Διαστρωμάτωση Κινδύνου στην Υπερτροφική Μυοκαρδιοπάθεια (ΥΜΚ) Γεώργιος Κ Ευθυμιάδης

Save this PDF as:
 WORD  PNG  TXT  JPG

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download "Διαστρωμάτωση Κινδύνου στην Υπερτροφική Μυοκαρδιοπάθεια (ΥΜΚ) Γεώργιος Κ Ευθυμιάδης"

Transcript

1 Διαστρωμάτωση Κινδύνου στην Υπερτροφική Μυοκαρδιοπάθεια (ΥΜΚ) Γεώργιος Κ Ευθυμιάδης

2 ΥΜΚ: Ανεξήγητη υπερτροφία της αριστερής κοιλίας

3

4 HCM phenotypes

5 Hypertrophic Cardiomyopathy HCM Landmarks Maron BJ et al. J Am Coll Cardiol 2012;60:705 15

6 histology

7

8 Λήψη ατομικού ιστορικού Υπάρχει, ιδίως μετά από κόπωσηː δύσπνοια, πόνος στο στήθος, αίσθημα παλμών, απώλεια συνειδήσεως Υπάρχει ιατρική αναφορά για φύσημα, παθολογικό ΗΚΓ, αρρυθμίες ή εγκεφαλικό επεισόδιο Υπάρχει αποκλεισμός από τον στρατό ή την άθληση για ιατρικούς λόγους

9 Λήψη οικογενειακού ιστορικού (3 Γενεές) Αιφνίδιος θάνατος Μυοκαρδιοπάθεια

10 Γιατί προσέρχεται για έλεγχο ο ασθενής 1. Εμφάνιση συμπτωμάτων (Δύσπνοια, στηθάγχη, αίσθημα παλμών) 2. Εμφάνιση συμβαμάτων (συγκοπή, εγκεφαλικό επεισόδιο, κολπική μαρμαρυγή) 3. Διερεύνηση φυσήματος ή παθολογικού ΗΚΓ σε προληπτικό έλεγχο 4. Ύπαρξη οικογενειακού ιστορικού ΥΜΚ 5. Αιφνίδιος θάνατος στην οικογένεια σε μικρή ηλικία

11 Οικογενειακό δένδρο

12 Κλινική εξέταση Τραχύ συστολικό φύσημα εξωθήσεως μεταξύ κορυφής και αριστερού χείλους στέρνου Ολοσυστολικό φύσημα κορυφής Αύξηση της έντασης σε όρθια θέση, μετά έκτακτη κοιλιακή συστολή, valsalva

13 Παρακλινικες εξετασεις ΗΚΓ ΥΠΕΡΗΧΟ 24-ωρη ΗΚΓ καταγραφή Καρδιοαναπνευστική δοκιμασία κόπωσης Μαγνητική τομογραφία καρδιάς

14 ΗΚΓ Παθολογικό στο 90% κύματα q, πτώση ST, αρνητικά Τ, LVH

15 υπερηχογράφημα

16 υπερηχογράφημα

17 υπερηχογράφημα

18

19 Υπερτροφική Μυοκαρδιοπάθεια

20

21

22

23

24 Απόφραξη χώρου εξόδου ΑΚ

25

26 Apical 5-chamber long-axis view at rest showing mitral valve at end diastole (SAM was absent in systole) (A) with normal continuous-wave Doppler velocity through the LV outflow tract (C) Maron, M. S. et al. Circulation 2006;114: Copyright 2006 American Heart Association

27 Prevalence of LV outflow tract obstruction in the overall study group of 320 HCM patients Maron, M. S. et al. Circulation 2006;114: Copyright 2006 American Heart Association

28 Holter Monitoring: NSVT

29 Cardiopulmonary stress test: Blood pressure response

30 Cardiopulmonary stress test: VO2 max

31 Μαγνητική τομογραφία καρδιάς

32 Figure 3. Diverse patterns of LV hypertrophy encountered in HCM shown in CMR short-axis images at end diastole. Rickers C et al. Circulation 2005;112: Copyright American Heart Association

33 Figure 2. Diagnostic images from 13-year-old identical twin with nonobstructive HCM. Two-dimensional stop-frame echocardiogram (A) and comparative CMR (B) images acquired in short-axis plane in end diastole at mitral valve level, and 12-lead ECG (C). Rickers C et al. Circulation 2005;112: Copyright American Heart Association

34 Apical variants of HCM are also better identified by CMR. J C C Moon, N G Fisher, W J McKenna, D J Pennell Heart 2004;90:

35 ΓΕΝΕΤΙΚΗ Οικογενής μορφή : 55% Μεταβίβαση κατά τον αυτοσωματικό επικρατούντα χαρακτήρα

36

37

38 Types of mutations Missense (δυσυνθετικές) 90% Single amino acid substitution Frame shift (αλλαγή αναγνωστικού πλαισίου) Deletions/Insertions of nucleic acids Shortened truncated proteins Pathogenic mutations, severe disease MYBPC gene

39 B-Myosin Heavy Chain Gene EXON 23 codon 403 AATGCATGCTTGAGTCTGAC:MHC gene...tac...mutant gene. Gln.b-MHC protein Arg403Gln

40 Clinical Applications of Genetic Testing Prevalence of HCM Genes in Probands Maron BJ, J Am Coll Cardiol. 2012;60(8):

41 Εκτίμηση κινδύνου αιφνιδίου θανάτου

42 ΥΠΕΡΤΡΟΦΙΚΗ ΜΥΟΚΑΡΔΙΟΠΑΘΕΙΑ φυσική ιστορία Ασυμπτωματική δια βίου Στηθάγχη, Δύσπνοια, Συγκοπή ΑΕΕ, Κολπική μαρμαρυγή (30%) Ενδοκαρδίτιδα (0.3%) Εξέλιξη προς διατατική μυοκαρδιοπάθεια (8%) Φυσιολογικό προσδώκιμο επιβίωσης (75%) Αιφνίδιος θάνατος (<1%)

43 Figure 1. Contemporary Insights and Strategies for Risk Stratification and Prevention of Sudden Death in Hypertrophic Cardiomyopathy. Maron, Barry Circulation. 121(3): , January 26, DOI: /CIRCULATIONAHA Figure 1. SD and age in HCM. Top, SD is most common before [almost equal to]25 years of age, whereas heart failure and stroke generally occur later in life. From Maron et al.11 Used with permission from the American Heart Association, copyright (C) Bottom, Single most frequent cause of SD in young competitive athletes in the United States. ARVC indicates arrhythmogenic right ventricular cardiomyopathy; AS, aortic valve stenosis; CHD, congenital heart disease; LAD, left anterior descending; MVP, mitral valve prolapse; and WPW, Wolff-Parkinson-White. *Regarded as possible (but not definitive) evidence for HCM at autopsy with mildly increased LV wall thickness and heart weight (447+/-76 g). +Includes Kawasaki disease, sickle cell trait, and sarcoid American Heart Association, Inc. Published by American Heart Association. 2

44 Μηχανισμοί ΑΚΘ στην ΥΜΚ Barry J. Maron BJ, et. al Efficacy of Implantable Cardioverter Defibrillators for the Prevention of Sudden Death in Patients with Hypertrophic Cardiomyopathy. N Engl J Med 2000; 342: In all 21 patients with stored electrographic data and appropriate interventions, the interventions were triggered by ventricular tachycardia or fibrillation.

45 Αιφνίδιος θάνατος στην ΥΜΚ < 1% ανά έτος Σε επιλεγμένη ομάδα ασθενών (15-20%) 4-6% ανά έτος

46 Αιφνίδιος θάνατος στην ΥΜΚ επιδημιολογία Μπορεί να είναι η πρώτη εκδήλωση της νόσου Συχνά σε ασυμπτωματικά ή ελάχιστα συμπτωματικά νέα άτομα Συμβαίνει σε -ήπια/έντονη άσκηση (>50%) -συνηθισμένες δραστηριότητες -στον ύπνο Κύριο αίτιο θανάτου σε άτομα <35 ετών και σε αθλητές

47

48 Major Risk Factors for SD in HCM Prior aborted cardiac arrest and spontaneous sustained ventricular tachycardia 7-year mortality rate of 33% 5-year SCD or ICD discharge rate of 41% Cecchi F. J Am Coll Cardiol 1989;13: Elliott PM. J Am Coll Cardiol 1999;33:

49 Clinical Markers of SD in HCM Family history of premature SD Unexplained syncope (<6 months) Huge hypertrophy (> 30 mm) Non-sustained VT (especially <30-y) Abnormal blood pressure response on exercise (<40-y)

50

51 Cardiovasc Ultrasound. 2009; 7: 37.

52 O'Mahony C, Tome-Esteban M, Lambiase PD, Pantazis A Dickie S, McKenna WJ, Elliott PM. Heart Jan 22 Median f/u 6.6 years SCD/appropriate ICD shock per/year 20/660 pts (3%): 0 RF (0.45%) 31/636 pts (4.8%): 1 RF (0.65%) 27/249 pts (10.8%):2 RF (1.3%) 7 /51 pts (13.7%): 3 RF (1.9%) 4/10 pts (40%): 4 RF (5.0%)

53 Figure 9. Contemporary Insights and Strategies for Risk Stratification and Prevention of Sudden Death in Hypertrophic Cardiomyopathy. Maron, Barry Circulation. 121(3): , January 26, DOI: /CIRCULATIONAHA Figure 9. Number of risk factors. Top, Appropriate ICD intervention rates (per 100 person-years) are not significantly different with respect to 1, 2, or >=3 risk factors. Center, Cumulative rates for first appropriate device intervention in patients with 1, 2, or >=3 risk factors. Reprinted from Maron et al.8 Used with permission from the American Medical Association, copyright (C) Bottom, ICD intervention rates in those patients with only 1 risk factor. LVH indicates LV hypertrophy; NSVT, nonsustained VT American Heart Association, Inc. Published by American Heart Association. 2

54 Possible Risk Factors for SD in HCM Atrial fibrillation Myocardial ischaemia Dilated phase Restrictive physiology Multiple mutations (3-5% ) LV outflow obstruction Mid LV obstruction Apical aneurysm LGAD enhancement

55 Atrial fibrillation in HCM

56 From: Dilated-Hypokinetic Evolution of Hypertrophic Cardiomyopathy: Title and subtitle BreakPrevalence, Incidence, Risk Factors, and Prognostic Implications in Pediatric and Adult Patients J Am Coll Cardiol. 2005;46(8): doi: /j.jacc Figure Legend: A representative example of evolution to dilated-hypokinetic hypertrophic cardiomyopathy (HCM) in a female pediatric patient. (A) The basal echocardiogram (at age 13 years) shows HCM with massive left ventricular (LV) hypertrophy involving the intraventricular septum and the left posterior wall, accompanied by diminutive LV cavity size. (B) Three years later (at age 16 years), the LV cavity has become enlarged and the walls have thinned in the context of severe heart failure, requiring heart transplantation. Date of download: 10/16/2012 Copyright The American College of Cardiology. All rights reserved.

57 Figure 4. Evolution to ES in a male HCM patient (patient 26), shown at end diastole in parasternal long-axis (A and C) and short-axis (B and D) echocardiographic crosssectional planes. Harris K M et al. Circulation 2006;114: Copyright American Heart Association

58 Μυοκαρδιακή ισχαιμία

59 Role of genetics in prognosis

60

61 Mid-ventricular hypertrophy

62 Mid-LV obstruction

63

64 Efthimiadis G et.al. Prevalence and Natural History of Mid-Ventricular Obstructive HCM, in press

65 Importance of hypertrophy pattern in sudden death risk stratification among patients suffering from hypertrophic cardiomyopathy. E Pagourelias, GK. Efthimiadis, DG. Parcharidou, TD. Gossios, H. Karvounis, IH. Styliadis. (presented in ESC congress, Munchen 2012)

66 Probability of Sudden Death among 224 Patients with a Left Ventricular Ouflow Tract Gradient of at Least 30 mm Hg and 770 Patients without Obstruction Maron M et al. N Engl J Med 2003;348:

67 Kaplan Meier estimates of the proportions of patients surviving from sudden cardiac death, appropriate ICD discharge, or resuscitated ventricular fibrillation in relation to LVOTO. Elliott P M et al. Eur Heart J 2006;27: The European Society of Cardiology All rights reserved. For Permissions, please

68 Efthimiadis GK, Parcharidou DG, Giannakoulas G, Pagourelias ED, Charalampidis P, Savvopoulos G, Ziakas A, Karvounis H, Styliadis IH, Parcharidis GE. Left ventricular outflow tract obstruction as a risk factor for sudden cardiac death in hypertrophi cardiomyopathy. Am J Cardiol Sep 1;104(5):695-9.

