONOLOGI BAHASA MELAYU(SMP) SMP FONETIK DAN FONOLOGI BAHASA MELAYU Zainun Salleh (720315115394) FAKULTI PENDIDIKAN DAN BAHASA SEMESTER MEI / 2012 SMP FONETIK DAN FONOLOGI BAHASA MELAYU(SMP) NO. MATRIKULASI : 720315115394001 NO. KAD

Διαβάστε περισσότερα

Pembunuhan Rahmah. Mukadimah

Pembunuhan Rahmah. Mukadimah Pembunuhan Rahmah Mukadimah Alhamdulillah, saya bersyukur kepada Allah atas segala kurniaan Nya dan nikmat yang tidak terhingga. Selawat dan salam ke atas junjungan Nabi SAW, keluarga, para sahabat serta

Διαβάστε περισσότερα

Potensi dan Cabaran Terhadap Perluasan Sumber Zakat Sektor Pertanian. Sanep Ahmad Hairunnizam Wahid

Potensi dan Cabaran Terhadap Perluasan Sumber Zakat Sektor Pertanian. Sanep Ahmad Hairunnizam Wahid Potensi dan Cabaran Terhadap Perluasan Sumber Zakat Sektor Pertanian Sanep Ahmad Hairunnizam Wahid Kumpulan Kajian Ekonomi & Kewangan Islam Pusat Pengajian Ekonomi, UKM ABSTRAK Dalam sektor pertanian,

Διαβάστε περισσότερα

BAB I PENDAHULUAN. Di Indonesia, terdapat beberapa sistem berkenaan hukum pusaka iaitu Hukum

BAB I PENDAHULUAN. Di Indonesia, terdapat beberapa sistem berkenaan hukum pusaka iaitu Hukum BAB I PENDAHULUAN 1.1 Latar Belakang Masalah Kajian Di Indonesia, terdapat beberapa sistem berkenaan hukum pusaka iaitu Hukum Pusaka Adat, Hukum Pusaka Berdasarkan Kitab Undang-undang Hukum Perdata (KUHP),

Διαβάστε περισσότερα

STATIK BENDALIR: TEKANAN. Setelah selesai mengikuti pelajaran ini anda seharusnya dapat. Mentakrif dan membuktikan hukum Pascal tentang tekanan.

STATIK BENDALIR: TEKANAN. Setelah selesai mengikuti pelajaran ini anda seharusnya dapat. Mentakrif dan membuktikan hukum Pascal tentang tekanan. Statik Bendalir: Tekanan 8 Pelajaran STATIK BENDALIR: TEKANAN OBJEKTIF PELAJARAN Setelah selesai mengikuti elajaran ini anda seharusnya daat Mentakrif dan membuktikan hukum Pascal tentang tekanan. Membuktikan

Διαβάστε περισσότερα

LAMPIRAN 1. Hasil Observasi dan Wawancara Pedagang Siomay di Semarang

LAMPIRAN 1. Hasil Observasi dan Wawancara Pedagang Siomay di Semarang LAMPIRAN 1. Hasil Observasi dan Wawancara Pedagang Siomay di Semarang Pertanyaan : 1. Berapa jam Anda berjualan dalam sehari? 2. Bagaimana cara membuat kubis gulung yang digunakan sebagai pelengkap siomay?

Διαβάστε περισσότερα

MATEMATIK TINGKATAN 2

MATEMATIK TINGKATAN 2 Kurikulum Bersepadu Sekolah Menengah SPESIFIKASI KURIKULUM MATEMATIK Bahagian Pembangunan Kurikulum Kementerian Pelajaran Malaysia 2011 Buku Spesifikasi Kurikulum Matematik Tingkatan 2 ini ialah terjemahan

