: ک ی ن و ر ت ک ل ا ت س پ

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download ": ک ی ن و ر ت ک ل ا ت س پ"

Transcript

1 : 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ک ی م ه ی ش ن م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ه د و ل آ ت ا ن ا و ی ح ع و ف د م ز ا ی ت ک ا ب د ق ا ف م و و ا پ *1 ی م ا غ ض ل ص ی ف ن ا ی د ی م ا ا ه ز ه د ا ز م ی ه ا ب ا ه ه ل ا ی غ ص ا ب ن ی ز ن ا ی ا ش ز ی و پ 1 ه- و گ ن ا ی ا ن ا ه ت ن ا ه ت ه ا گ ش ن ا د ی ک ش ز پ م ا د ه د ک ش ن ا د لشناسی گ ن ا ی د 1 : ت ف ا ی د خ ی ا ت ن م ه ب 1 2 : ش ی ذ پ خ ی ا ت ه د ی ک چ ت ا ن ا و ی ح د ا ز و ن و ی ن م ی ا ص ق ن ا چ د د ا ف ا د ه ک د ش ا ب ی م ن ا و ی ح و ن ا س ن ا ن ی ب ک ت ش م ی ا ه ت خ ا ی ک ت م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ا ه ب آ ع ب ا ن م ص و ص خ ب ط ی ح م ی گ د و ل آ ث ع ا ب ه د و ل آ ی ا ه م ا د ز ا ه د ش ع ف د ی ا ه ت س ی س و و ا. د ش ا ب ی م ا ز ی ا م ی ب ا ه ه ل ا س و گ ص و ص خ ب ه ب ا ه ت س ی س و و ا گ ی د ف ط ز ا و د ش ا ب ی ا م ی ب گ ز ا غ آ د ن ا و ت ی م ت س ی س و و ا م ک د ا د ع ت ی ت ح ه ک ن ی ا ه ب ه ج و ت ا ب. د ن و ش ی م ی ح ط س ی ا ه ش و ت س ا ه د ش ش ال ت ه ا و م ه و ه ت ف گ ا ق ن ی ق ق ح م ه ج و ت د و م ه ت خ ا ی ک ت ن ی ا د ن م و ا ق م ل و ا د ت م ی ا ه ه د ن ن ک ی ن و ف ع د ض و د و ش ه ن ی ه ب ت س ی س و و ا م ک د ا د ع ت ی ا ا د ی ط ی ح م ی ا ه ه ن و م ن د ی ت ح م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ص ی ل خ ت و ی ز ا س ا د ج ی ل و ک ل و م و ی ک ی ژ و ل و ن م ی ا ت ا ع ل ا ط م و ظ ن م ه ب ا ه ی ص ل ا خ ا ن ی ا س و ی ی ا ی ت ک ا ب ی ا ه ی گ د و ل آ ز ا ی ا ع و ص ل ا خ ال م ا ک ی ی ا ه ت س ی س و و ا ت س ی س و و ا ه ب د ن ا ه ت س ن ا و ت ن ک ی چ ی ه ی ل و د ن ا ه د و ب ز ی م آ ت ی ق ف و م حدودی تا د ن ا ه د ش ه د ا ف ت س ا کنون تا که مختلفی ی ا ه ش و. گدد فاهم و ظ ن م ه ب ق ی ق ح ت ن ی ا د. د ش ا ب ی م ی ت ک ا ب ز ا ی ا ع ت س ی س و و ا ه ب ی ب ا ی ت س د ق ی ق ح ت ن ی ا ز ا ف د ه. د ن ن ک ا د ی پ ت س د ی ت ک ا ب ز ا ی ا ع ل و ل ح م م ا ع ط ک م ن ل و ل ح م ز ا ه د ا ف ت س ا ل م ا ش ی ز ا س و ا ن ش ش و ا ه چ ا د ت ب ا کیپتوسپویدیوم ی ا ه ت س ی س و و ا ه ی ل و ا ی ز ا س ا د ج ی ا ب ش و ن ی ت ه ب د ص د 5 5 ز ا ک ا س ل و ل ح م. د ی د گ ه د ا ف ت س ا د ص د 5 5 ز ا ک ا س ل و ل ح م و ل و ک ی ا ف ی ن ا ک ل پ ی ت ظ ل غ ب ی ش ز ا ک ا س ت ل ی ف ز ا ه ا م ه ی ا ه ی ص ل ا خ ا ن ی ا س و ی ت ک ا ب ف ذ ح ت ه ج. د ی د گ ی ب ا ی ز ا م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ه ی ل و ا ی ز ا س ا د ج ن و ی س ا ت ل ی ف ز ا ل ص ا ح ی ا ه ت س ی س و و ا ه ک د ا د ن ا ش ن ه د ش ج ا خ ت س ا ی ا ه ت س ی س و و ا ز ی ل ا ن آ. د ی د گ ه د ا ف ت س ا ) ن و ک ی م 3 ذ ف ا ن م ا ب ( ز ل و ل س و ت ی ن ت س د ز ا ص ی ل خ ت ن ی ح د ا ه ت س ی س و و ا ز ا ی د ا ی ز د ا د ع ت ه چ گ ا. د ی د گ ی ب ا ی ز ا 0 3 ا ه ن آ د ص د و د و ب ی ت ک ا ب ه ن و گ ه ز ا ی ا ع. د ن ش ا ب ی م ب س ا ن م ا ی س ب س ک ی م و ئ ت و پ ت ا ش ی ا م ز آ ی ا ب ه د ش ص ی ل خ ت ی ا ه ت س ی س و و ا ا م ا د ن ت ف ن و ی س ا ت ل ی ف ی ز ا س و ا ن ش ت س ی س و و ا م و ا پ م و ی د ی و پ س و ت پ ی ک : ی د ی ل ک ت ا م ل ک ن ا ی ا ش ز ی و پ : ل و ئ س م ه د ن س ی و ن : ن ف ل ت. ن ا ی ا ن ا ه ت ن ا ه ت ه ا گ ش ن ا د ی ک ش ز پ م ا د ه د ک ش ن ا د ی س ا ن ش ل گ ن ا ه و گ : س د آ : ک ی ن و ت ک ل ا ت س پ

2 و 1 و ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 7 ه م د ق م ت س ا ا س ک ل پ م ک پی ا شاخه از ی ا ه ت خ ا ی ک ت م و ی د ی و پ س و ت پ ی ک ه ک ه ی ال کی ا و س م ای ه ل و ل س ی ا ه د و ث ک ا ه ه م ه ب ش ی پ دی ن چ ا ت. د ه د ی م ا ق م ج ا ه ت د و م ا ن ا ا د ن ا و ن ع ک ی ل گ ن ا ت ص ف ب ل ط ل و ا د ت م ی غ ح ط م د و ب د ی ا ه د و ی ا ز ی ا م ی ب ل م ا ع ک ی ن ا و ن ع ه ب ن و ن ک ا لی و ه ب ن ا ی ال ت ب م د ه ژ ی و ب م ا د و ن ا س ن ا ک ت ش م ای ه ی ا م ی ب ص ق ن ی ن م ی ا د و م ه ج و ت ا ق ه ت ف گ ت س ا. )2 ( ه ل م ج ز ا ه د و ل آ ی ا ه م ا د ط س و ت ه د ش ع ف د ی ا ه ت س ی س و و ا ع ب ا ن م د ن ن ا م ط ی ح م ن د ش ه د و ل آ ب ج و م د ن ا و ت ی م ه ل ا س و گ ی ح ط س ب آ. د و ش ش ا ز گ ه د ش ت س ا ه ک د ن ا و ت ی م م و و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا گی د و ل آ د. ش ا ب ا ب ه ج و ت ه ب ت م و ا ق م د ا د ع ت م ک گ ز ا غ آ ا ه ت س ی س و و ا ه ب ی ع ط ق ن ا م د د و ج و م د ع و ل و ا د ت م کنندههای ضدعفونی م و ی د ی و پ س و ت پ ی ک ه ی ل ع م و ز ل ص ی خ ش ت ت یس س و و ا د ا د ع ت ا ب ی ی ا ه ه ن و م ن د ی ت ح م و و ا پ م و ی د ی و پ س و ت پ ی ک م ک د و ج و ب س ک ی م و ئ ت و پ د ا ی ز و ص ل ا خ. د ا د م ا ج ن ا ت ا ق ی ق ح ت ی ل و ک ل و م و د ا د ع ت ه ب ووم ا پ کیپتوسپویدیوم ی و ت س ی س و و ا ز ا ی ن د ا د. ) 1 ( ن و ن ک ا ت ) )2 ز ا ک ا س ل و ل ح م ز ا ه د ا ف ت س ا د ن ن ا م ی ف ل ت خ م ی ا ه ش و ) 3 2 ( % 5 5 ز ا ک ا س ل و ل ح م ) و 9 )5 م ا ع ط ک م ن ل و ل ح م ب ی ش ل ک پ ی ت ظ ل غ ) 1 ( ع ط ق ن م ی غ ه ب ز ا ک ا س و ظ ن م ه ا م ه ص ی ل خ ت ا ب ب ی ش ی ت ظ ل غ ی ا ه ت س ی س و و ا ب ی ن ت ب م ی ا ه ش و. ت س ا شده استفاده و ک ذ م ه ت خ ا ی ک ت ص ی ل خ ت ز ا ق ی ط ک ی ت ن گ م و ن م ی ا ت ه ج ی ز ا س ا د ج ش ا ز گ ز ی ن م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ه د ش ت س ا. ) )8 گ ا ه چ د ش و ک ی ت ن گ م و ن و م ی ا ن ی ا ا م ا د ن ش ا ب ی م ی ز ا س ا د ج ل ب ا ق ص ل ا خ ی ا ه ت س ی س و و ا ش و ا ه ب ت ل ع ی ن ا گ ه ی ه ت د ا و م د و م ز ا ی ن ه ش ی م ه ا ه ت س ی س و و ا د ن ا و ت ب ه ک ی ش و ا ذ ل. د ش ا ب ی م ن ی ذ پ ن ا ک م ا ن ا ز ا ز ا ه ن و گ ه ی ص ل ا خ ا ن ی ز ا س ا د ج د ن ک ش ق ن ک ت ن ی ا ه ب ط و ب م ی س ک ی م و ئ ت و پ ت ا ق ی ق ح ت د ا ی م ه م. د و م ن د ه ا و خ ا ف ی ا ه ت خ ا ی ا ک ش و و د ا و م ی ا ه ت س ی س و و ا ه ی ل و ا جداسازی و ه ن و م ن ی و آ ع م ج م و ا پ م و ی د ی و پ س و ت پ ی ک ز و ی د ی و پ س و ت پ ی ک ه ب ک و ک ش م ی ل ا ه س ا گوسالههای از ش ی ا م ز آ ا ب ن ا ه ت ه ا گ ش ن ا د د ا ب آ ن ی م ا ی ت ا ق ی ق ح ت ه س س و م ل ا ت ک ه ن و م ن ت ا م و ک بی ا ت ع و ف د م م ی س ا ت پ ی و آ ع م ج 2/5 د ص د د ش ه ف ا ض ا و و م ه ه ب م ج ح ن آ ه ا گ ش ی ا م ز آ ا ه ه ن و م ن. د ی د گ ل ق ت ن م ی ک ش ز پ م ا د ه د ک ش ن ا د ی س ا ن ش ل گ ن ا ن ا م ز ش ي ا م ز آ د 4 ه ج د ي ت ن ا س د ا گ ي ا د ه گ ن ه ي ه ت ش ت س گ ع و ف د م ي ا ه ه ن و م ن ز ا ه ا گ ش ی ا م ز آ د. د ن شد. د ی د گ ی ز ی م آ گ ن ه د ش ح ال ص ا ن و س ل ن ل ی ذ ش و ا ب و ب ا ب 04 نمایی ت ش د ا ب ی ز ی م آ گ ن ز ا س پ ا ه ش ت س گ پ و ک س و ک ی م ی و ن 20 ز ا ش ی ب گی د و ل آ د ه ا ه ت س ی س و و ا ن ا د ی م. د ی د گ ع ا ب ش ا ز ا د ی د ع و ف د م ز ا DNA ج ا خ ت س ا ه د ه ا ش م و د ت و ص د و ج و م و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا پ ک س و ک ی م ا ب ه د ا ف ت س ا م ا د ق ا ز ا ه ب ل و ل ح م ص ی ل خ ت ز ا ک ا س م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا پلیماز) PCR ( ی ا ه ی ج ن ز ش ن ک ا و م ا ج ن ا و د و م ی ا ه ت س ی س و و ا ه ک ن ی ا ی ل و ک ل و م د ی ی ا ت و ظ ن م ه ب ی ی ا س ا ن ش د گ ن ی ز ی م آ ل ی ذ ن و س ل ن ح ال ص ا ه د ش ز ا DNA ج ا خ ت س ا د ن ش ا ب ی م م و ا پ م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا و ک ذ م ا ب ه د ا ف ت س ا ز ا ت ی ک DNA ( ل م ع ل ا و ت س د س ا س ا ب ) extraction kit, MBST, Iran ش ن ک ا و م ا ج ن ا ی ا ب ن آ ز ا س پ. ت ف ی ذ پ م ا ج ن ا ه د ن ز ا س ی ا ه ی ج ن ز ز ا م ی ل پ ز ا ی ا ه م ی ا پ F1=(5`aagctcgtagttggatttctg 3`) ی ص ا ص ت خ ا و ب ع ش ن م `5)=R1 taaggaacaacctccaatctc (`3