69 Apical aneurysm

70 Apical aneurysms

71 HCM with apical aneurysms 2% 40% <=50 years of age. 70% mid-lv obstruction 30% apical HCM myocardial scarring (late gadolinium enhancement) recognized by echocardiography in 60% By MRI in 100% Maron MS, et al. Circulation 2008;118:

72 Flow diagram summarizing the clinical course of 28 HCM patients with LV apical aneurysms Maron, M. S. et al. Circulation 2008;118: Copyright 2008 American Heart Association

73 LGAD in risk stratification process

74 LGAD)enhancement Efthimiadis GK, et al. Hypertrophic cardiomyopathy involving the right ventricular apex Can J Cardiol. 2007; 23(14): 1162.

75 Prevalence of LGAD enhancement in 87/403pts with HCM (AHEPA registry, unpublished data)

76 Correlation of %LGAD and Syncope (AHEPA registry, unpublished data)

77 Correlation of %LGAD and Max. thickness 30 mm (AHEPA registry, unpublished data)

78 Correlation of %LGAD and prevalence of NSVT (AHEPA registry, unpublished data)

79 Correlation of % LGAD and Risk Factors for SCD (AHEPA registry, unpublished data) Late Gadolinium Enhancement (%) p value Family history (SCD) Yes No Syncope Yes No Max wall thickness >30mm Yes No NSVT Yes No ABPR Yes No 13.5 (9.5) 9.48 (12.1) 17.1 (10.4) 8.7 (11.5) (5.7) 9.5 (12) 13.4 (8.54) 9.6 (12.14) 12.1 (13.4) 9.15 (10.7)

80

81

82 Indications for ICDs in HCM. *SCD risk modifiers include established risk factors and emerging risk modifiers (Section 9.4.2). Writing Committee Members et al. Circulation 2011;124: Copyright American Heart Association

83 ICD implantation in 37 pts with HCM for primary prevention (AHEPA Hospital) Appropriate ICD intervention in 10 out of 37 (27.02%) primary prevention patients Cumulative probability of ICD intervention at five years was 29.2% ( 7.4%) First appropriate intervention rate was 7.18% per year (95% CI: )

84 Προοπτικές Έναρξη θεραπείας στο προκλινικό στάδιο της νόσου Genotype (+)/Phenotype (-) A-MEA, AT-inhibitors, spironolactone, diltiazem, b-blockers

85 Prevalence of late gadolinium enhancement in 87/403pts with HCM (AHEPA registry, unpublished data)

86 Combined Midventricular and LVOT obstruction (50%)

87

88

89 Female 70-y with mid-lv obstruction

90 Figure 3. Contemporary Insights and Strategies for Risk Stratification and Prevention of Sudden Death in Hypertrophic Cardiomyopathy. Maron, Barry Circulation. 121(3): , January 26, DOI: /CIRCULATIONAHA Figure 3. Prevention of SD. Top, Intracardiac electrogram obtained at 1:20 am in a patient while asleep 5 years after implantation. From 35-year-old man with HCM who received prophylactic ICD because of family history of SD and marked ventricular septal thickness (31 mm). A, VT begins abruptly at 200 bpm. B, Defibrillator senses VT and charges. C, VT deteriorates into VF, and defibrillator issues 20-J shock (D; arrow), restoring sinus rhythm. Virtually identical sequence occurred 9 years later during sleep; the patient is now 53 years of age and asymptomatic. Reprinted from Maron et al.7 Copyright (C) 2000 Massachusetts Medical Society. All rights reserved. Bottom, Flow diagram summarizing ICD-related outcome in 506 high-risk HCM patients from an international multicenter ICD registry American Heart Association, Inc. Published by American Heart Association. 2

91 Apical 5-chamber long-axis view at rest showing mitral valve at end diastole (SAM was absent in systole) (A) with normal continuous-wave Doppler velocity through the LV outflow tract (C) Maron, M. S. et al. Circulation 2006;114: Copyright 2006 American Heart Association

92

93 Perspectives AIM: reversal or prevention of hypertrophy and fibrosis experimental therapies: beneficial small clinical trials in overt HCM: no benefit beneficial effect when applied in the preclinical phase? ongoing trial : diltiazem in preventing phenotypes, in preclinical HCM

94

95

Συγκοπτικά επεισόδια καρδιαγγειακής αιτιολογίας: διαγνωστική προσπέλαση

Συγκοπτικά επεισόδια καρδιαγγειακής αιτιολογίας: διαγνωστική προσπέλαση There are no translations available. Γιώργος Κολιός Καρδιολόγος Οι ασθενείς με συγκοπή αποτελούν το 2% των επισκέψεων στα τμήματα έκτακτων περιστατικών. Η ετήσια επίπτωση συγκοπτικών επεισοδίων στα ηλικιωμένα

Διαβάστε περισσότερα

PRELIMINARY PROGRAMME

PRELIMINARY PROGRAMME 3 rd JOINT GREEK TURKISH CONGRESS PRELIMINARY PROGRAMME ΠΑΡΑΚΔΤΖ 29ΗΟΤΝΗΟΤ 2012 FRIDAY 29 th JUNE 2012 18.00 20.00 Α ηρογγσιόσραπέδη RoundTableA Μσοθαρδηοπάζεηες Cardiomyopathies Πξόεδξνη: Γ. Παρταρίδες,

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΑΓΧΟΣ ΚΑΙ ΚΑΤΑΘΛΙΨΗ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΑΓΧΟΣ ΚΑΙ ΚΑΤΑΘΛΙΨΗ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία ΑΓΧΟΣ ΚΑΙ ΚΑΤΑΘΛΙΨΗ ΜΕΤΑ ΑΠΟ ΜΑΣΤΕΚΤΟΜΗ Ονοματεπώνυμο : Φάραχ Βαλεντίνα Αρ. Φοιτητικής Ταυτότητας : 2008899422 ΚΥΠΡΟΣ- ΛΕΥΚΩΣΙΑ 2012

Διαβάστε περισσότερα

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η θέση ύπνου του βρέφους και η σχέση της με το Σύνδρομο του αιφνίδιου βρεφικού θανάτου. Χρυσάνθη Στυλιανού Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα

Ο ρόλος της μαγνητικής τομογραφίας καρδιάς στον έλεγχο βιωσιμότητας μετά από έμφραγμα μυοκαρδίου: ενδιαφέρον περιστατικό

Ο ρόλος της μαγνητικής τομογραφίας καρδιάς στον έλεγχο βιωσιμότητας μετά από έμφραγμα μυοκαρδίου: ενδιαφέρον περιστατικό ΕΛΛΗΝΙΚΟ ΚΟΛΛΕΓΙΟ ΚΑΡ ΙΟΛΟΓΙΑΣ Επιστημονική Ένωση Καρδιαγγειακής Απεικόνισης Ο ρόλος της μαγνητικής τομογραφίας καρδιάς στον έλεγχο βιωσιμότητας μετά από έμφραγμα μυοκαρδίου: ενδιαφέρον περιστατικό Ιωάννης

Διαβάστε περισσότερα

ΣΚΟΛΙΩΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ

ΣΚΟΛΙΩΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ ΣΚΟΛΙΩΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ 18 ΦΕΒΡΟΥΑΡΙΟΥ 2010 ΘΕΣΣΑΛΟΝΙΚΗ ΜΑΡΙΑ Θ. ΠΑΠΑΦΥΛΑΚΤΟΥ ΩΝΑΣΕΙΟ ΚΑΡΔΙΟΧΕΙΡΟΥΡΓΙΚΟ ΚΕΝΤΡΟ ΕΙΣΑΓΩΓΗ Σκελετικές ανωμαλίες παρατηρούνται συχνά σε ασθενείς με συγγενή καρδιοπάθεια

Διαβάστε περισσότερα

ΣΤΕΝΩΣΗ ΑΟΡΤΗΣ ΜΕ ΧΑΜΗΛΟ ΚΛΑΣΜΑ ΕΞΩΘΗΣΗΣ. Λαζαρίδης Κυριάκος Γενικός Αρχίατρος 417 ΝΙΜΤΣ

ΣΤΕΝΩΣΗ ΑΟΡΤΗΣ ΜΕ ΧΑΜΗΛΟ ΚΛΑΣΜΑ ΕΞΩΘΗΣΗΣ. Λαζαρίδης Κυριάκος Γενικός Αρχίατρος 417 ΝΙΜΤΣ ΣΤΕΝΩΣΗ ΑΟΡΤΗΣ ΜΕ ΧΑΜΗΛΟ ΚΛΑΣΜΑ ΕΞΩΘΗΣΗΣ Λαζαρίδης Κυριάκος Γενικός Αρχίατρος 417 ΝΙΜΤΣ ΕΙΣΑΓΩΓΙΚΕΣ ΠΑΡΑΤΗΡΗΣΕΙΣ Ως βαλβιδική αορτική στένωση ορίζεται η παρεµπόδιση της ροής του αίµατος δια µέσου της αορτικής

Διαβάστε περισσότερα

Αντιπαράθεση στην Υπερτροφική Μυοκαρδιοπάθεια Διάγνωση: Υπερηχοκαρδιογραφία ή Μαγνητική τοµογραφία;

Αντιπαράθεση στην Υπερτροφική Μυοκαρδιοπάθεια Διάγνωση: Υπερηχοκαρδιογραφία ή Μαγνητική τοµογραφία; Αντιπαράθεση στην Υπερτροφική Μυοκαρδιοπάθεια Διάγνωση: Υπερηχοκαρδιογραφία ή Μαγνητική τοµογραφία; ΜΑΡΙΑ Β. ΚΑΛΑΝΤΖΗ ΚΑΡΔΙΟΛΟΓΟΣ IAΣΩ General ΥΠΕΡΤΡΟΦΙΚΗ ΜΥΟΚΑΡΔΙΟΠΑΘΕΙΑ ΓΕΝΙΚΑ Η πιο συχνή γενετική µυοκαρδιοπάθεια

Διαβάστε περισσότερα

4 η Επιστημονική συνάντηση Παιδιάτρων- Καρδιολόγων Θεσσαλονίκη 20-12-2014

4 η Επιστημονική συνάντηση Παιδιάτρων- Καρδιολόγων Θεσσαλονίκη 20-12-2014 4 η Επιστημονική συνάντηση Παιδιάτρων- Καρδιολόγων Θεσσαλονίκη 20-12-2014 Τυχαίο εύρημα καρδιακής αρρυθμίας σε ασυμπτωματικό παιδί Κωνσταντίνος Θωμαϊδης Καρδιολογική Κλινική, Γ.Ν. «ΓΕΩΡΓΙΟΣ ΠΑΠΑΝΙΚΟΛΑΟΥ»

Διαβάστε περισσότερα

Συγκοπή στους αθλητές Κριτική προσέγγιση. Νικόλαος Ι. Γκουζούμας Καρδιολόγος Διδάκτωρ ΑΠΘ Επιμελητής Α ΕΣΥ Γ.Ν.Θ. «Γ.Γεννηματάς»

Συγκοπή στους αθλητές Κριτική προσέγγιση. Νικόλαος Ι. Γκουζούμας Καρδιολόγος Διδάκτωρ ΑΠΘ Επιμελητής Α ΕΣΥ Γ.Ν.Θ. «Γ.Γεννηματάς» Συγκοπή στους αθλητές Κριτική προσέγγιση Νικόλαος Ι. Γκουζούμας Καρδιολόγος Διδάκτωρ ΑΠΘ Επιμελητής Α ΕΣΥ Γ.Ν.Θ. «Γ.Γεννηματάς» Ποιος θεωρείται αθλητής και ποιος όχι Αθλητής είναι όποιος συμμετέχει σε

Διαβάστε περισσότερα

ΣΕΜΙΝΑΡΙΟ ΟΜΑΔΑΣ ΕΡΓΑΣΙΑΣ ΗΛΕΚΤΡΟΦΥΣΙΟΛΟΓΙΑΣ &ΒΗΜΑΤΟΔΟΤΗΣΗΣ ΙΩΑΝΝΙΝΑ 2015 ΕΜΦΥΤΕΥΣΗ ΑΠΙΝΙΔΩΤΗ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΣΥΝΔΡΟΜΟ BRUGADA