Διαβάστε περισσότερα

FALKULTI PENDIDIKAN DALAM PENDIDIKAN MEI 2012 HBML 1203 FONETIK DAN FONOLOGI BAHASA MELAYU

FALKULTI PENDIDIKAN DALAM PENDIDIKAN MEI 2012 HBML 1203 FONETIK DAN FONOLOGI BAHASA MELAYU FALKULTI PENDIDIKAN DALAM PENDIDIKAN MEI 2012 HBML 1203 FONETIK DAN FONOLOGI BAHASA MELAYU NO. MATRIKULASI : 810713125386001 NO. KAD PENGNEALAN : 810713125386 NO. TELEFON : 0128101102 E-MEL : kongchuilee@yahoo.com

Διαβάστε περισσότερα

Kesediaan Pensyarah Terhadap Perlaksanaan Pembelajaran Sepanjang Hayat Melalui Kursus Jangka Pendek Di Kolej Komuniti

Kesediaan Pensyarah Terhadap Perlaksanaan Pembelajaran Sepanjang Hayat Melalui Kursus Jangka Pendek Di Kolej Komuniti Kesediaan Pensyarah Terhadap Perlaksanaan Pembelajaran Sepanjang Hayat Melalui Kursus Jangka Pendek Di Kolej Komuniti Mohd Nor bin Ihkasan mdnorihk@uthm.edu.my Nurshahida Bt Md Ab Patah shahida_2587@yahoo.com.my

Διαβάστε περισσότερα

Mana gereja Christian sebenar hari ini?

Mana gereja Christian sebenar hari ini? Mana gereja Christian sebenar hari ini? 18 bukti, petunjuk, dan tanda-tanda untuk mengenal pasti benar vs gereja Kristian yang palsu. campur 7 bukti-bukti, petunjuk, dan tanda-tanda untuk membantu mengenal

Διαβάστε περισσότερα

FAKULTI PENDIDIKAN DAN BAHASA SARJANA MUDA PENDIDIKAN (SEKOLAH RENDAH) DENGAN KEPUJIAN SEMESTER / TAHUN LIMA / 2012

FAKULTI PENDIDIKAN DAN BAHASA SARJANA MUDA PENDIDIKAN (SEKOLAH RENDAH) DENGAN KEPUJIAN SEMESTER / TAHUN LIMA / 2012 FAKULTI PENDIDIKAN DAN BAHASA SARJANA MUDA PENDIDIKAN (SEKOLAH RENDAH) DENGAN KEPUJIAN SEMESTER / TAHUN LIMA / 2012 HBML 1203 FONETIK DAN FONOLOGI BAHASA MELAYU NO. MATRIK : 730820065120001 NO. KAD PENGENALAN

Διαβάστε περισσότερα

PENGENALAN. 2. Memahami bahawa sebuah robot adalah merupakan salah satu unsur dalam satu sistem automasi.

PENGENALAN. 2. Memahami bahawa sebuah robot adalah merupakan salah satu unsur dalam satu sistem automasi. JT609 / BAB 1 / 1 BAB 1 PENGENALAN OBJEKTIF OBJEKTIF AM : Di akhir bab ini pelajar akan dapat: 1. Mengatahuii istilah dan terminologi dalam sistem robot 2. Memahami bahawa sebuah robot adalah merupakan

Διαβάστε περισσότερα

BIOKIMIA PROTEIN & ASID AMINO

BIOKIMIA PROTEIN & ASID AMINO BIOKIMIA PROTEIN & ASID AMINO OBJEKTIF PEMBELAJARAN Di akhir kuliah ini, pelajar-pelajar dapat: 1. Mengenalpasti struktur asas asid amino beserta sifatnya. 2. Mengkelaskan asid amino kepada jenis-jenisnya.