3 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ز ا م و ی د ی و پ س و ت پ ی ک س ن ج 18S ribosomal RNA ن ژ DNA ز ا ت ي ل و ك ي م ک ی و ظ ن م ن ی ا ه ب د. ی د گ ه د ا ف ت س ا ج ا خ ت س ا ت ی ل و ک ی م ه ه د ش ت ه ج ی ث ك ت ه د ا ف ت س ا. د ش ت ی ل و ک ی م 2 PCR buffer 10x ن ا ز ی م 0 1 dntp (10 ز ا ت ی ل و ک ی م 2 MgCl 2 50) mm) ت ی ل و ک ی م 3 mm) Reverse 20) µm) و Forward 20) µm) م ی ا پ 0/5 ا ب و د ت ی ل و ک ی م ه د ش ی ط ق ت م ی ز ن آ ل ی ت س ا Taq ه ب ز ا م ی ل پ ی ا ه ز ا د ن ا (5U/μl) ه ک م ج ح و ب آ ی ی ا ه ن ه ا گ ت س د د و ه د ش ه ف ا ض ا د ش ا ب ت ی ل و ک ی م ش ن ک ا و ل ک ی س و م ت (MWG Germany) ا ب ه م ا ن ب 5 9 ه ج د و د ه ی ل و ا ت ش س ا و و ظ ن م ه ب ه ق ی ق د 5 ت د م ه ب گاد سانتی د ا گ تی ن ا س ه ج د 5 9 ه م ا ن ب ا ب ه خ چ 5 3 DNA ه ت ش ه ی ن ا ث 5 4 ت د م ه ب د ا گ تی ن ا س ه ج د 8 5 ه ی ن ا ث 5 4 ت د م ه ب ل ی م ک ت ت ه ج و ه ی ن ا ث 5 4 ت د م ه ب د ا گ تی ن ا س ه ج د 2 7 ی ی ا ه ن ی ث ک ت ت خ ا س ک م ه ق ی ق د ه د ت د م ه ب د ا گ ی ت ن ا س ه ج د 2 7 DNA م ا ج ن ا. ت ف ی ذ پ ت ه ج ن ی ی ع ت و ز ا گ آ ل ژ ز ا PCR ل و ص ح م ا د ت ب ا م و و ا پ گونه تشخيص UV ه ع ش ا ت ح ت د ی ا م و ب م و ی د ی ت ا ا ب ی ز ی م آ گ ن ز ا س پ ج ا خ ت س ا ص ی ل خ ت م وو ا پ فی د ا ت ت س ا ن ی ا و ه د ش ص ی ل خ ت ا ب. د ی د گ ه د ا ف ت س ا ز ا د ه م ا د ا م ی ا پ ل و ص ح م صی ا ص ت خ ا PCR ) F2=5`catattactatttttttttttag 3`( و ص ح م د و م م ی ا پ ه د ش ی ب ا ی ز ا ط ق ف د ز ا ا ق و د م ی ا پ. ت ف گ لی ب ق ف د ا ت د و ج و م م و و ا پ ه ن و گ ه ک ل ی ک ش ت ه ن و گ ز ا ه د ش ی د ی ت و ئ ل ک و ن ه د و ب و د ی د ی ت و ئ ل ک و ن ف د ا ت ز ا ن ژ ز ا ت م س ق ن ی ا گ ی د ای ه ه ن و گ ی گ ی د ل ی ک ش ت ه د ش. ت س ا ی ث ک ت ک م DNA ت ح ت ه ج د 0 5 ه ب ا ه گ ز ا غ آ ل ا ص ت ا ي ا م د ( ه د ش ک ذ ط ی ا ش م ا ج ن ا R1 و F2 ای ه م ی ا پ ا ب ) ت ف ا ي ش ه ا ك د ا گ ي ت ن ا س د ص د 1/5 ز ا گ آ ل ژ وی ب PCR ل و ص ح م. ت ف گ د ی ا م و ب م و ی د ی ت ا ا ب ي ز ي م آ گ ن ز ا س پ ه د ش ز و ف و ت ک ل ا. ت ف گ ا ق ی ب ا ی ز ا د و م UV ه ع ش ا ت ح ت زی ا س ه د و ل آ م و ا پ و بی ج ت ه ل ا س و گ د ی ی ا ت و ص ی خ ش ت ز ا س پ م و ی د ی و پ س و ت پ ی ک ه ب م و ی د ی و پ س و ت پ ی ک ی ل و ک ل و م ز ا ت س ی س و و ا د ا ی ز د ا د ع ت ه ب ی ب ا ی ت س د و ظ ن م ه ب م و و ا پ د ل و ت م ه ز ا ت ن ی ا ت ش ل و ه گوساله اس ک ی د ح ا و ع ب ن م ک ی ه س س و م ز ا ضدکیپتوسپویدیوم پادتن د ق ا ف د ا م ز ا ه د ش و د ا م و ا گ ع و ف د م ز ا. د ش ب ا خ ت ن ا د ا ب آ ن ی م ا ی ت ا ق ی ق ح ت گدید تهیه گستش سازی آلوده ز ا ل ب ق گوساله مدفوع د و م و ی ز ی م آ گ ن ه د ش ح ال ص ا ن س ل ن ل ی ذ ش و ه ب و ه ک و ط ن ا م ه ( د و خ ه ک ی ا ه ل ا س و گ. ت ف گ ا ق ی ب ا ی ز ا د ت س ی س و و ا د و ج و ظ ا ح ل ز ا ش د ا م و ) ت ف ی م ا ظ ت ن ا ی ا ع ی ط ی ح م ه ب ی ب ج ت ی گ د و ل آ ی ا ب د و ب ی ف ن م ع و ف د م ز و غ آ ز ا ظ ن د و م گوساله. شد ه د ا د ل ا ق ت ن ا ت س ی س و و ا ز ا م ت س ی س ف ی ع ض ت جهت تولد ز ا س پ ت ع ا س 4 2 و م و ح م ل ه چ. د ی د گ ق ی ز ت ن آ ه ب ن و ز ا ت م ا ز گ د 0 1 mg/kg ی ن م ی ا ت ش ه ت ع ا س س پ ز ا د ل و ت ه ب ه ل ا س و گ ه د ی ن ا و خ م و و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا ا د د ج م ن و ز ا ت م ا ز گ د ای ه گی د و ل آ ه ل ا س و گ ه ب ن ا ز ی م ت ع ا س ق ی ز ت س پ ی ی ا ی ت ک ا ب ز ا. د ی د گ mg/kg د ل و ت ز ی ن ت ه ج ت ع ا س ه ب س پ ن ا م ه ی ی گ ش ی پ ز ا ن ي س ا س ك و ل ف و ن ا د ش د ل و ت و ن ا ز ی م ز ا ه ب ق ی ز ت ع و ف د م ل ا ه س ا م ئ ال ع ن ی ل و ا ز و ب ا ب د ع ب ز و ج ن پ. د ی د گ د ص د 2/5 م ی س ا ت پ ت ا م و ک ی ب ت و ا ج م د و ی و آ ع م ج ه ا گ ش ی ا م ز آ ل ق ت ن م. د ی د گ س پ ز ا ه ی ه ت ش ت س گ و ک ذ ی ا ه ش ش و ه د ش ح ال ص ا ن و س ل ن ل ی ذ ی ز ی م آ گ ن ه د ش ی ل و ک ل و م د ال ا ب و ض ح ت س ی س و و ا ز و ز ا. د ش د ی ی ا ت ع و ف د م د م و و ا پ م و ی د ی و پ س و ت پ ی ک ي و آ ع م ج ه ب م ا د ق ا گی د و ل آ ز ا س پ ز و 1 1 ا ت م ج ن پ د د ص د 2/5 ت ا م و ک ی ب ت و ا ج م د و گدید مدفوع ی ا م د 4 C ی ا د ه گ ن. د ش ا ه ت س ی س و و ا ا ب ز ا ه د ا ف ت س ا