ΣΕΜΙΝΑΡΙΟ ΟΜΑΔΑΣ ΕΡΓΑΣΙΑΣ ΗΛΕΚΤΡΟΦΥΣΙΟΛΟΓΙΑΣ &ΒΗΜΑΤΟΔΟΤΗΣΗΣ ΙΩΑΝΝΙΝΑ 2015 ΕΜΦΥΤΕΥΣΗ ΑΠΙΝΙΔΩΤΗ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΣΥΝΔΡΟΜΟ BRUGADA ΣΕΜΙΝΑΡΙΟ ΟΜΑΔΑΣ ΕΡΓΑΣΙΑΣ ΗΛΕΚΤΡΟΦΥΣΙΟΛΟΓΙΑΣ &ΒΗΜΑΤΟΔΟΤΗΣΗΣ ΙΩΑΝΝΙΝΑ 2015 ΕΜΦΥΤΕΥΣΗ ΑΠΙΝΙΔΩΤΗ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΣΥΝΔΡΟΜΟ BRUGADA ΓΙΩΡΓΟΣ ΠΟΥΛΟΣ, MD EΠΙΜΕΛΗΤΗΣ Α ΤΜΗΜΑ ΗΛΕΚΤΡΟΦΥΣΙΟΛΟΓΙΚΩΝ ΜΕΛΕΤΩΝ & ΒΗΜΑΤΟΔΟΤΗΣΗΣ,ΩΚΚ

Διαβάστε περισσότερα

Νόσος στελέχους: Διαδερμική ή χειρουργική αντιμετώπιση

Νόσος στελέχους: Διαδερμική ή χειρουργική αντιμετώπιση Νόσος στελέχους: Διαδερμική ή χειρουργική αντιμετώπιση Λ. Κ. Μιχάλης Καθηγητής Καρδιολογίας Πανεπιστήμιο Ιωαννίνων Πανελλήνιο Καρδιολογικό Συνέδριο Αθήνα, 30 Οκτωβρίου 2008 Από πού αντλούνται οι γνώσεις

Διαβάστε περισσότερα

4 o Συνέδριο Eπεμβατικής καρδιολογίας και Ηλεκτροφυσιολογίας Μέλανη Κωνσταντινίδου Καρδιολόγος - Ηλεκτροφυσιολόγος

4 o Συνέδριο Eπεμβατικής καρδιολογίας και Ηλεκτροφυσιολογίας Μέλανη Κωνσταντινίδου Καρδιολόγος - Ηλεκτροφυσιολόγος Αρρυθμίες στις γυναίκες. Τι ιδιαίτερο; 4 o Συνέδριο Eπεμβατικής καρδιολογίας και Ηλεκτροφυσιολογίας Μέλανη Κωνσταντινίδου Καρδιολόγος - Ηλεκτροφυσιολόγος Karen Yee A recent report of the Euro Heart project

Διαβάστε περισσότερα

Wolff Parkinson White Διαγνωστική προσέγγιση και θεραπεία

Wolff Parkinson White Διαγνωστική προσέγγιση και θεραπεία Wolff Parkinson White Διαγνωστική προσέγγιση και θεραπεία ΔΗΜΗΤΡΙΟΣ ΛΥΣΙΤΣΑΣ, MD, PhD, MRCP Επεμβατικός Hλεκτροφυσιολόγος Κλινική Αγιος Λουκάς Ιατρικό Διαβαλκανικό Κεντρο Honorary Senior EP Fellow Royal

Διαβάστε περισσότερα

Κ.ΚΙΤΣΙΟΣ, Ε.ΓΕΩΡΕΛΗ, Ν.ΚΑΔΟΓΛΟΥ 1, Β.ΣΤΟΥΠΑΣ, Ι.ΑΓΓΕΛΟΠΟΥΛΟΣ, Ν.ΣΑΙΛΕΡ 2, Α.ΔΗΜΗΤΡΙΑΔΗΣ

Κ.ΚΙΤΣΙΟΣ, Ε.ΓΕΩΡΕΛΗ, Ν.ΚΑΔΟΓΛΟΥ 1, Β.ΣΤΟΥΠΑΣ, Ι.ΑΓΓΕΛΟΠΟΥΛΟΣ, Ν.ΣΑΙΛΕΡ 2, Α.ΔΗΜΗΤΡΙΑΔΗΣ 24o ΕΤΗΣΙΟ ΣΥΝΕΔΡΙΟ ΔΙΑΒΗΤΟΛΟΓΙΚΗΣ ΕΤΑΙΡΙΑΣ ΒΟΡΕΙΟΥ ΕΛΛΑΔΑΣ Κ.ΚΙΤΣΙΟΣ, Ε.ΓΕΩΡΕΛΗ, Ν.ΚΑΔΟΓΛΟΥ 1, Β.ΣΤΟΥΠΑΣ, Ι.ΑΓΓΕΛΟΠΟΥΛΟΣ, Ν.ΣΑΙΛΕΡ 2, Α.ΔΗΜΗΤΡΙΑΔΗΣ ΠΑΘΟΛΟΓΙΚΟ ΤΜΗΜΑ, ΓΕΝΙΚΗΣ ΚΛΙΝΙΚΗΣ ΘΕΣΣΑΛΟΝΙΚΗΣ, EUROMEDICA

Διαβάστε περισσότερα

ΣΥΓΚΟΠΗ Ο ΡΟΛΟΣ ΤΟΥ ΗΛΕΚΤΡΟΦΥΣΙΟΛΟΓΙΚΟΥ ΕΛΕΓΧΟΥ ΓΕΩΡΓΙΟΣ Α. ΒΑΣΙΛΟΠΟΥΛΟΣ ΚΑΡ ΙΟΛΟΓΟΣ ΘΕΡΑΠΕΥΤΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΝΟΣΟΚΟΜΕΙΟ ΑΛΕΞΑΝ ΡΑ

ΣΥΓΚΟΠΗ Ο ΡΟΛΟΣ ΤΟΥ ΗΛΕΚΤΡΟΦΥΣΙΟΛΟΓΙΚΟΥ ΕΛΕΓΧΟΥ ΓΕΩΡΓΙΟΣ Α. ΒΑΣΙΛΟΠΟΥΛΟΣ ΚΑΡ ΙΟΛΟΓΟΣ ΘΕΡΑΠΕΥΤΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΝΟΣΟΚΟΜΕΙΟ ΑΛΕΞΑΝ ΡΑ ΣΥΓΚΟΠΗ Ο ΡΟΛΟΣ ΤΟΥ ΗΛΕΚΤΡΟΦΥΣΙΟΛΟΓΙΚΟΥ ΕΛΕΓΧΟΥ ΓΕΩΡΓΙΟΣ Α. ΒΑΣΙΛΟΠΟΥΛΟΣ ΚΑΡ ΙΟΛΟΓΟΣ ΘΕΡΑΠΕΥΤΙΚΗ ΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝ ΝΟΣΟΚΟΜΕΙΟ ΑΛΕΞΑΝ ΡΑ ΣΥΓΚΟΠΗ ΟΡΙΣΜΟΣ Syncope is a T-LOC due to transient global

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία ΙΕΡΕΥΝΗΣΗ ΤΩΝ ΕΠΙΠΕ ΩΝ ΘΝΗΣΙΜΟΤΗΤΑΣ ΚΑΙ ΤΩΝ ΚΥΡΙΟΤΕΡΩΝ ΑΙΤΙΩΝ ΠΡΟΚΛΗΣΗΣ ΘΑΝΑΤΟΥ ΑΤΟΜΩΝ ΜΕ ΨΥΧΟΓΕΝΗ ΑΝΟΡΕΞΙΑ Γεωργία Χαραλάµπους Λεµεσός

Διαβάστε περισσότερα

Πως θα αντιµετωπίσω τον ασθενή µε: Μετρίου προς σοβαρού βαθµού ΑΣΥΜΤΩΜΑΤΙΚΗ ανεπάρκεια αορτικής

Πως θα αντιµετωπίσω τον ασθενή µε: Μετρίου προς σοβαρού βαθµού ΑΣΥΜΤΩΜΑΤΙΚΗ ανεπάρκεια αορτικής Πως θα αντιµετωπίσω τον ασθενή µε: Μετρίου προς σοβαρού βαθµού ΑΣΥΜΤΩΜΑΤΙΚΗ ανεπάρκεια αορτικής Παναγοπούλου Βίκυ Καρδιολόγος Επ. Συνεργάτης Νοσοκοµείου Γ. Γεννηµατάς. ΕΠΙΔΗΜΙΟΛΟΓΙΑ ΜέσουέωςσοβαρούβαθμούΑR

Διαβάστε περισσότερα

ΑΞΟΝΙΚΗ ΣΤΕΦΑΝΙΟΓΡΑΦΙΑ

ΑΞΟΝΙΚΗ ΣΤΕΦΑΝΙΟΓΡΑΦΙΑ ΑΞΟΝΙΚΗ ΣΤΕΦΑΝΙΟΓΡΑΦΙΑ ΧΡΙΣΤΟΦΟΡΙΔΟΥ ΤΑΤΙΑΝΑ ακτινολόγος ΚΑΡΑΔΗΜΗΤΡΑΣ ΝΕΚΤΑΡΙΟΣ καρδιολόγος Τι είναι αξονική στεφανιογραφία; Είναι μέθοδος απεικόνισης των στεφανιαίων αγγείων με πολυτομικό αξονικό τομογράφο

Διαβάστε περισσότερα

Καρκίνος ορθού Προεγχειρητική ακτινοθεραπεία. Λουίζα Βίνη Ογκολόγος Ακτινοθεραπεύτρια Τμήμα Ακτινοθεραπείας Ιατρικό Αθηνών

Καρκίνος ορθού Προεγχειρητική ακτινοθεραπεία. Λουίζα Βίνη Ογκολόγος Ακτινοθεραπεύτρια Τμήμα Ακτινοθεραπείας Ιατρικό Αθηνών Καρκίνος ορθού Προεγχειρητική ακτινοθεραπεία Λουίζα Βίνη Ογκολόγος Ακτινοθεραπεύτρια Τμήμα Ακτινοθεραπείας Ιατρικό Αθηνών Prognostic groups in 1676 patients with T3 rectal cancer treated without preoperative

Διαβάστε περισσότερα

Σεμινάρια ομάδων εργασίας

Σεμινάρια ομάδων εργασίας Σεμινάρια ομάδων εργασίας ΙΕΡΕΥΝΗΣΗ ΕΞΙΑΣ ΚΑΡ ΙΑΚΗΣ ΑΝΕΠΑΡΚΕΙΑΣ ΛΟΓΩ ΠΝΕΥΜΟΝΙΚΗΣ ΥΠΕΡΤΑΣΗΣ ΠΑΝΑΓΙΩΤΗΣ ΚΑΡΥΟΦΥΛΛΗΣ ΩΝΑΣΕΙΟ ΚΑΡ ΙΟΧΕΙΡΟΥΡΓΙΚΟ ΚΕΝΤΡΟ Πνευμονική Υπέρταση Πνευμονική Υπέρταση είναι η παθολογική

Διαβάστε περισσότερα

ΦΑΡΜΑΚΕΥΤΙΚΗ ΘΕΡΑΠΕΙΑ ΝΟΣΗΜΑΤΩΝ ΑΝΑΠΝΕΥΣΤΙΚΟΥ ΑΓΓΕΙΟΔΙΑΣΤΑΛΤΙΚΑ

ΦΑΡΜΑΚΕΥΤΙΚΗ ΘΕΡΑΠΕΙΑ ΝΟΣΗΜΑΤΩΝ ΑΝΑΠΝΕΥΣΤΙΚΟΥ ΑΓΓΕΙΟΔΙΑΣΤΑΛΤΙΚΑ ΦΑΡΜΑΚΕΥΤΙΚΗ ΘΕΡΑΠΕΙΑ ΝΟΣΗΜΑΤΩΝ ΑΝΑΠΝΕΥΣΤΙΚΟΥ ΑΓΓΕΙΟΔΙΑΣΤΑΛΤΙΚΑ Γεωργία Γ. Πίτσιου,, MD, PhD Πνευμονολόγος Εντατικολόγος Μονάδα Αναπνευστικής Ανεπάρκειας ΑΠΘ ΑΓΓΕΙΟΔΙΑΣΤΑΛΤΙΚΑ ΚΑΙ ΠΝΕΥΜΟΝΑΣ Ανταγωνιστές