Διαβάστε περισσότερα

KERTAS KERJA INDIVIDU TAJUK : AL-QURAN SEBAGAI SUMBER KEPADA SISTEM PENDIDIKAN ISLAM PROGRAM SARJANA PENDIDIKAN

KERTAS KERJA INDIVIDU TAJUK : AL-QURAN SEBAGAI SUMBER KEPADA SISTEM PENDIDIKAN ISLAM PROGRAM SARJANA PENDIDIKAN KERTAS KERJA INDIVIDU TAJUK : AL-QURAN SEBAGAI SUMBER KEPADA SISTEM PENDIDIKAN ISLAM PROGRAM SARJANA PENDIDIKAN KURSUS GC6423 SUMBER-SUMBER PENDIDIKAN ISLAM PENSYARAH DR. AB. HALIM BIN TAMURI DISEDIAKAN

Διαβάστε περισσότερα

ALIRAN BOLEH MAMPAT SATU DIMENSI

ALIRAN BOLEH MAMPAT SATU DIMENSI Bab 3 ALIRAN BOLEH MAMPAT SATU DIMENSI 3.1 Bendalir Tak Boleh Mampat dan Boleh Mampat Bendalir tak boleh mampat tidak wujud dalam praktis. Sebutan ini sebenarnya digunakan untuk merujuk kepada bendalir

Διαβάστε περισσότερα

BAB I PENGENALAN. 1.1 Pendahuluan

BAB I PENGENALAN. 1.1 Pendahuluan BAB I PENGENALAN 1.1 Pendahuluan 1Malaysia adalah satu gagasan bagi memupuk perpaduan dalam kalangan rakyat Malaysia yang berbilang kaum berteraskan nilai-nilai penting yang menjadi amalan setiap rakyat

Διαβάστε περισσότερα

7 Unit UKUR TERABAS TIODOLIT UNIT 7 OBJEKTIF AM OBJEKTIF KHUSUS

7 Unit UKUR TERABAS TIODOLIT UNIT 7 OBJEKTIF AM OBJEKTIF KHUSUS UKUR TERABAS TIODOLIT C1005/UNIT 7/1 UNIT 7 UKUR TERABAS TIODOLIT OBJEKTIF AM Memahami dan mengetahui proses pengukuran terabas tiodolit, pengiraan koordinit dan keluasan serta pemelotannya. 7 Unit OBJEKTIF

Διαβάστε περισσότερα

KAJIAN PENGANGKUTAN BANDAR BARU BANGI (BBB)

KAJIAN PENGANGKUTAN BANDAR BARU BANGI (BBB) KERAJAAN MALAYSIA JABATAN PERANCANG JALAN KEMENTERIAN KERJA RAYA KAJIAN PENGANGKUTAN BANDAR BARU BANGI (BBB) DRAF LAPORAN AKHIR Disediakan oleh, 1 SAMUDERA CONSULTING ENGINEER SAMUDERA CONSULTING ENGINEER

Διαβάστε περισσότερα

KOMPONEN ELEKTRIK (PASIF) KOMPONEN ELEKTRIK (PASIF)

KOMPONEN ELEKTRIK (PASIF) KOMPONEN ELEKTRIK (PASIF) E1001 / UNIT 2/ 1 UNIT 2 KOMPONEN ELEKTRIK (PASIF) OBJEKTIF Objektif am : Mempelajari dan memahami konsep asas bagi komponenkomponen elektrik (pasif) seperti perintang, pearuh dan pemuat. Objektif khusus

Διαβάστε περισσότερα

Lampiran 1. Urutan basa dari 4 primer SSR. Nama Primer Sekuen (5 3 )

Lampiran 1. Urutan basa dari 4 primer SSR. Nama Primer Sekuen (5 3 ) 45 Lampiran 1. Urutan basa dari 4 primer SSR Nama Primer Sekuen (5 3 ) 1 FR 0783 2 FR 0779 3 FR 3663 4 FR 3745 F: 5 - GAATGTGGCTGTAAATGCTGAGTG -3 R: 5 - AAGCCGCATGGACAACTCTAGTAA -3 F: 5 - AATGCAGACCAAGCTAATCATATAC