4 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 8 7 ی ا ه ش و ف ل ت خ م ز ا ع و ف د م ج ا خ ت س ا و ص ی ل خ ت ع و ف د م د و ب ال ا ب ع و ف د م ی ب چ ه ک ی د ا و م د. د ی د گ ی و آ ع م ج ه د ش د ت و ا ج م. د ن د ش ه د ا د ا ق ت ا و د ص د ی ا ه ش و ف ل ت خ م ص ل ا خ ت ا م و ک ی ب ی ز ا س ع و ف د م ز ا م و و ا پ م و ی د ی و پ س و ت پ ی ک ه ن و م ن ه د ش ی و آ ع ع ع م ج ع ع ع و ف د م ز و دی ی و پ س و ت پ ی ک تجبیبه بهوش م ی س ا ت پ 2/5 م ج ح ب ا ب 3 ه ا م ش ز ا ل ص ا ح ت د م آب ط و ل خ م و ا ب خ آ ك ل ا ه د ا د و ب ع ت س ی س و و ا ه ک ی ا ه ه ه ه ه ل ا س و گ ز ا ا ب د ش ه د و ل آ از ب ي ت ت ه ب ل و ل ح م. د ش ي ا اا كه ك ك ك ك ك ك ل ا ه ب ه ق ي ق د د و د ص ی ل خ ت ز ا ل ب ق د ش ژ و يف ت ن ا س ه ق ي ق د 0 1 د ه ن و م ن ز ا ی ی ا ی ت ک ا ب ت ش ک ط ی ح م. د ی د گ ش ا م ش ل ص ا ح ی ا ا یه ی ی ی ن و ل ک و ت ف ی ذ پ به ت ي ا ه ن م ا ج ن ا LB د ای اا ا ا ته تت ت ت س ی سس س س س س س س س س س سس س س س س س و و ا ج ا خ ت س ا و ظ ن م د و م زی ای ا ا شه و م و و ا پ م م م م و ی د ی و پ س و ت پ ی ک ت: ف گ ا ق ه د ا ف ت س ا 1 سازی- خالص ع: ا ب ش ا ک م ن ب آ ز ا ه د ا ف ت س ا ا ب م و و ا پ کیپتوسپویدیوم ت س ی س و و ا ز ا م ج ح ک ی ) ( ن ا ا ک م ه و و ی ل ش و ق ب ا ط م 1 ا ب ت س ی س و و ا حاوی مدفوع ه ن و م ن م 0 ج ح ع ا ب ش ا ل و ل ح م ه ب ب آ م ج ح ک ی و ط و ل خ م ) م ا ع ط ک م ن ( م ی د س د ی ل ک ی م ا آ ی و ن آ ا ق ه د ا د. د ش ه ب ت د م g ط ق م و.0 گدید سانتیفوژ ی ال ا ب ل و ل ح م ه ق ی ق د و ب آ ی ز ه ی ال ( ی ن ا ی م ت م س ق ب آ ک م ن ) ع ا ب ش ا ی و ا ح و ph= 7/2 ا ب PBS ا ب ه ک د و ب ه د ش ا د ج ی ا ه ت س ی س و و ا ت ح ت g ه ب ت د م ه د ه ق ی ق د ژ و ف ی ت ن ا س د ی د گ ت م و ت ی س و م ه ج د م م ال ی و ب ا ه ت س ی س و و ا د ا د ع ت. ) 2 2 ( و ش ا م ش ی و ن پ و ک س و ک ی م ب ا ب 0 4 ی ی ا م ن ت ش د ا ب حجم شده شماش اووسیستهای ن ا ز ی م ( ل و م ف ق ب ط ز ا ت ی ا ه ن د گدید. محاسبه ) ا ز ه ه د ظ ن د و م ه ن و م ن ل ی ذ ش و ه ب و ه ی ه ت ش ت س گ ه د ش ا د ج ی ا ه ت س ی س و و ا ز ا س پ. د ی د گ ی ز ی م آ گ ن م گ و ه د ش ح ال ص ا ن و س ل ن ص ی ل خ ت ت ش ک ی ی ا ی ت ک ا ب ه ن و م ن د ط ی ح م د. ی د گ ش ا م ش ل ص ا ح ای ه نی و ل ک و ت ف ی ذ پ LB 2 سازی- خالص ع: ا ب ش ا ز ا ک ا س ز ا ه د ا ف ت س ا ز ا م ا ج ن ا ا ب م و و ا پ کیپتوسپویدیوم ت س ی س و و ا ت ی ل ی ل ی م 5 ) ( ن ا ا ک م ه و ت ن ک ش و ق ب ا ط م ب و س ز ا ک ا س ع ا ب ش ا ی و ا ح ه ب ت س ی س و و ا ی ب و خ ا ب ط و ل خ م 0 3 و ی ل ی م ت ح ت ت ی ل ل و ل ح م g ه ب ا ب ا ه چ ل م ع ن ی ا. د ی د گ ژ و ف ی ت ن ا س ه ق ی ق د 0 2 ت د م ی و ا ط ق م ب آ ت ی ل ی ل ی م ک ی ا ب ه و گدید تکا ا ب ل و ل ح م ح ط س ز ا ا ه ت س ی س و و ا و ه ت خ ی ز ا ک ا س ل و ل ح م ت پ ی پ ه ت خ ی و ت س ا پ د ش و ه ب ی و آ ع م ج ت د م ه د ز ن ا پ ن و د ه ق ی ق د PBS (ph=7.2) و ت ح ت g ش و د ه چ ن آ د ن ن ا م ت ی ا ه ن د. ) )2 د ی د گ ژ و ف ی ت ن ا س گدید. شماش اووسیستها شد بیان ع ا ب ش ا ک م ن ب آ ل ی ذ ش و ه ب و ه ی ه ت ش ت س گ ه د ش ا د ج ی ا ه ت س ی س و و ا ز ا ز ا س پ. د ی د گ ی ز ی م آ گ ن م گ و ه د ش ح ال ص ا ن و س ل ن ص ی ل خ ت ت ش ک ی ی ا ی ت ک ا ب ه ن و م ن د ط ی ح م د. ی د گ ش ا م ش ل ص ا ح ای ه نی و ل ک و ت ف ی ذ پ LB 3 سازی- خالص م ا ج ن ا ا ب م و و ا پ کیپتوسپویدیوم ت س ی س و و ا کل: ی ا ف ی ن ا ک ل پ ی ت ظ ل غ ب ی ش ز ا ه د ا ف ت س ا ق ب ا ط م ش و ب م ال و ) ( ن ا ا ک م ه ی ا ه م ج ح ز ا ب ی ت ت ه ب د ص د و /5 ل و ک ی ا ف ز ا ب ا ب ت ظ ل غ 0/5 د ص د ا ت د ص د ی و ک ی م ج ح ع ی ا م ب ی ت ت ن ی د ب و د ش ه د ا د ا ق ی م ا آ ه ب ت س ی س و و ا ی و ا ح س پ س. د ی د گ د ا ج ی ا ی ن ا ک ل پ ی ت ظ ل غ ب ی ش ا ب ن و ت س ک ی ژ و ف ی ت ن ا س ق ا ت ا ی ا م د د ه ق ی ق د 0 ت د م ه ب g ت ح ت. د ی د گ ا ه ت س ی س و و ا د ه ی ال ل و ک ی ا ف 0/5 د ص د د ن ا ب و ی و آ ع م ج ا ه ه ی ال ه ن ا گ ا د ج و ط ه ب ه ک د ن د ا د ل ی ک ش ت

5 ی 0 ل ی م ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ی س ب. د ی د گ و ه ه ی ال ه ن ا گ ا د ج ا ب PBS ل ی ت س ا ا ب ه س و ژ و ف ی ت ن ا س g ت ح ت ph= 7/2 ی ا ا د ش و د ه چ ن آ د ن ن ا م ت ی ا ه ن د. ) 0 1 ( د ش ه د ا د و ش ت س ش د. ی د گ ش ا م ش ا ه ت س ی س و و ا د ش ن ا ی ب ع ا ب ش ا ک م ن ب آ ل ی ذ ش و ه ب و ه ی ه ت ش ت س گ ه د ش ا د ج ی ا ه ت س ی س و و ا ز ا ز ا س پ. د ی د گ ی ز ی م آ گ ن م گ و ه د ش ح ال ص ا ن و س ل ن ص ی ل خ ت ت ش ک ی ی ا ی ت ک ا ب ه ن و م ن د ط ی ح م د. ی د گ ش ا م ش ل ص ا ح ای ه نی و ل ک و ت ف ی ذ پ LB 4 سازی- خالص م ا ج ن ا ا ب م و و ا پ کیپتوسپویدیوم ت س ی س و و ا ه: د ش ح ال ص ا د ص د 5 5 ز ا ک ا س ل و ل ح م ز ا ه د ا ف ت س ا ا ب ) ( ن ا ا ک م ه و ت ن ی و ش و ز ا و ظ ن م ن ی ا ی ا ب ا ب ا ب ه س ا ت و د ع و ف د م ه ن و م ن. د ش ه د ا ف ت س ا ت ا ی ی غ ت ی م ک ه ق ی ق د ه د ت د م ه ب g 0 ت ح ت PBS (ph=7.2) 0 5 ن و ک ل ا ف د چبی زدودن ی ا ب سپس. شد سانتیفوژ 1 ی ت ی ل ی ل ی م ه و ال ع ب ت ا م ج ح ک ی ا ب ه ن و م ن ز ا ت ی ل. د ش ط و ل خ م ب و خ د ص د 1 م ی د س ت ا ن ب ک ی ب م ج ح ه س ه ی ال. د ی د گ ژ و ف ی ت ن ا س g 0 ت ح ت ه ق ی ق د 0 1 ت د م ه ب و د ش ه ت خ ی و د ف ظ ی ال ا ب ت م س ق د د و ج و م ی ب چ ه ی ال ب و س ه گ ن ه ت ش ا د. د ش د ت و ص ب چ ن د و ب ت ا ن د و د ز ی ا ب. د ش ی م ا ک ت ه ا ب و د ه ل ح م ن ی ا ع و ف د م ت ه ج Tris-EDTA ف ا ب ز ا ه د ن ا م ی ق ا ب ی ب چ ن د و د ز و ه ق ی ق د ه د ت د م ه ب g 0 ت ح ت و ه د ا ف ت س ا و ش ت س ش و ژ و ف ی ت ن ا س ی ل ی م. ) 9 1 ( د ش ا ک ت ه ل ح م ن ی م ه ه ا ب و د 0 4 ا ب ه ل ص ا ح ت س ی س و و ا ی و ا ح ع ی ا م ز ا ت ی ل ی ل ی م 5 ت ی ل ز ا ک ا س 5 5 د ص د ک ن خ ب و خ ط و ل خ م ی م ا آ ه ب خنک بسیا ط ق م ب آ ت ی ل ی ل ی م 0 1 و د ی د گ ظف. شد تشکیل جدا قسمت و د و شد یخته ن آ ی و ه ق ی ق د 0 2 ت د م ه ب g 0 ت ح ت ژ و ف ی ت ن ا س د ی م ا آ ه ب ا ق ط ق م ه د ا د د. د ش ت م س ق ه س ت م س ق ال ا ب ه ی ال ال م ا ک ی ن ا ی م ا د ج ل م ا ش ل م ا ش ه ی ال ب آ ی ا ه ت س ی س و و ا ه. د ش ل ی ک ش ت ه ل و ل ه ت د ب و س ه ی ال و ه د ش و ا ن ش PBS (ph=7.2) ا ب ه ن ا گ ا د ج و ط ه ب ا ه ت م س ق ز ا م ا د ک. ) 3 2 ( د ش ژ و ف ی ت ن ا س ه ق ی ق د ه د ت د م ه ب g 0 ت ح ت ی ا ه ت س ی س و و ا ه ت م س ق ه ب ت و ص ه ن ا گ ا د ج ک م ن ب آ ش و د ه چ ن آ د ن ن ا م ت ی ا ه ن د و ی و آ ع م ج ع ا ب ش ا ن ا ی ب د ش ا ه ت س ی س و و ا ش ا م ش د. ن د ی د گ ز ا ل ی ذ ش و ه ب و ه ی ه ت ش ت س گ ه د ش ا د ج ی ا ه ت س ی س و و ا ز ا س پ. د ی د گ ی ز ی م آ گ ن م گ و ه د ش ح ال ص ا ن و س ل ن ص ی ل خ ت ت ش ک ی ی ا ی ت ک ا ب ه ن و م ن د ط ی ح م د. ی د گ ش ا م ش ل ص ا ح ای ه نی و ل ک و ت ف ی ذ پ LB 5- ه د ا ف ت س ا ای ه ی ت ک ا ب م: و و ا پ ز ا ه ا م ه ای ه ش و ا ب ی ل ی م ک ت ت ه ج م ا ج ن ا ش ه ا ک م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا ی ا ه ت س ی س و و ا ا ب ه ا م ه ی ا ه ی ت ک ا ب ش ه ا ک و ظ ن م ه ب ف ا ب ز ا ه د ا ف ت س ا ش و ه س ز ا م و و ا پ م و ی د ی و پ س و ت پ ی ک ه د ن ن ک ز ی ل ن و ی س ا ت ل ی ف ی ت ک ا ب ه د ا ف ت س ا ه د ا ف ت س ا. د ش د ز ا ک ی ت و ی ب ی ت ن آ ش و ه د ا ف ت س ا ث و م ز ا و ف ا ب ت س ی س و و ا ی و ا ح ب و س ی ز ا س و ا ن ش ز ا ل ب ق ه د ن ن ک ز ی ل ق ی ق م ی د س ت ی ل ک و پ ی ه ا ب م و و ا پ م و ی د ی و پ س و ت پ ی ک ا ب ه س ه ق ی ق د 0 1 ز ا د ع ب و و ا ج م 0 1 ه ب 1 ت ب س ن ه ب ه د ش ا ب ب و س ن گ م ه ط و ل خ م س پ س. د ی د گ م ا ج ن ا و ش ت س ش MBST ت ی ل و ک ی م و 5 2 ف ا ب ه د ن ن ک ز ی ل ت ی ل و ک ی م ی ت ک ا ب TritonX و ت خ ا س 0 2 ت ک ش ت ی ل و ک ی م 7 3 ی ا م ن ب د ه ق ی ق د 0 3 ت د م ه ب ) 10mg/ml( م و ز و ز ی ل ت ی ل ی ل ی م 4 ه م ا د ا د. د ش ه د ا د ا ق د ا گ ی ت ن ا س ه ج د ن گ م ه ط و ل خ م ز ا ت ی ل ی ل ی م 2 ی و ی م ا آ ه ب ل و ک ی ا ف ا ق ه د ا د د ش و ه ب ت د م 0 3 ه ق ی ق د ت ح ت g ه. د و ب ه ی ال ه س شامل حاصل محلول. گدید سانتیفوژ م ا د ک و ش ت س ش ز ا ا ه ه ی ال ه د ا د ه ب. د ش و ط ه ن ا گ ا د ج ای ه ت س ی س و و ا ا ب PBS (ph=7.2) ی و آ ع م ج ه د ش ب. د ی د گ ه ب س ا ح م و ش ا م ش ت م و ت ی س و م ه ج د م م ال وی ی ز ی م آ گ ن جهت یکی ش ت س گ و د ا ه ت س ی س و و ا ن ی ا ز ا