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ ΚΑΠΝΙΣΤΙΚΕΣ ΣΥΝΗΘΕΙΕΣ ΓΟΝΕΩΝ ΚΑΙ ΕΠΙΡΡΟΗ ΤΟΥΣ ΣΤΗΝ ΕΝΑΡΞΗ ΤΟΥ ΚΑΠΝΙΣΜΑΤΟΣ ΣΤΟΥΣ ΕΦΗΒΟΥΣ Ονοματεπώνυμο Φοιτήτριας: Χριστοφόρου Έλενα

Διαβάστε περισσότερα

ΑΘΛΗΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ. Διευθυντής Καρδιολογικό Τμήμα, ΤΖΑΝΕΙΟ Νοσοκομείο Πειραιά

ΑΘΛΗΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ. Διευθυντής Καρδιολογικό Τμήμα, ΤΖΑΝΕΙΟ Νοσοκομείο Πειραιά ΑΘΛΗΣΗ ΚΑΙ ΣΥΓΓΕΝΕΙΣ ΚΑΡΔΙΟΠΑΘΕΙΕΣ Χ. Ντέλλος Διευθυντής Καρδιολογικό Τμήμα, ΤΖΑΝΕΙΟ Νοσοκομείο Πειραιά Υπεύθυνος Παιδοκαρδιολογικού και Συγγενών Καρδιοπαθειών Ενηλίκων Disclosures : No conflicts of interest

Διαβάστε περισσότερα

Γεώργιος Ανδρικόπουλος, Δ/ντής. Καρδιολογικής Κλινικής, ΓΝΑ «Ερρίκος. Ντυνάν»

Γεώργιος Ανδρικόπουλος, Δ/ντής. Καρδιολογικής Κλινικής, ΓΝΑ «Ερρίκος. Ντυνάν» Γεώργιος Ανδρικόπουλος, Δ/ντής Καρδιολογικής Κλινικής, ΓΝΑ «Ερρίκος Ντυνάν» Δήλωση συμφερόντων Ο ομιλητής έχει λάβει ερευνητικά κονδύλια, αμοιβές για συμμετοχή σε συμβουλευτικά σώματα και αμοιβές για ομιλίες

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή εργασία ΕΠΙΠΤΩΣΕΙΣ ΤΗΣ ΚΑΚΗΣ ΔΙΑΤΡΟΦΗΣ ΣΤΗ ΠΡΟΣΧΟΛΙΚΗ ΗΛΙΚΙΑ ΜΕ ΑΠΟΤΕΛΕΣΜΑ ΤΗ ΠΑΧΥΣΑΡΚΙΑ Έλλη Φωτίου 2010364426 Επιβλέπουσα

Διαβάστε περισσότερα

ΚΑΠΝΙΣΜΑ ΚΑΙ ΣΥΝΔΡΟΜΟ ΑΙΦΝΙΔΙΟΥ ΒΡΕΦΙΚΟΥ ΘΑΝΑΤΟΥ

ΚΑΠΝΙΣΜΑ ΚΑΙ ΣΥΝΔΡΟΜΟ ΑΙΦΝΙΔΙΟΥ ΒΡΕΦΙΚΟΥ ΘΑΝΑΤΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΚΑΠΝΙΣΜΑ ΚΑΙ ΣΥΝΔΡΟΜΟ ΑΙΦΝΙΔΙΟΥ ΒΡΕΦΙΚΟΥ ΘΑΝΑΤΟΥ Ονοματεπώνυμο: Λοϊζιά Ελένη Λεμεσός 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

Η εφαρμογή της Καρδιοαναπνευστικής δοκιμασίας κόπωσης σε ασθενείς με Πνευμονική Αρτηριακή υπέρταση

Η εφαρμογή της Καρδιοαναπνευστικής δοκιμασίας κόπωσης σε ασθενείς με Πνευμονική Αρτηριακή υπέρταση Η εφαρμογή της Καρδιοαναπνευστικής δοκιμασίας κόπωσης σε ασθενείς με Πνευμονική Αρτηριακή υπέρταση Κωνσταντίνος Κώντσας, Παρασκευή Τριβήλου, Αναστασία Καραγκιούλη, Ελένη Τριανταφυλλίδη Εργαστήριο Καρδιοαναπνευστικής

Διαβάστε περισσότερα

Χρόνια Απόφραξη: Γιατί αξίζει τον κόπο να παρέμβουμε

Χρόνια Απόφραξη: Γιατί αξίζει τον κόπο να παρέμβουμε Χρόνια Απόφραξη: Γιατί αξίζει τον κόπο να παρέμβουμε Αθηνόδωρος Ν. Νικητόπουλος Επεμβατικός Καρδιολόγος Γενική Κλινική Euromedica Επιστημονικός Συνεργάτης Β ΚΚ ΑΠΘ Δεν έχω να δηλώσω κάποια αντίθεση συμφερόντων

Διαβάστε περισσότερα

Αξονική Στεφανογραφία: Ο ρόλος της στη διερεύνηση της στεφανιαίας νόσου - Συσχετισμός με την Επεμβατική και τη Μαγνητική Στεφανογραφία.

Αξονική Στεφανογραφία: Ο ρόλος της στη διερεύνηση της στεφανιαίας νόσου - Συσχετισμός με την Επεμβατική και τη Μαγνητική Στεφανογραφία. Αλέξανδρος Καλλιφατίδης - Αξονική Στεφανογραφία 41 Αξονική Στεφανογραφία: Ο ρόλος της στη διερεύνηση της στεφανιαίας νόσου - Συσχετισμός με την Επεμβατική και τη Μαγνητική Στεφανογραφία. Αλέξανδρος Καλλιφατίδης

Διαβάστε περισσότερα

ΑΠΟΦΡΑΚΤΙΚΗ ΥΠΝΙΚΗ ΑΠΝΟΙΑ ΚΑΙ ΣΑΚΧΑΡΩΔΗΣ ΔΙΑΒΗΤΗΣ. Νικολέτα Καρτάλη Β Προπαιδευτική Παθολογική Κλινική ΑΠΘ

ΑΠΟΦΡΑΚΤΙΚΗ ΥΠΝΙΚΗ ΑΠΝΟΙΑ ΚΑΙ ΣΑΚΧΑΡΩΔΗΣ ΔΙΑΒΗΤΗΣ. Νικολέτα Καρτάλη Β Προπαιδευτική Παθολογική Κλινική ΑΠΘ ΑΠΟΦΡΑΚΤΙΚΗ ΥΠΝΙΚΗ ΑΠΝΟΙΑ ΚΑΙ ΣΑΚΧΑΡΩΔΗΣ ΔΙΑΒΗΤΗΣ Νικολέτα Καρτάλη Β Προπαιδευτική Παθολογική Κλινική ΑΠΘ Burwell et al, Am J Med 1956 SLEEP BREATHING DISORDERS ΣΥΝΔΡΟΜΟ ΑΠΟΦΡΑΚΤΙΚΩΝ ΑΠΝΟΙΩΝ ΣΤΟΝ ΥΠΝΟ

Διαβάστε περισσότερα

Τετραγλώχινα Πνευμονική Βαλβίδα σε Ενήλικα Ασθενή: Ευρήματα από το. Διαθωρακικό Υπερηχοκαρδιογράφημα και την Πολυτομική Αξονική Τομογραφία

Τετραγλώχινα Πνευμονική Βαλβίδα σε Ενήλικα Ασθενή: Ευρήματα από το. Διαθωρακικό Υπερηχοκαρδιογράφημα και την Πολυτομική Αξονική Τομογραφία Τετραγλώχινα Πνευμονική Βαλβίδα σε Ενήλικα Ασθενή: Ευρήματα από το Διαθωρακικό Υπερηχοκαρδιογράφημα και την Πολυτομική Αξονική Τομογραφία SOO-YEON JUNG, Department of cardiology, St. Vincent s Hospital,

Διαβάστε περισσότερα

Greek Young Cardiologists

Greek Young Cardiologists Greek Young Cardiologists Newsletter Ιούλιος 2014 Email: younggreekcardiologists@gmail.com http://gy-cardio.gr Long-Term Follow-Up of Heart Failure Patients With Recovered LVEF After β-blocker [Pascal

Διαβάστε περισσότερα

ΗΜΗΤΡΙΑ ΗΣ ΗΜΟΚΡΙΤΟΣ MD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡ ΙΟΛΟΓΟΣ ΚΥΑΝΟΥΣ ΣΤΑΥΡΟΣ EUROMEDICA

ΗΜΗΤΡΙΑ ΗΣ ΗΜΟΚΡΙΤΟΣ MD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡ ΙΟΛΟΓΟΣ ΚΥΑΝΟΥΣ ΣΤΑΥΡΟΣ EUROMEDICA ΗΜΗΤΡΙΑ ΗΣ ΗΜΟΚΡΙΤΟΣ MD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡ ΙΟΛΟΓΟΣ ΚΥΑΝΟΥΣ ΣΤΑΥΡΟΣ EUROMEDICA Φύσηµα της καρδιάς!! Το καρδιακό φύσηµα οφείλεται πάντα σε κάποια παθολογία της καρδιάς. Το παιδί µας έχει ΦΥΣΗΜΑ στην καρδιά!!

Διαβάστε περισσότερα

Πανθηλωμάτωση ουροδόχου κύστεως Πολλαπλές TUR η ριζική κυστεκτομή

Πανθηλωμάτωση ουροδόχου κύστεως Πολλαπλές TUR η ριζική κυστεκτομή Πανθηλωμάτωση ουροδόχου κύστεως Πολλαπλές TUR η ριζική κυστεκτομή ΚΑΛΟΓΕΡΟΠΟΥΛΟΣ ΘΕΟΔΩΡΟΣ MD,MSc,FEBU ΕΠΙΜΕΛΗΤΗΣ Β, ΟΥΡΟΛΟΓΙΚΟ ΤΜΗΜΑ Α.Ο.Ν.Α Θεωρίες προέλευσης της πολλαπλότητας των όγκων

Διαβάστε περισσότερα

Speakers Index Ευρετήριο Ομιλητών

Speakers Index Ευρετήριο Ομιλητών Speakers Index Ευρετήριο Ομιλητών Γρηγοριάδης Ν. Αν. Καθηγητής Νευρολογίας, Ιατρική Σχολή, Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης Δαρδιώτης Ε. Λέκτορας Νευρολογίας, Ιατρική Σχολή, Πανεπιστήμιο Θεσσαλίας

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή Εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ. Πτυχιακή Εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Πτυχιακή Εργασία ΣΥΜΠΛΗΡΩΜΑΤΙΚΕΣ ΚΑΙ ΕΝΑΛΛΑΚΤΙΚΕΣ ΘΕΡΑΠΕΙΕΣ ΩΣ ΠΡΟΣ ΤΗ ΔΙΑΧΕΙΡΙΣΗ ΤΟΥ ΠΟΝΟΥ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΚΑΡΚΙΝΟ. Ονοματεπώνυμο:

Διαβάστε περισσότερα

ΠΕΤΡΟΣ ΔΡΑΚΑΚΗΣ ΑΝΑΠΛ. ΚΑΘΗΓΗΤΗΣ ΜΑΙΕΥΤΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΑΣ Α ΜΑΙΕΥΤΙΚΗ ΓΥΝ/ΚΗ ΚΛΙΝΙΚΗ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ

ΠΕΤΡΟΣ ΔΡΑΚΑΚΗΣ ΑΝΑΠΛ. ΚΑΘΗΓΗΤΗΣ ΜΑΙΕΥΤΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΑΣ Α ΜΑΙΕΥΤΙΚΗ ΓΥΝ/ΚΗ ΚΛΙΝΙΚΗ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ ΠΕΤΡΟΣ ΔΡΑΚΑΚΗΣ ΑΝΑΠΛ. ΚΑΘΗΓΗΤΗΣ ΜΑΙΕΥΤΚΗΣ-ΓΥΝΑΙΚΟΛΟΓΙΑΣ Α ΜΑΙΕΥΤΙΚΗ ΓΥΝ/ΚΗ ΚΛΙΝΙΚΗ ΠΑΝ/ΜΙΟΥ ΑΘΗΝΩΝ ΤΕΧΝΗΤΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΕΞΩΣΩΜΑΤΙΚΗ ΓΟΝΙΜΟΠΟΙΗΣΗ ΠΡΟΚΛΗΣΗ ΩΟΘΥΛΑΚΙΟΡΡΗΞΙΑΣ ΛΗΨΗ ΩΑΡΙΩΝ ΓΟΝΙΜΟΠΟΙΗΣΗ ΕΜΒΡΥΟΜΕΤΑΦΟΡΑ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΙΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΙΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΙΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η ΕΠΙΔΡΑΣΗ ΤΟΥ ΘΕΡΑΠΕΥΤΙΚΟΥ ΑΓΓΙΓΜΑΤΟΣ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΚΑΡΚΙΝΟ ΩΣ ΑΝΑΚΟΥΦΙΣΤΙΚΟ ΜΕΤΡΟ ΑΝΤΡΕΑΣ ΠΙΤΣΙΛΛΟΣ Α.Φ.Τ 2007947541 ΛΕΥΚΩΣΙΑ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Σύνδρομο ευερέθιστου εντέρου και τρόποι αντιμετώπισης του