Διαβάστε περισσότερα

Muhasabah Diri Sempena Hijrah

Muhasabah Diri Sempena Hijrah Muhasabah Diri Sempena Hijrah (Edisi ke 2) Terbitan Jamiyah Singapura 1 2 KANDUNGAN Mukadimah 5 Kemuliaan Muharam 7 Bulan Mulia Lagi Dihormati 7 Rasulullah Diizinkan Hijrah Ke Madinah 8 Nabi Berhijrah

Διαβάστε περισσότερα

SENIBINA KAPAL (HIDROSTATIK DAN KESTABILAN KAPAL) Dr. Omar bin Yaakob

SENIBINA KAPAL (HIDROSTATIK DAN KESTABILAN KAPAL) Dr. Omar bin Yaakob SENIBINA KAPAL (HIDROSTATIK DAN KESTABILAN KAPAL) Dr. Omar bin Yaakob Pendahuluan 2 Pendahuluan Pengenalan Senibina kapal ialah salah satu bidang kejuruteraan yang meliputi teknologi rekabentuk kapal atau

Διαβάστε περισσότερα

Keberkahan البركة. Penyusun : Amin Abdullah Asyaqawy. Terjemah : Muzaffar Syahidu. Editor : Eko Haryanto Abu Ziyad

Keberkahan البركة. Penyusun : Amin Abdullah Asyaqawy. Terjemah : Muzaffar Syahidu. Editor : Eko Haryanto Abu Ziyad Keberkahan البركة ] إندونيسي Indonesian [ Indonesia Penyusun : Amin Abdullah Asyaqawy Terjemah : Muzaffar Syahidu Editor : Eko Haryanto Abu Ziyad 2009 1430 البركة» باللغة الا ندونيسية «تا ليف : أمين عبد

Διαβάστε περισσότερα

ISLAM DAN KEBUDAYAAN MELAYU DI ERA GLOBALISASI DI MALAYSIA

ISLAM DAN KEBUDAYAAN MELAYU DI ERA GLOBALISASI DI MALAYSIA ISLAM DAN KEBUDAYAAN MELAYU DI ERA GLOBALISASI DI MALAYSIA Baharuddin bin H. Puteh dan Mohamad Nazli bin H. Omar Kolej Universiti Islam Melaka E-mail: dr_baharudin@yahoo.com Abstrak: Sejarah telah menunjukkan

Διαβάστε περισσότερα

KAEDAH PENGAJARAN TILAWAH DAN HAFAZAN AL-QURAN. Oleh : Mohd Zainul Arifien bin Mohd Jaid (Fakulti Pendidikan UKM)

KAEDAH PENGAJARAN TILAWAH DAN HAFAZAN AL-QURAN. Oleh : Mohd Zainul Arifien bin Mohd Jaid (Fakulti Pendidikan UKM) 1 KAEDAH PENGAJARAN TILAWAH DAN HAFAZAN AL-QURAN Oleh : Mohd Zainul Arifien bin Mohd Jaid (Fakulti Pendidikan UKM) Pendahuluan Kepentingan al-quran al-karim dalam kehidupan umat Islam tidak dapat dinafikan.

Διαβάστε περισσότερα

Method Pemikiran Hassan Al-Banna

Method Pemikiran Hassan Al-Banna Dr Jumaah Amin Method Pemikiran Hassan Al-Banna Antara tetap dan berubah Siri Tarbiyyah Kandungan Sepatah kata Penerbit 1. Pendahuluan Syeikh Muhammad Abdullah al-khatib 2. Muqadimah Penulis Jum ah Amin

Διαβάστε περισσότερα

Perkembangan Sistem Ejaan Rumi Bahasa Melayu

Perkembangan Sistem Ejaan Rumi Bahasa Melayu Topik7 Sistem Perkembangan Sistem Ejaan Rumi Bahasa Melayu HASIL PEMBELAJARAN Pada akhir topik ini, anda seharusnya dapat: 1. Memperihalkan perkembangan sistem tulisan Jawi bahasa Melayu; dan 2. Menghuraikan

Διαβάστε περισσότερα