6 ) ی و ص ت 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 0 8 م گ ی ز ی م آ گ ن ی گ ی د و ه د ش ح ال ص ا ن و س ل ن ل ی ذ ه ب. د و ب ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا گ ی د ش و. گدید تهیه ی ت ن آ و ت ش ک ت س ی س و و ا ی و ا ح ل و ل ح م ز ا و ظ ن م ن ی ا ) Disk diffusion( ن ژ و ف ی د ک س ی د ش و ه ب م ا گ و ی ب ی ت ن آ. ت ف گ م ا ج ن ا ی س ا ن ش ب و ک ی م ه ا گ ش ی ا م ز آ ط س و ت ن و س ک ا ی ت ف س ل م ا ش ه د ا ف ت س ا د و م ی ا ه ک ی ت و ی ب و )Ciprofloxacin( ن ی س ا س ک و ل ف و پ ی س ) Ceftriaxone( ن ا و ن ع ه ب ن و س ک ا ی ت ف س. د و ب ) Ceftazidime( م ی د ی ز ا ت ف س ط ق م ب آ ت ی ل ی ل ی م 9. شد انتخاب حساس بیوتیک ی ت ن آ ک ی ت و ی ب ی ت ن آ د و پ ی م گ ک ی ل ا ی و ا ب ا ل ی ت س ا ن ا ی ح ن ب ب ا ج ی ز ا س و ا د ت ک ش ت خ ا س س ک ا ت ف س ی و ا ح ل و ل ح م ز ا ت ی ل و ک ی م د و د ح و ط و ل خ م ه ب ک ح ت م صفحه وی و ه د ک ه ف ا ض ا ن آ ه ب ت س ی س و و ا. د ش ه د ا د ا ق ه ا گ ش ی ا م ز آ ی ا م د د ب ش ک ی ت د م ز ا ه ل ح م ن ی ا ز ا د ع ب و ل ب ق و د ش م ا ج ن ا و ش ت س ش س پ س ی ز ی م آ گ ن و ه ی ه ت ش ت س گ ت س ی س و و ا ی و ا ح ل و ل ح م م و س ش و. ت ف گ ت و ص ی ی ا ی ت ک ا ب ت ش ک و م گ. د و ب ن و ی س ا ت ل ی ف ز ا ه د ا ف ت س ا ه ن و م ن ز ا ی ت ک ا ب ن د و د ز ت ه ج و ت ن ی و ش و ز ا ه د ا ف ت س ا ا ب ه ی ل و ا ی ز ا س ص ل ا خ ز ا س پ. د ش ه د ا ف ت س ا ز ل و ل س و ت ی ن ت ل ی ف ز ا 0( ( ن ا ا ک م ه ق ی ق PBS (ph=7.2) ت ی ل ی ل ی م 0 1 د ا ه ت س ی س و و ا ه د ش س ک ی ف ن آ ه د ن ا د ه گ ن د ه ک ت ل ی ف ز ا و ه د ی د گ ز ا PBS (ph=7.2) ت ی ل ی ل ی م 0 5. د ش ه د ا د و ب ع د و ب ن ا ش ه ز ا د ن ا ه ط س ا و ه ب ا ه ت س ی س و و ا د ش ه د ا د و ب ع ت ل ی ف. د ن د ک و ب ع ا ه ی ت ک ا ب و د ن د ن ا م ت ل ی ف ی و و PBS (ph=7.2) ک م ک ه ب ت ل ی ف ی و ی ا ه ت س ی س و و ا و ب ع ع ی ا م. د ش ی و آ ع م ج ت ق د ا ب و ی م ا آ ه ب ل پ م س ی ل ی م 0 1 ا ب م ه ت ل ی ف. گدید جمعآوی نیز ت ل ی ف ز ا ه د ک ی و ل ی ت س ا ف ظ ک ی د PBS (ph=7.2) ت ی ل ز ا ا ه ت س ی س و و ا ه د ن ا م ی ق ا ب ا ت د ش ه د ا د ا ق ن ا ز ل ه ح ف ص ه ک ن ی ا ز ا ن ا ن ی م ط ا ی ا ب س پ س. د ن و ش ا د ج ت ل ی ف ا ه ت س ی س و و ا د ی ا ه ذ ف ن م ت ل ی ف ی ق ا ب د ن ن ا م ن ا ب و ه د ا د ا ق ه د ن ا د ه گ ن د ل ب ق حالت بعکس ت ل ی ف ا PBS (ph=7.2) ی و ش ت س ش س و ک ع م م ا ج ن ا. د ی د گ د ا د ع ت م ال وی ب ه ل ح م ه ز ا ه د ش عآوی م ج ای ه ت س ی س و و ا ج د م ت م و ت ی س و م ه ش ا م ش و ه ب س ا ح م. د ی د گ ز ا ن ی ا ل ی ذ ی ز ی م آ گ ن ت ه ج ی ک ی ش ت س گ و د ا ه ت س ی س و و ا ه ی ه ت م گ ی ز ی م آ گ ن ی گ ی د و ه د ش ح ال ص ا ن و س ل ن د. ی د گ ج ی ا ت ن ه ب ک و ک ش م ی ل ا ه س ا ی ا ه ه ل ا س و گ ع و ف د م ی ا ه ه ن و م ن ز ا ز و ی د ی و پ س و ت پ ی ک ه ا گ ش ی ا م ز آ د ل گ ن ا ی س ا ن ش ش ت س گ ی ز ی م آ گ ن ه د ش ح ال ص ا ن و س ل ن ل ی ذ ش و ه ب و ه ی ه ت 4 د ا ع ب ا ه ب ی و ک م ا س ج ا صوت به ا ه ت س ی س و و ا. د ی د گ گدید مشاهده سبز زمینه د ز م ق گ ن ه ب ن و ک ی م ا ت ی ت ب ث م ی ی ا م ن ه ک ی ا ه ه ن و م ن ز ا ا ه ت س ی س و و ا ج ا خ ت س ا. 1( ه ا م ش د ص د ه ب ا ب ن ا د ی م ی ا ا د د ی د 4-5 پ و ک س و ک ی م د د ع ا ب ت س ی س و و ا گ ز ب د ن د و ب م ی ا پ و د ا ب DNA ی ا ه ی ج ن ز ش ن ك ا و د. د ی د گ م ا ج ن ا د ن د و ب ه د ش ی ح ا ط 18S rrna ن ژ ز ا ه ک R1 و F1 ز ا ه ک د م آ ت س د ه ب ز ا ب ت ف ج ه ز ا د ن ا ه ب لی و ص ح م ظ ا ح ل ا ه م ی ا پ و د ه ز ا د ن ا و ا ب ه ع ط ق د ا د ع ت ن ی ب ی ا ه د ی ت و ئ ل ک و ن ا ه ن آ ی ب ا ب ه ل ک ش ت م. ت ش ا د ز ا ای ب لی ا و ت ن ی ی ع ت ا ب DNA ک م ی ث ک ت ش و ز ا م و ی د ی و پ س و ت پ ی ک ه ن و گ م ی ا پ F2 و R1 ه د ا ف ت س ا د ي د گ ه ك ه ج ي ت ن ن ی ا ی و ص ت ( د و ب ز ا ب ت ف ج ه ز ا د ن ا ه ب لی و ص ح م واکنش 2(. ه ا م ش ق ی ط ن ی ا ه ب م و و ا پ م و ی د ی و پ س و ت پ ی ک تهای س ی س و و ا ه د ا د ص ی خ ش ت و ک ذ م ت ا ش ی ا م ز آ م ا ج ن ا ا ب ن ا ی ا ه ی ا د ج م ج ن پ ز و ز ا ی ب ج ت ش و ه ب ه د ش ه د و ل آ ه ل ا س و گ. د ش س پ ز ا ه د و ل آ ی ز ا س ع و ش ه ب ع ف د ت س ی س و و ا