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία. Σύνδρομο ευερέθιστου εντέρου και τρόποι αντιμετώπισης του 1 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Σύνδρομο ευερέθιστου εντέρου και τρόποι αντιμετώπισης του Ονοματεπώνυμο φοιτήτριας: Ειρήνη Αδάμου Λεμεσός 2014 2 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

Νίκος Τζανάκης Αναπληρωτής Καθηγητής Ιατρική Σχολή, Πανεπιστήμιο Κρήτης

Νίκος Τζανάκης Αναπληρωτής Καθηγητής Ιατρική Σχολή, Πανεπιστήμιο Κρήτης Νίκος Τζανάκης Αναπληρωτής Καθηγητής Ιατρική Σχολή, Πανεπιστήμιο Κρήτης ΧΑΠ: Η φυσική της εξέλιξη FEV 1 (% of value at age 25) 100% 75 50 25 0% AE of COPD or AE in COPD 25 50 75 Age (years) COPD Stages

Διαβάστε περισσότερα

Σακχαρώδης Διαβήτης. Είναι η πιο συχνή μεταβολική νόσος στον άνθρωπο. Γανωτάκης Εμμανουήλ Καθηγητής Παθολογίας Πανεπιστήμιο Κρήτης

Σακχαρώδης Διαβήτης. Είναι η πιο συχνή μεταβολική νόσος στον άνθρωπο. Γανωτάκης Εμμανουήλ Καθηγητής Παθολογίας Πανεπιστήμιο Κρήτης Σακχαρώδης Διαβήτης Είναι η πιο συχνή μεταβολική νόσος στον άνθρωπο. Γανωτάκης Εμμανουήλ Καθηγητής Παθολογίας Πανεπιστήμιο Κρήτης Number of people with diabetes by IDF Region, 2013 IDF Diabetes Atlas.

Διαβάστε περισσότερα

Βαλβιδοπάθειες. Melanie Deutsch

Βαλβιδοπάθειες. Melanie Deutsch Βαλβιδοπάθειες Melanie Deutsch Στένωση µιτροειδούς Σχεδόν πάντοτε ρευµατικής αιτιολογίας Συχνότερα στις γυναίκες Άνοιγµα µιτροειδούς µικρότερο - φυσ. 4-6 cm 2 Στένωση µιτροειδούς Πνευµονικό οίδηµα διαταραχή

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ: ΜΑΚΡΟΧΡΟΝΙΑ ΧΡΗΣΗ ΚΙΝΗΤΟΥ ΤΗΛΕΦΩΝΟΥ ΚΑΙ ΑΝΑΠΤΥΞΗ ΟΓΚΩΝ ΕΓΚΕΦΑΛΟΥ. ΧΡΙΣΤΟΣ ΕΥΘΥΜΙΟΥ ΛΕΜΕΣΟΣ 2012 1 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ

Διαβάστε περισσότερα

ΠΟΣΟΤΙΚΗ ΑΞΙΟΛΟΓΗΣΗ ΤΟΥ ΑΥΤΟΝΟΜΟΥ ΝΕΥΡΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΜΕΣΩ ΤΗΣ ΑΝΑΛΥΣΗΣ HEART RATE VARIABILITY

ΠΟΣΟΤΙΚΗ ΑΞΙΟΛΟΓΗΣΗ ΤΟΥ ΑΥΤΟΝΟΜΟΥ ΝΕΥΡΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΜΕΣΩ ΤΗΣ ΑΝΑΛΥΣΗΣ HEART RATE VARIABILITY ΠΟΣΟΤΙΚΗ ΑΞΙΟΛΟΓΗΣΗ ΤΟΥ ΑΥΤΟΝΟΜΟΥ ΝΕΥΡΙΚΟΥ ΣΥΣΤΗΜΑΤΟΣ ΜΕΣΩ ΤΗΣ ΑΝΑΛΥΣΗΣ HEART RATE VARIABILITY Ποσοτική αξιολόγηση του Αυτόνομου Νευρικού Συστήματος μέσω της ανάλυσης Heart Rate Variability Το NervExpress

Διαβάστε περισσότερα

Πρωτοπαθής αλδοστερονισμός. Δούμας Μιχάλης Παθολόγος

Πρωτοπαθής αλδοστερονισμός. Δούμας Μιχάλης Παθολόγος Πρωτοπαθής αλδοστερονισμός Δούμας Μιχάλης Παθολόγος Πρωτοπαθής Αλδοστερονισμός Σύνδρομο: υπέρταση αλδοστερόνη ρενίνη Ερωτήματα Γιατί πρέπει να ψάξουμε; Είναι συχνός; Αξίζει τον κόπο και τα χρήματα; Ποιούς

Διαβάστε περισσότερα

1. Μηδέν άγαν; Γεώργιος Ανδρικόπουλος, MD, PhD, FESC, ιευθυντής Καρδιολογικής Κλινικής, Ερρίκος Ντυνάν Hospital Center

1. Μηδέν άγαν; Γεώργιος Ανδρικόπουλος, MD, PhD, FESC, ιευθυντής Καρδιολογικής Κλινικής, Ερρίκος Ντυνάν Hospital Center Επιτυχής επέμβαση κατάλυσης κολπικής μαρμαρυγής σε ασθενή με CHADS VASc score 1. Μηδέν άγαν; Γεώργιος Ανδρικόπουλος, MD, PhD, FESC, ιευθυντής Καρδιολογικής Κλινικής, Ερρίκος Ντυνάν Hospital Center ήλωση

Διαβάστε περισσότερα

Number All 397 Women 323 (81%) Men 74 (19%) Age(years) 39,1 (17-74) 38,9 (17-74) 40,5 (18-61) Maximum known weight(kg) 145,4 (92,0-292,0) 138,9 (92,0-202,0) 174,1 (126,0-292,0) Body mass index (kg/m 2

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Ο ΡΟΛΟΣ ΤΗΣ ΑΣΚΗΣΗΣ ΣΕ ΗΛΙΚΙΩΜΕΝΟΥΣ ΜΕ ΚΑΤΑΘΛΙΨΗ Θεοφάνης Παύλου Αρ. Φοιτ. Ταυτότητας: 2010207299 Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ ΑΞΙΟΛΟΓΗΣΗ ΣΤΑΣΕΩΝ ΚΑΙ ΕΠΙΠΕΔΟΥ ΓΝΩΣΕΩΝ ΤΩΝ ΝΟΣΗΛΕΥΤΩΝ ΣΕ ΜΟΝΑΔΕΣ ΕΝΤΑΤΙΚΗΣ ΘΕΡΑΠΕΙΑΣ ΣΧΕΤΙΚΑ ΜΕ ΤΗ ΜΕΤΑΜΟΣΧΕΥΣΗ ΟΡΓΑΝΩΝ ΑΠΟ ΕΓΚΕΦΑΛΙΚΑ

Διαβάστε περισσότερα

Πτυχιακή εργασία. Παραγωγή Βιοντίζελ από Χρησιμοποιημένα Έλαια

Πτυχιακή εργασία. Παραγωγή Βιοντίζελ από Χρησιμοποιημένα Έλαια ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΤΜΗΜΑ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία Παραγωγή Βιοντίζελ από Χρησιμοποιημένα Έλαια Ελένη Χριστοδούλου Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΕΠΙΛΟΧΕΙΑ ΚΑΤΑΘΛΙΨΗ: Ο ΡΟΛΟΣ ΤΗΣ ΚΑΤ ΟΙΚΟΝ ΝΟΣΗΛΕΙΑΣ. Φοινίκη Αλεξάνδρου

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή Εργασία ΕΠΙΛΟΧΕΙΑ ΚΑΤΑΘΛΙΨΗ: Ο ΡΟΛΟΣ ΤΗΣ ΚΑΤ ΟΙΚΟΝ ΝΟΣΗΛΕΙΑΣ. Φοινίκη Αλεξάνδρου ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία ΕΠΙΛΟΧΕΙΑ ΚΑΤΑΘΛΙΨΗ: Ο ΡΟΛΟΣ ΤΗΣ ΚΑΤ ΟΙΚΟΝ ΝΟΣΗΛΕΙΑΣ Φοινίκη Αλεξάνδρου Λεμεσός 2014 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

Test Data Management in Practice

Test Data Management in Practice Problems, Concepts, and the Swisscom Test Data Organizer Do you have issues with your legal and compliance department because test environments contain sensitive data outsourcing partners must not see?

Διαβάστε περισσότερα

ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ ΠΡΟΓΝΩΣΤΙΚΗΣ ΑΞΙΑΣ ΚΑΡΔΙΑΓΓΕΙΑΚΟΥ ΚΙΝΔΥΝΟΥ: FRAMINGHAM RISK SCORE vs ΚΡΙΤΗΡΙΑ ΜΕΤΑΒΟΛΙΚΟΥ ΣΥΝΔΡΟΜΟΥ

ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ ΠΡΟΓΝΩΣΤΙΚΗΣ ΑΞΙΑΣ ΚΑΡΔΙΑΓΓΕΙΑΚΟΥ ΚΙΝΔΥΝΟΥ: FRAMINGHAM RISK SCORE vs ΚΡΙΤΗΡΙΑ ΜΕΤΑΒΟΛΙΚΟΥ ΣΥΝΔΡΟΜΟΥ ΣΥΓΚΡΙΤΙΚΗ ΜΕΛΕΤΗ ΠΡΟΓΝΩΣΤΙΚΗΣ ΑΞΙΑΣ ΚΑΡΔΙΑΓΓΕΙΑΚΟΥ ΚΙΝΔΥΝΟΥ: FRAMINGHAM RISK SCORE vs Π. Τσατραφύλλιας, Δ. Θεοδωράκης, Ευδοξία Μπουτμπάρα, Δήμητρα Κεσίδου, Θ. Γεωργιάδης, Σ. Παραστατίδης, Γεωργία Θεοδωροπούλου,

Διαβάστε περισσότερα

Πνευμονική υπέρταση στις χρόνιες πνευμονοπάθειες. Ιωάννης Στανόπουλος Πνευμονολόγος Εντατικολόγος Μ.Α.Α.

Πνευμονική υπέρταση στις χρόνιες πνευμονοπάθειες. Ιωάννης Στανόπουλος Πνευμονολόγος Εντατικολόγος Μ.Α.Α. Πνευμονική υπέρταση στις χρόνιες πνευμονοπάθειες Ιωάννης Στανόπουλος Πνευμονολόγος Εντατικολόγος Μ.Α.Α. Πνευμονική υπέρταση σε χρόνιες υποξυγοναιμικές πνευμονοπάθειες ορίζεται ως μέση πνευμονική πίεση

Διαβάστε περισσότερα

ΑΝΩΤΑΤΗ ΣΧΟΛΗ ΠΑΙ ΑΓΩΓΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΠΑΡΑΔΟΤΕΟ ΕΠΙΣΤΗΜΟΝΙΚΗ ΕΡΓΑΣΙΑ ΣΕ ΔΙΕΘΝΕΣ ΕΠΙΣΤΗΜΟΝΙΚΟ ΠΕΡΙΟΔΙΚΟ

ΑΝΩΤΑΤΗ ΣΧΟΛΗ ΠΑΙ ΑΓΩΓΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΕΚΠΑΙ ΕΥΣΗΣ ΠΑΡΑΔΟΤΕΟ ΕΠΙΣΤΗΜΟΝΙΚΗ ΕΡΓΑΣΙΑ ΣΕ ΔΙΕΘΝΕΣ ΕΠΙΣΤΗΜΟΝΙΚΟ ΠΕΡΙΟΔΙΚΟ ΑΝΩΤΑΤΗ ΣΧΟΛΗ ΠΑΙ ΑΓΩΓΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΕΚΠΑΙ ΕΥΣΗΣ (Α.Σ.ΠΑΙ.Τ.Ε.) «Αρχιμήδης ΙΙΙ Ενίσχυση Ερευνητικών ομάδων στην Α.Σ.ΠΑΙ.Τ.Ε.» Υποέργο: 8 Τίτλος: «Εκκεντρότητες αντισεισμικού σχεδιασμού ασύμμετρων

Διαβάστε περισσότερα

Καρδιολογικός Έλεγχος για Άθληση

Καρδιολογικός Έλεγχος για Άθληση Καρδιολογικός Έλεγχος για Άθληση (www.pegkaspanagiotis.gr) Καρδιολογικός Έλεγχος για Άθληση...1 Γενικά...2 Αίτια- μηχανισμοί αιφνίδιου καρδιακού θανάτου σε αθλητές...3 Πρωτόκολλο καρδιολογικού ελέγχου

Διαβάστε περισσότερα

Βασίλειος Τάνος M.D Γυναικολόγος Ογκολόγος

Βασίλειος Τάνος M.D Γυναικολόγος Ογκολόγος Οικογενής καρκίνος του μαστού σε Κύπριες ασθενείς Μοντέλο προοπτικού μαζικού ελέγχου για την πρόληψη του καρκίνου του μαστού σε ειδικές πληθυσμιακές ομάδες Βασίλειος Τάνος M.D Γυναικολόγος Ογκολόγος Συχνότητα

Διαβάστε περισσότερα

20-40% των ισχαιμικών ΑΕΕ οφείλονται σε νόσο καρωτίδων

20-40% των ισχαιμικών ΑΕΕ οφείλονται σε νόσο καρωτίδων Γ. Μπενέτος 1, Κ. Τούτουζας 1, Μ. Δρακοπούλου 1, Χ. Δεληγιάννη 2, Ι. Κουτάγιαρ 1, Κ. Σταθογιάννης 1, Χ. Γράσσος 1, Κ. Σπέγγος 2, Η. Σιώρης 3, Χ. Στεφανάδης 1 (1) Α Καρδιολογική Κλινική, Ιπποκράτειο Γενικό

Διαβάστε περισσότερα

Μεταβολικό Σύνδροµο και Σεξουαλική δραστηριότητα. ά ς ό ς.. ής ί ς ή ή ά ώ ά ής ί ς ά

Μεταβολικό Σύνδροµο και Σεξουαλική δραστηριότητα. ά ς ό ς.. ής ί ς ή ή ά ώ ά ής ί ς ά Μεταβολικό Σύνδροµο και Σεξουαλική δραστηριότητα ά ς ό ς. ής ί ς ή ή ά ώ ά ής ί ς ά Ιούνιος 2011 Μεταβολικό Σύνδροµο και Στυτική δυσλειτουργία έ ς ή ς έ. ό. ί ς ός ί ς ί ά Μεταβολικό Σύνδροµο και Στυτική

Διαβάστε περισσότερα

Στυτική δυσλειτουργία και Στεφανιαία νόσος

Στυτική δυσλειτουργία και Στεφανιαία νόσος Στυτική δυσλειτουργία και Στεφανιαία νόσος Χαράλαμπος Βλαχόπουλος Αναπληρωτής Καθηγητής Καρδιολογίας ΓΝΑ Ιπποκράτειο Υπεύθυνος Μονάδας Υπέρτασης Στυτική δυσλειτουργία και Στεφανιαία Νόσος Σχέση με τη ΣΝ

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή εργασία ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΕΠΙΣΤΗΜΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΑΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή εργασία Η ΕΦΑΡΜΟΓΗ ΤΟΥ ΣΥΣΤΗΜΑΤΟΣ HACCP ΣΕ ΜΙΚΡΕΣ ΒΙΟΤΕΧΝΙΕΣ ΓΑΛΑΚΤΟΣ ΣΤΗΝ ΕΠΑΡΧΙΑ ΛΕΜΕΣΟΥ

Διαβάστε περισσότερα

Πόσο συχνές και πόσο επικίνδυνες είναι οι αρρυθμίες της παιδικής ηλικίας;

Πόσο συχνές και πόσο επικίνδυνες είναι οι αρρυθμίες της παιδικής ηλικίας; Πόσο συχνές και πόσο επικίνδυνες είναι οι αρρυθμίες της παιδικής ηλικίας; Δημήτρης Ζ. Ψυρρόπουλος -Καρδιολόγος -Διδάκτωρ Ιατρικής Σχολής Α.Π.Θ. -Συντονιστής Διευθυντής Καρδιολογικής Κλινικής, Γ.Ν.Θ. «Γ.

Διαβάστε περισσότερα

Ενδιαφέρουσα Περίπτωση. Αρρυθμιογόνος Μυοκαρδιοπάθεια/Δυσπλασία Δεξιάς Κοιλίας

Ενδιαφέρουσα Περίπτωση. Αρρυθμιογόνος Μυοκαρδιοπάθεια/Δυσπλασία Δεξιάς Κοιλίας Ενδιαφέρουσα Περίπτωση Ελληνική Καρδιολογική Επιθεώρηση 2010, 51: 301-311 Αρρυθμιογόνος Μυοκαρδιοπάθεια/Δυσπλασία Δεξιάς Κοιλίας Δημητριος Αβραμιδης, 1 Νικολαος Πρωτονοταριος, 2 Αγγελικη Ασημακη, 3 Ευαγγελος

Διαβάστε περισσότερα

Νοσοκοµειακή Οµάδα Επειγόντων: Όθων Φραϊδάκης Αναισθησιολόγος ΤΕΠ Πανεπιστηµιακού Νοσοκοµείου Ηρακλείου

Νοσοκοµειακή Οµάδα Επειγόντων: Όθων Φραϊδάκης Αναισθησιολόγος ΤΕΠ Πανεπιστηµιακού Νοσοκοµείου Ηρακλείου Νοσοκοµειακή Οµάδα Επειγόντων: Είναι µια λύση; Όθων Φραϊδάκης Αναισθησιολόγος ΤΕΠ Πανεπιστηµιακού Νοσοκοµείου Ηρακλείου Νοσοκοµειακή Οµάδα Επειγόντων η ανάγκη ΚΑΡΠΑ-Οµάδα αναζωογόνησης επιβίωση ενδονοσοκοµειακά

Διαβάστε περισσότερα

Ενδείξεις της δοκιμασίας κόπωσης σε παιδιά με χρόνια αναπνευστικά προβλήματα. Θ. Τσιλιγιάννης

Ενδείξεις της δοκιμασίας κόπωσης σε παιδιά με χρόνια αναπνευστικά προβλήματα. Θ. Τσιλιγιάννης Ενδείξεις της δοκιμασίας κόπωσης σε παιδιά με χρόνια αναπνευστικά προβλήματα Θ. Τσιλιγιάννης Παιδίατρος Εξειδικευμένος Παιδοπνευμονολόγος Διευθυντής Παιδοπνευμονολογικού Παιδιατρική Κλινική ΜΗΤΕΡΑ Φυσική

Διαβάστε περισσότερα

ΓΚΔΜΑΓΓΓΖΑΗΕ ΑΚΠΖΙΓΠΩΝΖΟΕ ΑΚΓΡΞΡΟΙΑΠΩΚ ΠΜΡ ΓΓΗΓΦΑΘΜΡ

ΓΚΔΜΑΓΓΓΖΑΗΕ ΑΚΠΖΙΓΠΩΝΖΟΕ ΑΚΓΡΞΡΟΙΑΠΩΚ ΠΜΡ ΓΓΗΓΦΑΘΜΡ ΓΚΔΜΑΓΓΓΖΑΗΕ ΑΚΠΖΙΓΠΩΝΖΟΕ ΑΚΓΡΞΡΟΙΑΠΩΚ ΠΜΡ ΓΓΗΓΦΑΘΜΡ Β. ΝΑΚΑΓΖΩΠΜΝΜΡΘΜΟ Θέθημναξ Κεονμπεηνμονγηθήξ ΚΓΡΞΜΓΖΞΜΡΞΓΖΗΕ ΗΘΖΚΖΗΕ & ΠΙΕΙΑ ΓΝΓΙΒΑΠΖΗΕΟ ΚΓΡΞΜΑΗΠΖΚΜΘΜΓΖΑΟ ΝΑΚΓΝΖΟΠΕΙΖΑΗΜ ΚΜΟΜΗΜΙΓΖΜ ΝΑΠΞΩΚ ΓΓΗΓΦΑΘΖΗΜ

Διαβάστε περισσότερα

Η δοκιμασία κόπωσης σε διαβητικούς ασθενείς

Η δοκιμασία κόπωσης σε διαβητικούς ασθενείς ιάγνωση Στεφανιαίας Νόσου σε άτομα με Σακχαρώδη ιαβήτη Η δοκιμασία κόπωσης σε διαβητικούς ασθενείς Σταύρος Γαβριηλίδης Καθηγητής Καρδιολογίας Α.Π.Θ. ΕΒΕ 14/11/2008 Diabetes as a Risk Equivalent of CAD

Διαβάστε περισσότερα

ΑΝΕΠΑΡΚΕΙΑ ΣΙΔΗΡΟΥ ΑΠΟ ΤΗΝ ΠΑΡΑΤΗΡΗΣΗ ΣΤΗΝ ΚΛΙΝΙΚΗ ΠΡΑΞΗ ΑΙΚΑΤΕΡΙΝΗ ΑΥΓΕΡΟΠΟΥΛΟΥ, MD ΔΙΕΥΘΥΝΤΡΙΑ ΕΣΥ, Γ.Ν.Α ΙΠΠΟΚΡΑΤΕΙΟ

ΑΝΕΠΑΡΚΕΙΑ ΣΙΔΗΡΟΥ ΑΠΟ ΤΗΝ ΠΑΡΑΤΗΡΗΣΗ ΣΤΗΝ ΚΛΙΝΙΚΗ ΠΡΑΞΗ ΑΙΚΑΤΕΡΙΝΗ ΑΥΓΕΡΟΠΟΥΛΟΥ, MD ΔΙΕΥΘΥΝΤΡΙΑ ΕΣΥ, Γ.Ν.Α ΙΠΠΟΚΡΑΤΕΙΟ ΑΝΕΠΑΡΚΕΙΑ ΣΙΔΗΡΟΥ ΑΠΟ ΤΗΝ ΠΑΡΑΤΗΡΗΣΗ ΣΤΗΝ ΚΛΙΝΙΚΗ ΠΡΑΞΗ ΑΙΚΑΤΕΡΙΝΗ ΑΥΓΕΡΟΠΟΥΛΟΥ, MD ΔΙΕΥΘΥΝΤΡΙΑ ΕΣΥ, Γ.Ν.Α ΙΠΠΟΚΡΑΤΕΙΟ ΦΥΣΙΟΛΟΓΙΑ Ο ΡΟΛΟΣ ΤΟΥ ΣΙΔΗΡΟΥ Ο Σίδηρος ενέχει κεντρικό ρόλο στην μεταφορά του οξυγόνου

Διαβάστε περισσότερα

Πτυχιακή διατριβή ΣΤΥΙΤΙΚΗ ΔΥΣΛΕΙΤΟΥΡΓΙΑ ΜΕΤΑ ΑΠΟ ΡΙΖΙΚΗ ΠΡΟΣΤΑΤΕΚΤΟΜΗ

Πτυχιακή διατριβή ΣΤΥΙΤΙΚΗ ΔΥΣΛΕΙΤΟΥΡΓΙΑ ΜΕΤΑ ΑΠΟ ΡΙΖΙΚΗ ΠΡΟΣΤΑΤΕΚΤΟΜΗ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή διατριβή ΣΤΥΙΤΙΚΗ ΔΥΣΛΕΙΤΟΥΡΓΙΑ ΜΕΤΑ ΑΠΟ ΡΙΖΙΚΗ ΠΡΟΣΤΑΤΕΚΤΟΜΗ Μάριος Βασιλείου Λεμεσός 2012 ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ

Διαβάστε περισσότερα

Πρωτογενής αγγειοπλαστική στο οξύ έμφραγμα του μυοκαρδίου Πρόγραμμα stent for life. Ι. Κανακάκης