7 .) ) 1 ه ا م ش ی و ص ت ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ز و ت ف ه ل و ط د و د و م ن م و و ا پ م و ی د ی و پ س و ت پ ی ک ه ل ا س و گ ع و ف د م ز ا ت س ی س و و ا ن و ی ل ی م د و د ح ی ل ا و ت م ی و آ ع م ج. د ی د گ ای ه ت س ی س و و ا ص ی ل خ ت ه د ش ز ا ی ب ا ی ز ا د و م ي ك ي ت ن ژ ل ت ن ك ت ه ج ه د ش ه د و ل آ ه ل ا س و گ و ط ن ا م ه و گفت قا PCR ش و ا ب ي ل و ك ل و م د د ج م ه ك د ش ه د ا د ن ا ش ن و د ي ي ا ت ي ل ب ق ج ي ا ت ن ت ف ي م ا ظ ت ن ا ه ك ي ا ه ت س ي س و و ا. د ن د و ب م و و ا پ د ق ی ق ح ت ع ف د ض ا ح ه د ش ط و ب م ای ه ش و م و ی د ی و پ س و ت پ ی ک ه ب ف ل ت خ م ل م ا ش م و و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا ص ل ا خ زی ا س ای ه ش و تی ظ ل غ شیب اشباع ز ا ک ا س ع ا ب ش ا ک م ن ب آ ز ا ه د ا ف ت س ا نی ا ک ل پ ح ال ص ا ل ک ی ا ف ه د ش و ه د ا ف ت س ا و ا ن ش زی ا س. د ی د گ ا ب ا ب ز ا ک ا س ه ج و ت ه ب 5 5 ال ا ب د ص د ن د و ب ی س ب د و م ع و ف د م ی ا ه ه ن و م ن د ی ی ا ی ت ک ا ب ی گ د و ل آ ش ال ت د ی د گ ت ه ج ش ه ا ک ای ه ی ت ک ا ب ه ا م ه ز ی ل ف ا ب ز ا ه د ا ف ت س ا د ن ن ا م ی ل ی م ک ت ش و ز ا ا ه ت س ی س و و ا ه د ن ن ک ه د ا ف ت س ا ی ت ک ا ب ز ا ت ل ی ف ه د ا ف ت س ا ز ا ی ز ل و ل س و ت ی ن ی ت ن آ ا ب ک ی ت و ی ب ب س ا ن م و ن و ک ی م 3 ذ ف ا ن م ز ی ا س. د شو ه د ا ف ت س ا ا ه ت س ی س و و ا ص ی ل خ ت و جداسازی ت ه ج ا ه ت س ی س و و ا ز ا ی د ا د ع ت ع ا ب ش ا ک م ن ب آ ش و د و ا ن ش ن ا ز ی م د ن د ش ن ی د ا ی ز و ه ا م ه ل و ل س ی ا ه ت س ی س و و ا و ی ت ک ا ب و ا ن ش د و ج و ه د ش ز ی ن. ت ش ا د گ ن ش و و د ه د ن آ ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا ی ز ی م آ ی ا ا د ن ا ز ی م ی گ د و ل آ ال ا ب ه ب ا ه ی ت ک ا ب و د ا و م و ه د ش و ا ن ش ی ا ه ت س ی س و و ا د ا د ع ت ن ی گ ن ا ی م. د ن د و ب د ئ ا ز ش ا م ش ی ل ا و ت م ه د ش 0 1 ب ی و 7/8 0 5 م ال د ت م و ت ی س و م ه ک ی ی ل ی م د ت ی ل ه س. د و ب ا ک ت د ا د ع ت د ن د ش ن شناو و ه د ن ا م ی ق ا ب ب و س د که اووسیستهایی 0 1 د ی ل ی م ت ی ل. د و ب د ا د ع ت ی ا ه ی ن و ل ک ی ت ک ا ب ت ق د و د د ع : 1 ت ق د شده شماش د و ا ن ش ت س ی س و و ا ه ا م ه ش و د ن د ش ن ز ا ک ا س و ه د ه ا ش م ه ا م ه. د ش ی ا ه ت س ی س و و ا ع ا ب ش ا ب و س ن ی ن چ م ه و ا ن ش ی د ا د ع ت ن ا ز ی م ن ا ز ی م ه د ش ز ا ا ه ت س ی س و و ا ل ب ا ق ی د ا ی ز ه د ه ا ش م ی ه ج و ت ی ت ک ا ب. د ش گ ن ش و و د ه د ن آ ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا ی ز ی م آ ی ا ا د ن ا ز ی م ی گ د و ل آ ال ا ب ه ب ا ه ی ت ک ا ب و د ا و م و ه د ش و ا ن ش ی ا ه ت س ی س و و ا د ا د ع ت ن ی گ ن ا ی م. د ن د و ب د ئ ا ز ش ا م ش ی ل ا و ت م ظ ن ه د ش ب ی و م ال ت م و ت ی س و م ه. د و ب ت ی ل ی ل ی م ک ی د 0 1 د ه س ا ک ت د و م ه ی ال د ل ک ی ا ف ی ن ا ک ل پ ی ت ظ ل غ ب ی ش ش و د ه ی ال ( ت ق 0/5 د ص د ) ل ک ی ا ف ه ب ه ا م ه د و ج و ی د ا ی ز ی ل و ل س ی ا ه ه د و ت و ی ت ک ا ب ا ه ت س ی س و و ا ا ی س ب ی ت ک ا ب ب ه و ال ع م ه ب و س ت م س ق د. ت ش ا د ن ا ز ی م د ه ل ب ا ق و د ی ه ج و ت ت س ی س و و ا د و ج و. ت ش ا د د ن ی ا و ی ل و ل س ی ا ه ه د و ت ز ا ا ه ت س ی س و و ا ه ی ال ک ی ک ف ت ش و ن ی ا ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا. د و ب ا و ش د ا ه ی ت ک ا ب ی ت م ک ز ا ک ا س و د ه ب و ه ب ش و ا ه ی ت ک ا ب ع ا ب ش ا و گ ن و ب آ ی ز ی م آ د ا و م ک م ن د ئ ا ز ی ا ا د د ع ا ب ش ا ن ا ز ی م ه س ی ا ق م. د ن د و ب ی گ د و ل آ ا ب ش و د ا د ع ت د ت م و ت ی س و م ه م ال ی و ب ه د ش ش ا م ش ی ا ه ت س ی س و و ا ا ک ت ی ل ا و ت م د ک ی ی ل ی م ت ی ل د و ب د ن د ش و ا ن ش خوبی به ا ه ت س ی س و و ا ز ا ک ا س ش و د ی و ط ه ک د ب و س ن آ ت س ی س و و ا ل ب ا ق ی ه ج و ت ی ا ه ت س ی س و و ا ا ب ه ا م ه ی ت ک ا ب ن ا ز ی م. د ی د گ ن ه د ه ا ش م د و ب ا ه ش و ی ا س ز ا ت م ک ش و ن ی ا ز ا شده جمعآوی ی ا ه ده و ت ی ل و ل س و ی ل و ل س ا ه ت س ی س و و ا ه د ه ا ش م ه. د ی د گ ن م ا د ک د ا ه ی ت ک ا ب ی ا ه ه ی ال ه د و ت ی ی ا ز ج م ه د ن آ ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا. د ن د ش و ا ن ش ه ب ی گ د و ل آ ن ا ز ی م ن ی ت م ک ی ا ا د ی ز ی م آ گ ن ش و و د. د ن د و ب ل ب ق ش و ه س ا ب ه س ی ا ق م د د ئ ا ز د ا و م و ا ه ی ت ک ا ب. د و ب د د ع : 1

8 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 2 8 ش ا م ش و ه د ش و ا ن ش ی ا ه ت س ی س و و ا د ا د ع ت ن ی گ ن ا ی م 0 1 ی ل ا و ت م ا ک ت ش ش د ت م و ت ی س و م ه م ال ی و ب ه د ش ی ت ک ا ب ی ا ه ی ن و ل ک د ا د ع ت. د و ب ت ی ل ی ل ی م ک ی د 0 4 ی و ص ت ( د و ب د د ع ک ی : 1 ت ق د ه د ش ش ا م ش. ) 1 ه ا م ش ی ا ه ت س ی س و و ا ا ب ه ا م ه ی ا ه ی ت ک ا ب ش ه ا ک و ظ ن م ه ب ز ی ل ف ا ب ز ا ه د ا ف ت س ا د ن ن ا م ی ب ن ا ج ی ا ه ش و ز ا ه د ش ص ی ل خ ت ه د ا ف ت س ا ن و ی س ا ت ل ی ف و ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا ه د ن ن ک ن ت ف ن ی ب ز ا ث ع ا ب د ن چ ه ه د ن ن ک ز ی ل ف ا ب ز ا ه د ا ف ت س ا. د ش ن ا ک م ا ص ی ل خ ت ل ح ا م ی ط د ا م ا د ش ا ه ی ت ک ا ب ش و د. د ش ن س ی م ا ه ت س ی س و و ا ز ا ا ه ن آ الشه جداسازی ای ه ش ت س گ د س ک ا ت ف س ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا ز ا د ع ب و ل ب ق شده آمیزی گ ن ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا ز ا س پ ا ه ی ت ک ا ب ل ک ش ی ی غ ت ه ی ل و ا ه ز ا د ن ا ز ا ی م ک ا ه ت س ی س و و ا و د و ب ح ض ا و پ و ک س و ک ی م ی س ب د و د ن د و ب ه د ش ت ک چ و ک ا ه ت س ی س و و ا ا د ج ل ک ش ی ی غ ت و ب ی خ ت ی ن و ت ک ل ا د ی پ و ک س و ک ی م ن و ت ک ل ا ش ی ا م ز آ ( د ی د گ ه د ه ا ش م ن ا م ل آ خ ی ن و م ه ا گ ش ن ا د ی ک ش ز پ م و ل ع ه د ک ش ن ا د ه ا گ ش ی ا م ز آ ش و د. ) د ش م ا ج ن ا ی ی ا ب ی ک ش ی د ه م ت ک د ظ ن ی ز ا ه ت س ی س و و ا ی گ د و ل آ ن ا ز ی م ظ ن ز ا ن و ی س ا ت ل ی ف ز ا ه د ا ف ت س ا ی ت ک ا ب ز ا ی ا ع ت ل ی ف ی و ی ا ه ت س ی س و و ا ی ت ک ا ب ه ب ت ل ی ف س و ک ع م ی و ش ت س ش ز ا ل ص ا ح ی ا ه ت س ی س و و ا و د ا د ع ت ش و ن ی ا د. د ن ت ش ا د ی ت ک ا ب ه ب ط س و ت م ی گ د و ل آ ز ا ب د ص د و ه د ا ت ف ا ی گ ت ل ی ف ن و د ا ه ت س ی س و و ا ز ا ی د ا ی ز. د ش ه ب س ا ح م د ص د 0 3 ا ه ت س ی س و و ا ت ف ا ی ل. ک ی ا ف ی ن ا ک ل پ ی ت ظ ل غ ب ی ش و د ص د 5 5 ز ا ک ا س ش و ه ب م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ج ا خ ت س ا ه س ی ا ق م : 1 ی و ص ت ت س ی س وو ا ا ب ه ا م ه ی ا ه ی ت ک ا ب ی س ب و ظ ن م ه ب د ص د 0/5 ل ک ی ا ف الیه گم ی ز ی م آ گ ن 2-. ی ز ا س خالص از ل ب ق ع و ف د م ه ن و م ن ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن 1- و ه د ش ن شناو که هستند ی ی ا ه ت س ی س و و ا گ ن ی ب ا ی و کمنگ صوتی نگ ه ب کوی اجام ل ک ی ا ف ش و ز ا حاصل سوب گم آمیزی گ ن 3-. م و و ا پ م و ی د ی و پ س و ت پ ی ک ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن 5-. د ه د ی م ن ا ش ن ا ل ک ی ا ف ش و ز ا حاصل اووسیست ی و ا ح ه ی ال ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن 4-. د ن و ش ی م ه د ه ا ش م ب و س د ی و ا ح ه ی ال ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن 7-. د ص د 5 5 ز ا ک ا س ش و ز ا حاصل سوب ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن -. ل ک ی ا ف ش و ز ا حاصل سوب. ت ل ی ف ق ی ط ز ا ص ی ل خ ت ز ا د ع ب ت س ی س و و ا 8-. د ش ا ب ی م % 5 5 ز ا ک ا س ش و ز ا ل ص ا ح ت س ی س و و ا