Πρωτογενής αγγειοπλαστική στο οξύ έμφραγμα του μυοκαρδίου Πρόγραμμα stent for life. Ι. Κανακάκης Στρογγυλό Τραπέζι Η επεμβατική Καρδιολογία στη χώρα μας και η εναρμόνισή της με τις διεθνείς εταιρείες επεμβατικής Καρδιολογίας Πρωτογενής αγγειοπλαστική στο οξύ έμφραγμα του μυοκαρδίου Πρόγραμμα stent

Διαβάστε περισσότερα

ΒΑΛΒΙΔΟΠΑΘΕΙΕΣ ΩΣ ΑΠΟΤΕΛΕΣΜΑ ΑΛΛΩΝ ΚΑΡΔΙΑΚΩΝ ΠΑΘΗΣΕΩΝ ΕΚΤΙΜΗΣΗ-ΑΝΤΙΜΕΤΩΠΙΣΗ

ΒΑΛΒΙΔΟΠΑΘΕΙΕΣ ΩΣ ΑΠΟΤΕΛΕΣΜΑ ΑΛΛΩΝ ΚΑΡΔΙΑΚΩΝ ΠΑΘΗΣΕΩΝ ΕΚΤΙΜΗΣΗ-ΑΝΤΙΜΕΤΩΠΙΣΗ ΒΑΛΒΙΔΟΠΑΘΕΙΕΣ ΩΣ ΑΠΟΤΕΛΕΣΜΑ ΑΛΛΩΝ ΚΑΡΔΙΑΚΩΝ ΠΑΘΗΣΕΩΝ (Μυοκαρδιοπάθειες, Δυσλειτουργία θηλοειδών µυών, διάταση δακτυλίων, µεταβολή της γεωµετρίας των κοιλιών κλπ) ΕΚΤΙΜΗΣΗ-ΑΝΤΙΜΕΤΩΠΙΣΗ Κ.ΛΑΜΠΡΟΠΟΥΛΟΣ MD,

Διαβάστε περισσότερα

Νέες στρατηγικές προσέγγισης των επαγγελματιών υγείας

Νέες στρατηγικές προσέγγισης των επαγγελματιών υγείας Innovating in Uncertain Times Επιστημονική Ημερίδα ΕΕΦΑΜ 27Νοεμβρίου Νοεμβρίου, 2010 Βασίλης Τριαντόπουλος Διευθύνων Σύμβουλος, BIΟΑXIS Healthcare Ltd London UK Νέες στρατηγικές προσέγγισης των επαγγελματιών

Διαβάστε περισσότερα

ΑΓΓΕΙΑΚΑ ΕΓΚΕΦΑΛΙΚΑ ΕΠΕΙΣΟΔΙΑ Ι (ΕΠΙΔΗΜΙΟΛΟΓΙΑ ΚΑΙ ΥΠΟΚΕΙΜΕΝΟΙ ΜΗΧΑΝΙΣΜΟΙ) ΓΕΩΡΓΙΟΣ Κ. ΤΣΙΒΓΟΥΛΗΣ AΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΝΕΥΡΟΛΟΓΙΑΣ

ΑΓΓΕΙΑΚΑ ΕΓΚΕΦΑΛΙΚΑ ΕΠΕΙΣΟΔΙΑ Ι (ΕΠΙΔΗΜΙΟΛΟΓΙΑ ΚΑΙ ΥΠΟΚΕΙΜΕΝΟΙ ΜΗΧΑΝΙΣΜΟΙ) ΓΕΩΡΓΙΟΣ Κ. ΤΣΙΒΓΟΥΛΗΣ AΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΝΕΥΡΟΛΟΓΙΑΣ ΑΓΓΕΙΑΚΑ ΕΓΚΕΦΑΛΙΚΑ ΕΠΕΙΣΟΔΙΑ Ι (ΕΠΙΔΗΜΙΟΛΟΓΙΑ ΚΑΙ ΥΠΟΚΕΙΜΕΝΟΙ ΜΗΧΑΝΙΣΜΟΙ) ΓΕΩΡΓΙΟΣ Κ. ΤΣΙΒΓΟΥΛΗΣ AΝΑΠΛΗΡΩΤΗΣ ΚΑΘΗΓΗΤΗΣ ΝΕΥΡΟΛΟΓΙΑΣ ΟΡΙΣΜΟΣ Αγγειακό Εγκεφαλικό Επεισόδιο (AEE) είναι κάθε κλινικό σύνδρομο,

Διαβάστε περισσότερα

31o/st. Γενικές Πληροφορίες. 11.00-11.30 Διάλειμμα. 15.00-16.00 Διάλειμμα. 11.00-11.30 Αναρτημένες Ανακοινώσεις. 16.00-16.30 Aναρτημένες Ανακοινώσεις

31o/st. Γενικές Πληροφορίες. 11.00-11.30 Διάλειμμα. 15.00-16.00 Διάλειμμα. 11.00-11.30 Αναρτημένες Ανακοινώσεις. 16.00-16.30 Aναρτημένες Ανακοινώσεις ΠΕΜΠΤΗ 21 ΟΚΤΩΒΡΙΟΥ 2010 THURSDAY, 21 OCTOBER 2010 Γενικές Πληροφορίες 11.00-11.30 Διάλειμμα 15.00-16.00 Διάλειμμα 11.00-11.30 Αναρτημένες Ανακοινώσεις 16.00-16.30 Aναρτημένες Ανακοινώσεις 03 ΠΕΜΠΤΗ 21

Διαβάστε περισσότερα

Professional Tourism Education EΠΑΓΓΕΛΜΑΤΙΚΗ ΤΟΥΡΙΣΤΙΚΗ ΕΚΠΑΙΔΕΥΣΗ. Ministry of Tourism-Υπουργείο Τουρισμού

Professional Tourism Education EΠΑΓΓΕΛΜΑΤΙΚΗ ΤΟΥΡΙΣΤΙΚΗ ΕΚΠΑΙΔΕΥΣΗ. Ministry of Tourism-Υπουργείο Τουρισμού Professional Tourism Education EΠΑΓΓΕΛΜΑΤΙΚΗ ΤΟΥΡΙΣΤΙΚΗ ΕΚΠΑΙΔΕΥΣΗ Ministry of Tourism-Υπουργείο Τουρισμού Need for Professional Tourism Education Η Ανάγκη για Επαγγελματική Τουριστική Εκπαίδευση Tourism:

Διαβάστε περισσότερα

Παρουσίαση Περιπτώσεων και Ανάλυση των. Υπερηχογραφικών Χαρακτηριστικών

Παρουσίαση Περιπτώσεων και Ανάλυση των. Υπερηχογραφικών Χαρακτηριστικών Ποικίλα Άρθρα Πρόπτωση Αορτικής Βαλβίδας. Παρουσίαση Περιπτώσεων και Ανάλυση των. Υπερηχογραφικών Χαρακτηριστικών Γεώργιος Μακρυγιάννης MD Κωνσταντίνος Ξυδάς MD ΕΙΣΑΓΩΓΗ Η πρόπτωση της αορτικής βαλβίδας

Διαβάστε περισσότερα

Μια πολύτιμη μέθοδος για τη διάγνωση της στεφανιαίας νόσου Δρ. Ηλίας Κ. Καραμπίνος, MD, FESC, Καρδιολόγος,

Μια πολύτιμη μέθοδος για τη διάγνωση της στεφανιαίας νόσου Δρ. Ηλίας Κ. Καραμπίνος, MD, FESC, Καρδιολόγος, Μια πολύτιμη μέθοδος για τη διάγνωση της στεφανιαίας νόσου Δρ. Ηλίας Κ. Καραμπίνος, MD, FESC, Καρδιολόγος, Ευρωκλινική Αθηνών, Ηχωκαρδιογραφικό Τμήμα Εισαγωγή Η δυναμική ηχωκαρδιογραφία εισήχθη στην κλινική

Διαβάστε περισσότερα

- S P E C I A L R E P O R T - EMPLOYMENT. -January 2012- Source: Cyprus Statistical Service

- S P E C I A L R E P O R T - EMPLOYMENT. -January 2012- Source: Cyprus Statistical Service - S P E C I A L R E P O R T - UN EMPLOYMENT -January 2012- Source: Cyprus Statistical Service This Special Report is brought to you by the Student Career Advisory department of Executive Connections. www.executiveconnections.eu

Διαβάστε περισσότερα

Υπέρταση και Όργανα Στόχος: Εγκέφαλος Οι Βλάβες, η Διάγνωση, η Θεραπεία

Υπέρταση και Όργανα Στόχος: Εγκέφαλος Οι Βλάβες, η Διάγνωση, η Θεραπεία Υπέρταση και Όργανα Στόχος: Εγκέφαλος Οι Βλάβες, η Διάγνωση, η Θεραπεία Βέμμος Κ., Παθολόγος Μονάδα Οξέων Αγγειακών Εγκεφαλικών Επεισοδίων Θεραπευτική Κλινική, Πανεπιστημίου Αθηνών Νοσοκομείο «Αλεξάνδρα»

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή διατριβή

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ. Πτυχιακή διατριβή ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΓΕΩΠΟΝΙΚΩΝ ΕΠΙΣΤΗΜΩΝ ΚΑΙ ΔΙΑΧΕΙΡΙΣΗΣ ΠΕΡΙΒΑΛΛΟΝΤΟΣ Πτυχιακή διατριβή ΠΙΘΑΝΗ ΕΦΑΡΜΟΓΗ ΜΕΛΑΤΟΝΙΝΗΣ ΓΙΑ ΤΗΝ ΠΑΡΑΣΚΕΥΗ ΛΕΙΤΟΥΡΓΙΚΟΥ ΓΙΑΟΥΡΤΙΟΥ ΜΕ ΒΑΣΗ ΤΟ ΠΡΟΒΕΙΟ ΓΑΛΑ

Διαβάστε περισσότερα

Επιστηµονικά συνεργαζόµενοι Euromedica - Κυανούς Σταυρός, Θεσσαλονίκη.

Επιστηµονικά συνεργαζόµενοι Euromedica - Κυανούς Σταυρός, Θεσσαλονίκη. ΒΡΑΧΥ- ΚΑΙ ΜΑΚΡΟΠΡΟΘΕΣΜΑ ΑΠΟΤΕΛΕΣΜΑΤΑ ΑΠΟ ΤΗ ΧΡΗΣΙΜΟΠΟΙΗΣΗ ΕΠΙΚΑΛΥΜΜΕΝΩΝ ΕΝ ΟΣΤΕΦΑΝΙΑΙΩΝ ΠΡΟΘΕΣΕΩΝ ΣΕ ΑΣΘΕΝΕΙΣ ΜΕ ΣΟΒΑΡΟΥ ΒΑΘΜΟΥ ΥΣΛΕΙΤΟΥΡΓΙΑ ΤΗΣ ΑΡΙΣΤΕΡΗΣ ΚΟΙΛΙΑΣ. Χ. ΓΡΑΪ ΗΣ 1,. ΗΜΗΤΡΙΑ ΗΣ 1, Α. ΝΤΑΤΣΙΟΣ

Διαβάστε περισσότερα

Άρθρο Ανασκόπησης Κατευθυντήριες Οδηγίες για τον Καρδιολογικό Έλεγχο Αθλητών

Άρθρο Ανασκόπησης Κατευθυντήριες Οδηγίες για τον Καρδιολογικό Έλεγχο Αθλητών Άρθρο Ανασκόπησης Κατευθυντήριες Οδηγίες για τον Καρδιολογικό Έλεγχο Αθλητών Ασ τ ε ρ ι ο ς Δε λ η γ ι α ν ν η ς 1, Αρ η ς Αν α σ τ α σ α κ η ς 2, Λο ϊ ζ ο ς Αν τ ω ν ι α δ η ς 3, Πα ν α γ ι ω τ η ς Βα

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία Η ΧΡΗΣΗ ΤΟΥ ΕΜΒΟΛΙΟΥ ΓΙΑ ΤΟΝ ΙΟ HPV ΣΤΗΝ ΠΡΟΛΗΨΗ ΤΟΥ ΚΑΡΚΙΝΟΥ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ. Πτυχιακή εργασία Η ΧΡΗΣΗ ΤΟΥ ΕΜΒΟΛΙΟΥ ΓΙΑ ΤΟΝ ΙΟ HPV ΣΤΗΝ ΠΡΟΛΗΨΗ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή εργασία Η ΧΡΗΣΗ ΤΟΥ ΕΜΒΟΛΙΟΥ ΓΙΑ ΤΟΝ ΙΟ HPV ΣΤΗΝ ΠΡΟΛΗΨΗ ΤΟΥ ΚΑΡΚΙΝΟΥ ΤΟΥ ΤΡΑΧΗΛΟΥ ΤΗΣ ΜΗΤΡΑΣ [ Αναστασία Πέτρου ] 2009625164 Λευκωσία 2014

Διαβάστε περισσότερα

Προγνωστικός δείκτης (σκορ) ενδονοσοκομειακής. θνητότητας σε ασθενείς με Οξύ Στεφανιαίο σύνδρομο: Η Μελέτη «GREECS»

Προγνωστικός δείκτης (σκορ) ενδονοσοκομειακής. θνητότητας σε ασθενείς με Οξύ Στεφανιαίο σύνδρομο: Η Μελέτη «GREECS» Προγνωστικός δείκτης (σκορ) ενδονοσοκομειακής και 30-ημερών θνητότητας σε ασθενείς με Οξύ Στεφανιαίο σύνδρομο: Η Μελέτη «GREECS» Δ. Παναγιωτάκος 1, Ε. Γεωργουσοπούλου 1, Χ. Πίτσαβος 2, Β. Νοταρά 1, Χ.

Διαβάστε περισσότερα

Αιφνίδιος θάνατος των αθλητών

Αιφνίδιος θάνατος των αθλητών Καρδιολογική Γνώμη (2009) 4(4):270-278 Αιφνίδιος θάνατος των αθλητών Άρης Αναστασάκης Μονάδα Κληρονομικών Παθήσεων, Ειδικό Κέντρο Καρδιάς Αθλητών και Νέων, Α Καρδιολογική Κλινική Πανεπιστημίου Αθηνών Λέξεις

Διαβάστε περισσότερα

Multi-grained alignment of parallel texts with endogenous resources

Multi-grained alignment of parallel texts with endogenous resources Multi-grained alignment of parallel texts with endogenous resources Emmanuel Giguet Greyc CNRS UMR 6072 Université de Caen, France Free parallel corpora for research EU legal texts Technical documentation

Διαβάστε περισσότερα

Κλινική εξέταση σε ασθενή με ανδρολογικά προβλήματα. Πέτρος Περιμένης

Κλινική εξέταση σε ασθενή με ανδρολογικά προβλήματα. Πέτρος Περιμένης Κλινική εξέταση σε ασθενή με ανδρολογικά προβλήματα Πέτρος Περιμένης Δήλωση συμφερόντων GSK, Lilly, AMGEN Είναι εφικτή μια αντικειμενική κλινική εξέταση σε ασθενή με ανδρολογικά προβλήματα; Η καθημερινή

Διαβάστε περισσότερα

GREECE BULGARIA 6 th JOINT MONITORING

GREECE BULGARIA 6 th JOINT MONITORING GREECE BULGARIA 6 th JOINT MONITORING COMMITTEE BANSKO 26-5-2015 «GREECE BULGARIA» Timeline 02 Future actions of the new GR-BG 20 Programme June 2015: Re - submission of the modified d Programme according

Διαβάστε περισσότερα

Τα δεδομένα που αφορούν στον καρκίνο είναι το πρώτο ουσιαστικό βήμα για τον αποτελεσματικό σχεδιασμό του ελέγχου του καρκίνου

Τα δεδομένα που αφορούν στον καρκίνο είναι το πρώτο ουσιαστικό βήμα για τον αποτελεσματικό σχεδιασμό του ελέγχου του καρκίνου Τα δεδομένα που αφορούν στον καρκίνο είναι το πρώτο ουσιαστικό βήμα για τον αποτελεσματικό σχεδιασμό του ελέγχου του καρκίνου Πέτρος Καρακίτσος Καθηγητής Κυτταρολογίας Διευθυντής Εργαστηρίου Διαγνωστικής

Διαβάστε περισσότερα

Επιβλέπων καθηγητής: Δρ Βασίλειος Ραφτόπουλος ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΣΕ ΜΕΤΕΜΜΗΝΟΠΑΥΣΙΑΚΕΣ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΟΣΤΕΟΠΟΡΩΤΙΚΑ ΚΑΤΑΓΜΑΤΑ ΣΠΟΝΔΥΛΙΚΗΣ ΣΤΗΛΗΣ

Επιβλέπων καθηγητής: Δρ Βασίλειος Ραφτόπουλος ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΣΕ ΜΕΤΕΜΜΗΝΟΠΑΥΣΙΑΚΕΣ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΟΣΤΕΟΠΟΡΩΤΙΚΑ ΚΑΤΑΓΜΑΤΑ ΣΠΟΝΔΥΛΙΚΗΣ ΣΤΗΛΗΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΤΜΗΜΑ ΝΟΣΗΛΕΥΤΙΚΗΣ Επιβλέπων καθηγητής: Δρ Βασίλειος Ραφτόπουλος ΠΟΙΟΤΗΤΑ ΖΩΗΣ ΣΕ ΜΕΤΕΜΜΗΝΟΠΑΥΣΙΑΚΕΣ ΓΥΝΑΙΚΕΣ ΜΕΤΑ ΑΠΟ ΟΣΤΕΟΠΟΡΩΤΙΚΑ ΚΑΤΑΓΜΑΤΑ ΣΠΟΝΔΥΛΙΚΗΣ ΣΤΗΛΗΣ Από τη

Διαβάστε περισσότερα

Προχωρηµένη καρδιακή ανεπάρκεια. Φαρµακευτική θεραπεία

Προχωρηµένη καρδιακή ανεπάρκεια. Φαρµακευτική θεραπεία Προχωρηµένη καρδιακή ανεπάρκεια. Φαρµακευτική θεραπεία!"#$%& ()* +), ( %*- +-./ 0/ &12* 3%( -)")4-52 3"-&-52 6.7.7)8)5)µ.9)/ : ;")/ Conflict of Interest Nothing to declare! Natural history of Heart failure

Διαβάστε περισσότερα

Αξιολόγηση και θεραπεία Από τα πρωτόκολλα των SOS Ιατρών Επιμέλεια Γεώργιος Θεοχάρης

Αξιολόγηση και θεραπεία Από τα πρωτόκολλα των SOS Ιατρών Επιμέλεια Γεώργιος Θεοχάρης Αξιολόγηση και θεραπεία Από τα πρωτόκολλα των SOS Ιατρών Επιμέλεια Γεώργιος Θεοχάρης Παθολόγος Αξιολόγηση βαρύτητας περιστατικού - Από την βαρύτητα των κλινικών σημείων (αναπνευστική συχνότητα >35, ταχυκαρδία,

Διαβάστε περισσότερα

Καθολική χρήση των φαρμακοεκλυόντων stent (DES) σε όλους;

Καθολική χρήση των φαρμακοεκλυόντων stent (DES) σε όλους; Σεμινάριο Ομάδων Εργασίας της Ελληνικής Καρδιολογικής Εταιρείας Θεσσαλονίκη 8 Φευρουαρίου 2006 Καθολική χρήση των φαρμακοεκλυόντων stent (DES) σε όλους; Βασίλειος Ν. Σπανός Επεμβατικός Καρδιολόγος Ευρωκλινικής

Διαβάστε περισσότερα

12ο ΒΟΡΕΙΟΕΛΛΑΔΙΚΟ ΚΑΡΔΙΟΛΟΓΙΚΟ ΣΥΝΕΔΡΙ0. ΜΕΣΟΚΟΛΠΙΚΗ ΕΠΙΚΟΙΝΩΝΙΑ Τύποι- Πρόγνωση- Θεραπεία

12ο ΒΟΡΕΙΟΕΛΛΑΔΙΚΟ ΚΑΡΔΙΟΛΟΓΙΚΟ ΣΥΝΕΔΡΙ0. ΜΕΣΟΚΟΛΠΙΚΗ ΕΠΙΚΟΙΝΩΝΙΑ Τύποι- Πρόγνωση- Θεραπεία 12ο ΒΟΡΕΙΟΕΛΛΑΔΙΚΟ ΚΑΡΔΙΟΛΟΓΙΚΟ ΣΥΝΕΔΡΙ0 Στρογγυλό Τραπέζι: Συγγενείς καρδιοπάθειες ενηλίκων- πνευµονική υπέρταση ΜΕΣΟΚΟΛΠΙΚΗ ΕΠΙΚΟΙΝΩΝΙΑ Τύποι- Πρόγνωση- Θεραπεία Κωνσταντίνος Θωµαϊδης, Γ.Ν. «Γ.ΠΑΠΑΝΙΚΟΛΑΟΥ»

Διαβάστε περισσότερα

Μελέτη της οξείας επίδρασης της κατανάλωσης μπύρας στην ενδοθηλιακή λειτουργία και την αρτηριακή σκληρία

Μελέτη της οξείας επίδρασης της κατανάλωσης μπύρας στην ενδοθηλιακή λειτουργία και την αρτηριακή σκληρία Μελέτη της οξείας επίδρασης της κατανάλωσης μπύρας στην ενδοθηλιακή λειτουργία και την αρτηριακή σκληρία υγιών εθελοντών Κ. Καράτζη, PhD (Χαροκόπειο Πανεπιστήμιο) Τμήμα Επιστήμης Διαιτολογίας-Διατροφής

Διαβάστε περισσότερα

34o ΠΑΝΕΛΛΗΝΙΟ ΚΑΡ ΙΟΛΟΓΙΚΟ ΣΥΝΕ ΡΙΟ 10-12 ΟΚΤΩΒΡΙΟΥ 2013 ΞΕΝΟ ΟΧΕΙΟ HILTON / ΑΘΗΝΑ

34o ΠΑΝΕΛΛΗΝΙΟ ΚΑΡ ΙΟΛΟΓΙΚΟ ΣΥΝΕ ΡΙΟ 10-12 ΟΚΤΩΒΡΙΟΥ 2013 ΞΕΝΟ ΟΧΕΙΟ HILTON / ΑΘΗΝΑ 1 34o ΠΑΝΕΛΛΗΝΙΟ ΚΑΡ ΙΟΛΟΓΙΚΟ ΣΥΝΕ ΡΙΟ 10-12 ΟΚΤΩΒΡΙΟΥ 2013 ΞΕΝΟ ΟΧΕΙΟ HILTON / ΑΘΗΝΑ 34th PANHELLENIC CONGRESS OF CARDIOLOGY 10-12 OCTOBER 2013 HILTON HOTEL / ATHENS 2 ΣΥΝΟΠΤΙΚΟ ΕΠΙΣΤΗΜΟΝΙΚΟ ΠΡΟΓΡΑΜΜΑ

Διαβάστε περισσότερα

GREECE BULGARIA 6 th JOINT MONITORING

GREECE BULGARIA 6 th JOINT MONITORING GREECE BULGARIA 6 th JOINT MONITORING COMMITTEE BANSKO 26-5-2015 LEGISLATIVE FRAMEWORK Regulation 1083/2006 (general provisions for ERDF). Regulation 1080/2006 (ERDF) Regulation 1028/2006 (Implementing

Διαβάστε περισσότερα

Η πρόληψη των κατακλίσεων σε βαριά πάσχοντες και η χρήση ειδικών στρωμάτων για την πρόληψη και αντιμετώπιση των κατακλίσεων

Η πρόληψη των κατακλίσεων σε βαριά πάσχοντες και η χρήση ειδικών στρωμάτων για την πρόληψη και αντιμετώπιση των κατακλίσεων ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΠΤΥΧΙΑΚΗ ΕΡΓΑΣΙΑ Η πρόληψη των κατακλίσεων σε βαριά πάσχοντες και η χρήση ειδικών στρωμάτων για την πρόληψη και αντιμετώπιση των κατακλίσεων Ονοματεπώνυμο

Διαβάστε περισσότερα

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ

ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ ΤΕΧΝΟΛΟΓΙΚΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΚΥΠΡΟΥ ΣΧΟΛΗ ΕΠΙΣΤΗΜΩΝ ΥΓΕΙΑΣ Πτυχιακή Εργασία Χαμηλά επίπεδα βιταμίνης D σχετιζόμενα με το βρογχικό άσθμα στα παιδιά και στους έφηβους Κουρομπίνα Αλεξάνδρα Λεμεσός [2014] i ΤΕΧΝΟΛΟΓΙΚΟ

Διαβάστε περισσότερα