9 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م س پ س و ) 3 د ن ا ب ( د ن د ش ه د ا د ی ث ک ت,F1) (R1 ی ص ا ص ت خ ا ی ا ه م ی ا پ ا ب ا د ت ب ا م و پاو م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ز ا ه د ش ج ا خ ت س ا DNA 2: ی و ص ت. د ش ا ب ی م DNA 100bp ک ا م 1 د ن ا ب. ) 2 د ن ا ب ( د ش ه د ا د ی ث ک ت,F2) (R1 ی ا ه م ی ا پ ا ب PCR ل و ص ح م م و و ا پ م و ی د ی و پ س و ت پ ی ک ه ن و گ ن ی ی ع ت ت ه ج ی ی گ ه ج ی ت ن و ث ح ب م و ی د ی و پ س و ت پ ی ک ک ت ی ا ه ت خ ا ی ز ا ه خ ا ش پی ا ث ک ا ی ا ه د و سلولهای مسواکی ه ی ال ه ک ت س ا ا س ک ل پ م ک ن ا ا د ه ه م ا ز و ی د ی و پ س و ت پ ی ک م ت س ی س ی ن م ی ا د و م د ت ی م ه ا ن ا ک د و ک ا ی س ب م ج ا ه ت. د ا د و د ا ف ا د ا ق ل ا س ی ا ا د د ه د ی م ص ق ن ه م ه د و د ح ه ک د ا د خ ه د ح ت م ت ال ا ی ا ی ک ا و ل ی م ه ش د ی ی گ ه د و ل آ شه آشامیدنی ب آ سیستم طیق از ف ن ا ز ه د ن د ش ا و د و م گ م ش ا ز گ د ی د گ )8 و. ) 1 ی ش ا ن ی م و گ م ن ا ز ی م ) ( ن ا ا ک م ه و ا ک س ن ی ز ا ک ی ن م ی ا م ت س ی س ص ق ن ا ب د ا ف ا د س ی ز و ی د ی و پ س و ت پ ی ک ز ا 0 5 د ص د ک ذ م و و ا پ م و ی د ی و پ س و ت پ ی ک. د ن د ک د ه ک ت س ا ا ذ غ و ب آ ق ی ط ز ا ه ل ق ت ن م ی ا ه ت خ ا ی ک ت. ) )1 د ا د ی د ا ی ز ت ی م ه ا ی ک ش ز پ م ا د و ی ک ش ز پ س ی ز و ی د ی و پ س و ت پ ی ک ی د ا ی ز د ا ج ی ا. د ن ک ی م د ی ا ه ه ل ا س و گ ا ه ی ا د و ا گ ه ز ا ت د ل و ت م ت ا ا س خ ه د ش ه ب ع و ف د م ه ا م ه ت س ی س و و ا ن و ی ل ی ب 0 3 ا ت و حساسند عفونت ع ف د. د ن ن ک ی م د ه ع ل ا ط م ت ا ک س ا و ن ا ا ک م ه د ل ا س ی ا ه و ا گ ع و ف د م م گ ه د ت س ی س و و ا ا ت ا ه ت س ی س و و ا ع ف د. ت س ا ه د ش ش ا ز گ م ل ا س ه ا ظ ه ب غ ل ا ب ث ع ا ب ی گ د و ل آ ی گ د و ل آ ه ب ی ا س ط ی ح م ا ه م ا د و و ع ب ا ن م ن ا س ن ا ب آ د ه ا و خ ی ح ط س. د ش و ل ا ق ت ن ا ت ا ع ل ا ط م د ت س ی س و و ا ک د ن ا ا ی س ب د ا د ع ت ی ی ا س ا ن ش جهت زیادی سطحی آبهای ع ب ا ن م خصوص به ط ی ح م و ا ه م ا د ع و ف د م م ا ج ن ا ه د ش ت س ا. ) )1 ت ی ه ا م ت خ س و م و ا ق م ضدعفونی اکث ه ب ه ک م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا ی ا ه ه د ن ن ک ل و ا د ت م د ن م و ا ق م ع ف د ی د ا ق م ل ب ا ق ه ج و ت ه ک م ل ا س ه ا ظ ه ب ی ت ح ا ی ا م ی ب ی ا ه م ا د ط س و ت ت س ی س و و ا ن ا م د د و ج و م د ع و د و ش ی م ط ی ح م ی ز ا س ه د و ل آ ه ب ج ن م

10 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 4 8 ا ق ن ی ق ق ح م ه ج و ت ز ک م د ا ه ت خ ا ی ک ت ن ی ا ی ع ط ق ی ا ه ش و ی و ب ت ا ق ی ق ح ت ه ک ن ی ا م غ ی ل ع. ت س ا ه د ا د ف ل ت خ م ج ا خ ت س ا م و و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا شوع قبل سالها از ی ط ی ح م ی ا ه ه ن و م ن ی ا س و ع و ف د م ز ا ه ک ی ی ا ه ش و ه ب ی ب ا ی ت س د ت ه ج ا ه ش ال ت ت س ا ه د ش ه و ال ع ب ت ف ا ی ز ا ب د ا د ع ت ی ال ا ب ت س ی س و و ا ج ت ن م ه ب ن ا ن چ م ه د و ش ی ت ک ا ب ز ا ی ا ع ی ی ا ه ت س ی س و و ا ج ا خ ت س ا ه م ا د ا ه ب. د ا د ه ب و ظ ن م م ا ج ن ا ت ش ک ک ت ه ت خ ا ی ی ب ا ی ت س د س ک ی م و ئ ت و پ ت ا ع ل ا ط م و م و ی د ی و پ س و ت پ ی ک د ا د ع ت ا ه ی ص ل ا خ ا ن ا ه ی ت ک ا ب ا ذ ل ی د ا ی ز ه ب ی و ض ت س ی س و و ا ی ا د ه گ ن. د ش ا ب ی م ی ا ع نی ال و ط ز ا ن ی ن چ م ه ت د م ی ت ک ا ب ش ه ا ک و ی ا س د ا د ع ت ای ه ت س ی س و و ا ه ک ن ی ا ه ب ه ج و ت ا ب. د ن ک ی م ک م ک م و ی د ی و پ س و ت پ ی ک ه ن و م ن ز ا شده استخاج کیپتوسپویدیوم ای ه ت س ی اووس د ن ش ا ب ی م ه ا م ه ی د ا ی ز ای ه گی د و ل آ ا ب ه ا و م ه ع و ف د م ش و د و م. د ش ا ب ا ه ی گ د و ل آ ت ا ع ل ا ط م د و ج و م ه د ا ف ت س ا ن ا ش ن د ی ا ب ه د ا د د ا ق ت س ا ه ب ف ذ ح ی ا ب ن ی ا ل و ص ح ت ا ع ل ا ط م جهت مناسب ت ی ف ی ک و ت ی م ک ا ب ی ی ا ه ن ی ئ ت و پ س ک ی م و ئ ت و پ م و ی د ی و پ س و ت پ ی ک ل ق ا د ح ت ی ف ی ک. ) 1 ( ت س ا ز ا ی ن د و م ص ل ا خ ال م ا ک ت س ی س و و ا ه د ا ف ت س ا ب ه و ال ع ع و ف د م ز ا ه د ش ص ی ل خ ت ی ا ه ت س ی س و و ا ه ن و م ن ه ی ل و ا ی گ د و ل آ ن ا ز ی م ه ب ص ی ل خ ت ب س ا ن م ش و ز ا ی گ ت س ب ه د و ل آ ه ل ا س و گ ز ا ی ا د ب ه ن و م ن ش و و ع و ف د م. د ا د ه ب ن ی ا و ظ ن م د ت ا ق ی ق ح ت د ی ا ب ز ا ش و ه د و ل آ د ک ی ت و ی ب ی ت ن آ ز ی و ج ت ا ب ه ا م ه ه ل ا س و گ ی ب ج ت ی ز ا س ت س ی س و و ا ی ال ا ب د ا د ع ت ه ب ی ب ا ی ت س د و ظ ن م ه ب ز ی م ت ی ط ی ح م ه د ا ف ت س ا. د و م ن ذ خ ا ه ن و م ن ز ا ه ل ا س و گ ه د و ل آ د ی ا ب ا ب م ا ج ن ا ف ا ط ا ط ی ح م ا ب س ا م ت ن و د ب و ل ا ت ک ش ی ا م ز آ ب د و ج و م ع و ف د م ی ا ه ه ن و م ن ی و آ ع م ج ز ا ی ت س ی ا ب. د و ش ق ی ق ح ت ن ی ا د. د و ش ی ا د د و خ ت د ش ه ب ن ی م ز ح ط س ی و ه ب ه ل ا س و گ بی ج ت سازی ه د و ل آ ن ی ل و ا ا ی س ب ش ال ت م غ ی ل ع ل ی ل د گی د و ل آ ط ی ح م ی ا د ه گ ن ج ن م ه ب ع ف د د. د ی د گ باکتی ه ب ال ا ب گی د و ل آ ا ب ه ا م ه ت س ی س و و ا ت ش ک ی ب و ک ی م س ی م و ف ی ن چ ی ل س ن ج و ه ن و گ ن ی ا )Bacillus licheniformis( س و ل ی س ا ب ی ت ک ا ب ص ی خ ش ت د ش ه س ا ی ت ک ا ب و ت ن ا ه د ا و ن ا خ ز ا ی ت ک ا ب چ ی ه و د ش ه د ا د د ک ن ه ک ال ا م ت ح ا ه ب ل ی ل د ث ا بی ت م و ا ق م و ه س ا ی ت ک ا ب و ت ن ا ای ه باکتی ت ا م و ک م ی س ا ت پ ب س و ل ی س ا ب ی ت ک ا ب ا ه ش ال ت. ت س ا ه د و ب م ی س ا ت پ ت ا م و ک بی ه ب س ی م و ف ی چ ی ل ت ی ق ف و م ا ب ت س ی س و و ا ه ن و م ن د ی ت ک ا ب ن ی ا حذف جهت ن ت ف ن ی ب ز ا صوت د ه ک ا چ د و ب ن ه ا م ه لی و ب ق ل ب ا ق ه د ا ف ت س ا د ن ن ا م ی ی ا ه ش و ط س و ت ا ه ه ن و م ن ن ی ا د باکتی د ک ی م ی ی غ ت ز ی ن ت س ی س و و ا شکل موث ک ی ت و ی ب تی ن آ ز ا ی ت ک ا ب ن ت ف ن ی ب ز ا ت و ص د تی ح ن آ ب ه و ال ع و ه ش ال ا ه ن آ ا ب چ ی ه شی و ز ا ت س ی س و و ا ا د ج. د ی د گ ن ل ک ش م س ک ی م و ئ ت و پ ت ا ق ی ق ح ت د باکتی ه ش ال و ض ح. د و ب د ه ا و خ ز ا س ا ت ای اا ا شه ش ش ش و ن و ن ک ن ی ق ق ق ق ق ق ق ح م ط س و ت فی ف ف ف ل ت خ م ت ت ت ت ت س ی س و و ا ززی ز ز ز ز ز ز ز ز ز ز ز ز ز ز ز ز ز ز ا س ا د ج منظو به ف ل ت خ م ع و دف م ز ا م م م و ی د ی و پ س و ت پ ی ک ( 0 5 ( ی( ز ا س و ا ن ش 0 شک گم ا ) ل ن ف لیت میلی ه د ا ف ت س ا ا ب ت ی ش. ت ت ت ت ت ت ت ت ت ت س ا ه د ش م ا ج ن ا ت ی ش ل و ل ح م ز ا ط ق م ب آ ت ی ل ی ل ی م و ا. ی س ا گ 9 ) 5 1 ( ( ( ( (( ( ( ( ( (( ( ( ( ( د ک ی ف ع م ا ب ی ز ا س و ا ن ش ش و ) ( ( ( ( ( ان ا ک م ه ت ی ش وش بهتین ن ا و ن ع ه ب ا ی ا ب بیماان د کیپتوسپویدیوزیس ه ی ص و ت ا اا ا هه ه ه ه ا گ ش ی ا م ز آ هت ج ل ک پ ز ا ) ( ( ( ( ( ( ن ا ا ک م ه ص ی خ ش ت. ) 2 1 ( کدند استفاده ا ه ت س ی س و و ا ه ب زی د ی ا ل و ل ح م و من د ل ا و. ) 5 1 ( د د د ن ا ه ه ه ه د و م ن ی ز ا س ا د ج و ی ز ا س خالص کدند ن ا ی ب ) ( ن ا ا ک م ه و د و و آ ا ب م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا ه د ا ف ت س ا ش و ز ا

11 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ی ز ا س و ا ن ش ا ب ل و ل ح م ت ی ش ب ل غ ا ت ی ا ض ش خ ب ن ی ا د ه د ش ا د ج ی ا ه ت س ی س و و ا د ا د ع ت ه چ گ ا. د ش ا ب ی م ن و ی ت ک ا ب ی د ا ی ز ن ا ز ی م ا ب ه ا م ه ا ه ن آ ا م ا د و ب ال ا ب ش و ی ا س ی ا ه ی ص ل ا خ ا ن ی ع و ف د م و د ن م ز ا ی ن ه ل ح م ی ف ا ض ا ن ا م ز م ه ص ی ل خ ت ش و ز ا ا ه ن آ ا ذ ل. د ن د و ب ی ز ا س ص ل ا خ و د ن د ک ه د ا ف ت س ا ل ک پ و ز ا ک ا س ع ط ق ن م ی ت ظ ل غ ب ی ش م ال ع ا د ن د و م ن ش ی ب ز ا 4 3 د ص د ل ک ا ه ت س ی س و و ا ه ب و شدند جدا پکل ی ت ظ ل غ شیب محله د خالص شکل ن ی ا ا ه ت س ی س و و ا. ) )4 د ن د و ب ی ب ک ی م ت ن و ف ع ا ز و ی ا ع ز ا ی ا ه ی گ د و ل آ ز ا دی ا د ع ت ع ا ب ش ا ز ا ک ا س ش و د حاض مطالعه د ل ب ا ق ن ا ز ی م ب و س ه ا م ه و د ن د ش ن و ا ن ش ا ه ت س ی س و و ا ی د ا ی ز ن ا ز ی م ن ی ن چ م ه. د ش ه د ه ا ش م ت س ی س و و ا هی ج و ت ی ت ک ا ب. د ی د گ ش و ه ا م ه ای ه ت س ی س و و ا ی ز ی م آ گ ن ای ه ت س ی س و و ا ت س د ب ای ا د د. ن د و ب د ئ ا ز د ا و م و ا ه ی ت ک ا ب و ا ن ش ه د م آ ن ا ز ی م ز ا ه د ش ن آ گی د و ل آ د ه د ه ا ش م ه ال ا ب و د ه ب زی ا س و ا ن ش ز ا ه د ا ف ت س ا ا ب ) ( ن ا ا ک م ه و ی ن ال ی ک ل ک پ ت ن ا ی د ا گ و د ی ا ل ک م ی ز س تی ظ ل غ ب ی ش ک م ک ه ب ا م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ص ی ل خ ت ی ت ظ ل غ. د ن د و م ن ل ک پ ی ا ه ت س ی س و و ا ت ا ش ی ا م ز آ 3( و. ) 5 ا ه ن آ ا ل ص ا ح ی ی ا ی م ی ش و ی ب ن ی ا ش و ی ا ه ت س ی س و و ا ت ه ج ه ب و ز ا ز ا ت ا ش ی ا م ز آ م ی ز س ه ن و م ن ل ص ا ح د ی ا ل ک ی ک ی ژ و ل و ن و م ی ا ل ی ل د ه د ا ف ت س ا ز ا ز ا ی ل و ک ل و م ا ی ف ع م م ی ز س ع و ف د م ب ی ش و ت ه ج د ن د ک د ی ا ل ک ن ی ا د ن ی ا ب ه و ال ع. ت س ی ن صفه به ن و ق م و ه د و ب ن ا گ ن ک م م ه ک ه د ش ه د ا ف ت س ا ال ا ب و د ی ا ه ژ و ف ی ت ن ا س ز ا ش و. د ن ش ا ب ن س ت س د د ه ش ی م ه ت س ا د و و آ ی ت ظ ل غ و م ی ز س ن و س د ل ا ن و د د ی ا ل ک و ) ( ) g( ه ب ت د م ک ی م ا ج ن ا ت ع ا س ا ب ه د ا ف ت س ا ژ و ف ی ت ن ا س د ی ا م د ز ا و د 4 ب ی ش ال ا ب ه ج د ن ی ا د. ) 4 1 ( د ن د ک ا ه ت س ی س و و ا ی ز ا س ص ل ا خ ه ب م ا د ق ا گدید استخاج ی ت ک ا ب ز ا ی ا ع ی ا ه ت س ی س و و ا ه ع ل ا ط م ه ک. د ن د ش ت ه ج ت ا ع ل ا ط م ی ک ی ژ و ل و ن و م ی ا ب س ا ن م ی ب ا ی ز ا ل و ک ی ا ف ی ت ظ ل غ ب ی ش ز ا ) ) ن و س پ م ا ت و ی ن و ل م ه د ا ف ت س ا ش و م ع و ف د م ز ا ا ه ت س ی س و و ا سازی خالص بای ه ز ا ا ه ش و م ی ب ج ت ی ز ا س ه د و ل آ ز ا س پ ا ه ن آ. د ن د ک ش و م ج ا خ ت س ا ی ط ص ل ا خ ه د ک و ی ز ا س ت ه ج 3- ت ش ک ن و ی ل ی م ت س ی س و و ا ی ا ه ت س ی س و و ا. ) 1 1 ( د ن د ب ه ه ب ن آ ز ا م و و ا پ م و ی د ی و پ س و ت پ ی ک د ه ع ل ا ط م ض ا ح د ش و ب ی ش ی ت ظ ل غ ی ن ا ک ل پ ) ل ک ی ا ف د ص د 0/5 ت ق ه ی ال ( ظ ن د و م ه ی ال د ل ک ی ا ف ی د ا ی ز ی ل و ل س ی ا ه ه د و ت و ی ت ک ا ب ا ه ت س ی س و و ا ه ا م ه ه ب ی ت ک ا ب ب ه و ال ع م ه ب و س ت م س ق د. ت ش ا د د و ج و د. ت ش ا د د و ج و ت س ی س و و ا ی ه ج و ت ل ب ا ق ن ا ز ی م ا ی س ب ی ل و ل س ی ا ه ه د و ت ز ا ا ه ت س ی س و و ا الیه تفکیک ش و ن ی ا ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا. د و ب ا و ش د ا ه ی ت ک ا ب و ی گ د و ل آ ن ا ز ی م ی ا ا د ی ز ی م آ گ ن ش و و د ه د ن ی ا ی ت م ک ه ب ا ه ی ت ک ا ب و د ا و م د ئ ا ز د. د ن د و ب ع ا ب ش ا ک م ن ب آ و ع ا ب ش ا ز ا ک ا س ه س ی ا ق م ا ب ش و ع ا ب ش ا ز ا ک ا س ه ل ی س و ب ی ز ا س ق ل ع م ز ا ) ( ن و ت پ آ ت ش ک د ا ه ن آ ز ا و د ب ه ه ب ا ه ت س ی س و و ا ج ا خ ت س ا د ه د ا ف ت س ا م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ل و ل س د و م ن. ) 1 ( و ه د و ب ع ی س ا ی س ب ش و ن ی ا ت س ا د ق ت ع م ) ( ی ا ف و د و ش ی م ت س ی س و و ا ز ا ی د ا ی ز ن ا ز ی م ت ف ا ی ز ا ب ه ب ج ن م ز ا ه د ش ی و آ ع م ج ی ا ه ت س ی س و و ا د ص د ش ی ا ز ف ا ی ا ب ا ه ب و س. ) )2 د ش ا ب ی م ب ق ا ع ت م ن و ی س ا ت ل ی ف ی ا ه ب آ ی ح ط س ب س ا ن م زی ا س و ا ن ش ش و ز ا ) 9 1 )88 ن ا ا ک م ه و ب م ال ه د ا ف ت س ا ا ه ت س ی س و و ا ص ی ل خ ت ای ب ک م ن ل و ل ح م ط س و ت د ن د و م ن. ) 0 1 ( ا ه ن آ ز ا ژ و ف ی ت ن ا س ب ی ش بای لی ا گ چ

12 ا) ب 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 8 د ا م ه ع ل ا ط م ج ی ا ت ن. د ن د ک ه د ا ف ت س ا ا ه ت س ی س و و ا ت ف ا ی ز ا ب ش و ه د ا ف ت س ا ز ا ل و ل ح م ک م ن م ا ع ط ع ا ب ش ا ا ب ج ی ا ت ن ی و ط ه ب ت ش ا د ن ت ق ب ا ط م ن ا ا ک م ه و ب م ال ت ا ع ل ا ط م ه ک دی ا د ع ت ای ه ت س ی س و و ا ز ا ا ه ت س ی س و و ا و ا ن ش ه د ش ز ی ن و ا ن ش ن ا ز ی م د ن د ش ن ی د ا ی ز و ه ا م ه ل و ل س و ن آ ز ا ه د م آ ت س د ب ای ه ت س ی س و و ا. ت ش ا د د و ج و ی ت ک ا ب ال ا ب گی د و ل آ ن ا ز ی م ای ا د ی ز ی م آ گ ن ش و و د ه د. د ن د و ب د ئ ا ز د ا و م و ا ه باکتی ه ب ت ن ی و و ن ا ا ک م ه ) ( ا ب ه د ا ف ت س ا ز ا ش و ه د ش د س د ص د 5 5 ز ا ک ا س ل و ل ح م ط س و ت شناوسازی ا ت ب س ن ن ا ز ی م ص ی ل خ ت ه ب ق ف و م ) 1/9 2 ص و ص خ م ن ز و ه ع ل ا ط م د ش و ن ی ا. ) 3 2 ( د ن د ش ا ه ت س ی س و و ا ز ا ی ی ال ا ب ض ا ح ز ی ن ه د ا ف ت س ا د ش و ج ن م ه ب ص ی ل خ ت ز ا ک ا س ش و د د. ی د گ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا د ه ک ی و ط ه ب د ن د ش و ا ن ش ی ب و خ ه ب ا ه ت س ی س و و ا 5 5 % ب و س ن آ ت س ی س و و ا ل ب ا ق ی ه ج و ت ه د ه ا ش م. د ی د گ ن ز ا ه د ش ی و آ ع م ج ی ا ه ت س ی س و و ا ا ب ه ا م ه ی ت ک ا ب ن ا ز ی م ی ل و ل س ی ا ه ه د و ت و د و ب ا ه ش و ی ا س ز ا ت م ک ش و ن ی ا ا ه ت س ی س و و ا و ی ل و ل س ه د و ت ا ه ی ت ک ا ب. د ی د گ ن ه د ه ا ش م. د ن د ش و ا ن ش ی ی ا ز ج م ی ا ه یه ال د ا ت ب س ن م ا د ک ه ال ا ت ن ا و ن ا ا ک م ه ) ( ز ا ب ی ش ی ت ظ ل غ م ی س ا ت پ ت س ی س و و ا ص ی ل خ ت ت ه ج ) % 8 2 و 1 % % ( د ی ا م ب ه ه ب ن ا و ن ع. د ن د ب ی ا ه د ا م ا ه ن آ د د ه ع ل ا ط م س ت س د و د و خ ن ا ز ا م ی س ا ت پ ی ف ع م د ی ا م ب ا د ن د ک ه ب و د ی ت خ س ب ه و ال ع د ی ا ل ک م ی ز س و ل ک پ د ن د و م ن ن ا و ن ع. ) )5 د ن ش ا ب ی م ز ی ن ن ا گ م ا ج ن ا ه ج ت( ( ن ا ا ک م ه و گ ن ا ت م و ی د ی و پ س و ت پ ی ک ه ب ه س ی ا ق م ت س ی س و و ا ص ی ل خ ت ش و. د ن ت خ ا د پ ز ا ک ا س ا ب شناوسازی ساکاز ن و ی س ن ا پ س و س ای ه ش و ت ن ا ی د ا گ د ی ا ل ک ل ک پ ت ن ا ی د ا گ ه ا م ه ل و ک ی ا ف زی ا س و ا ن ش ش و ا ب ز ا ک ا س ت ن ا ی د ا گ م ی ز س ع ط ق ن م ا ه ن آ ه ع ل ا ط م د و م ای ه ش و ل ک پ گادیانت و ز ا ک ا س. د ن د و ب ل و ل س 9 /5 5 ( ا ه ن آ م ال ع ا ب د ص د ی( ت م و ت ی ا س و ل ف ل ک پ ه ا م ه س ا س ا د ن د و م ن ت ف ا ی ز ا ب ج ی ا ت ن ای ه ش و زی ا س و ا ن ش زی ا س و ا ن ش ت س ی س و و ا ا ب ا ب ی ت م و ت ی ا س و ل ف ن و ی س ن ا پ س و س ا ب ز ا ک ا س ز ا ک ا س ش و و و 0 3 /7 2 ( ت ش ک ز ا ک ا س ی ی ا س ا ن ش ت ن ا ی د ا گ د ص د ه ب ) ی ت م تو ی ا س و ل ف ی ی ا س ا ن ش ش و ا ب ت س ی س و و ا ت ف ا ی ز ا ب ب ی ت ت ش ا ز گ تی ظ ل غ ن ی ت ال ا ب د ن د و م ن ع ط ق ن م ت ف ا ی ز ا ب ه ک ز ا ک ا س ت س ی س و و ا ای ه ش و و ب ی ش م ی ز س تی ظ ل غ ا. د ن ا د د ی ا ل ک ل ک پ و ا ه ن آ ب ی ش ب ی ش ت س ی س و و ا می ک د ا د ع ت ص ی ل خ ت ی ی ا ن ا و ت ل و ک ی ا ف تی ظ ل غ تی ظ ل غ ب ی ش ش و د ی ت ک ا ب دگی و ل آ ن ا ز ی م. د ن ا د ا ل ک پ ه ا م ه 3/ ±0/ / ±0/ / ±0/ زی ا س و ا ن ش ک ذ 4 1 / ±0/ ص ی ل خ ت ه د ش ه ب ش و ی ز ا س و ا ن ش ب ی ش ا ب ن و ی س ن ا پ س و س م ی ز س. د ی د گ تی ظ ل غ ا ب ز ا ک ا س ز ا ک ا س ز ا ک ا س د ی ا ل ک ای ه ت س ی س و و ا ل ک پ ه ا م ه ا ی ت ک ا ب ه ب گی د و ل آ ن ی ت م ک ز ا ک ا س ا ب زی ا س و ا ن ش ی ت ک ا ب ت ش ک د و م د ا م ه ع ل ا ط م ج ی ا ت ن. ) 1 ( د ن د ا د ن ا ش ن ه ک ت ش ا د ن نی ا و خ م ه ن ا ا ک م ه و گ ن ا ت ت ا ق ی ق ح ت ا ب ال ا م ت ح ا ه ب ط ا خ. د ش ا ب ی م ا م ه ع ل ا ط م ه د ا ف ت س ا ز ا بی ت ا م و ک م ی س ا ت پ د ا ب زی ا س و ا ن ش ز ا ه د ا ف ت س ا ا ب ) ( ن ا ا ک م ه و ن ب ا ا 3 1/2 1 ص و ص خ م ن ز و ( طعام نمک ل و ل ح م م 0 گ د د ن ت ش ا د کمی اولیه گی د و ل آ که نمونههایی وی ب ) ت ی ل د ا د ع ت 1/ ± 0/ ت س ی س و و ا ا م ی ت ز ا ل ب ق. د ن د و آ ت س د ه ب م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ت ک ا ب نی و ل ک ت ی ل ی ل ی م ه د 2/ د ا د ع ت ت ا ا ب د ش باکتی ت ا ا ب ا م ی ت ز ا س پ لی و د ی د گ ش ا م ش. د ک ن ا ب ه ج و ت ه ب ن ی ا ه ک د ت ش ی ب د ا و م ه ی ه ت ع ب ن م

13 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ت س ی س و و ا ه ن و م ن ع و ف د م د ش ا ب ی م ه ک ال و م ع م ه ا م ه ا ب د کابدی وش ن ی ا ت س ا باکتی ه ب ی ی ال ا ب گی د و ل آ ا ب ا م ت ا ع ل ا ط م ج ی ا ت ن. ) 2 1 ( ت ش ا د د ه ا و خ ن ا ه ه ن و م ن ن ی ا ت ل ع ه ب د ن ا و ت ی م که نداشت خوانی هم ه ع ل ا ط م ن ی ا ج ی ا ت ن ت ال ا ب ن د و ب گی د و ل آ. د ش ا ب ا م ق ی ق ح ت د ه د ا ف ت س ا ای ه ه ت ف ا ی ) ( ( ش خ ب ه( ک ق ی ق ح ت ت ق ب ا ط م ض ا ح د ا د ی ی ا ی ت ک ا ب و ا ب ا ب ه ت ف ا ی ظ ن ه ن و م ن د و و آ ا ی س ا گ ع و ف د م و و د و م ن ا ا ک م ه ن ا ا ک م ه ت ی ا ض ا شیت محلول ا ب شناوسازی وش ف ی ص و ت د ن د ک ت ق ب ا ط م. د ا د ن ش و ب ی ش بی و ل ط م ج ی ا ت ن ت س ی س و و ا ص و ل خ ظ ن ز ا ل ک ی ا ف ظتی ل غ ز ا ت ن ا گ ی ا ه د ا م ل و ک ی ا ف ه ک ن ی ا ضمن نداشت پی د س ت س د د ی ه ا گ ش ی ا م ز آ ه د ه ش ی م ه و ت س ا ز ا ک ا س. د ش ا ب ی م ن زی ا س و ا ن ش ش و د ا د ع ت ه د ا ف ت س ا ز ا ی د ا ی ز ز ا ک ا س 5 5 ت س ی س و و ا د ص د ص ل ا خ. د ک د ا ج ی ا ا ه ش و ی ا س ا ب ه س ی ا ق م د ا ت س ی س و و ا گ ن و پ ا پ م و ک و ن ا ا ک م ه ) ( ز ا ن م ض زی ا س و ا ن ش ن ی ت ا ب ش و ا ب ن آ ه س ی ا ق م و ) 1/8 1 ص و ص خ م ن ز و ( ز ا ک ا س ک ی ت ن گ م و ن و م ی ا ت ه ج ص ی ل خ ت ا ه ت س ی س و و ا ه د ا ف ت س ا ا ن آ و د ا ه ن ش ی پ ا ز ا ک ا س ا ب زی ا س و ا ن ش ا ه ن آ. د ن د ک گان ا گ ن ی ت ن گ م و ن و م ی ا ش و و فی ع م ب س ا ن م و ن ا ز ا ضد بادی تی ن آ ک ی ت ن گ م و ن م ی ا ش و د. ) )8 کدند ذک تی ن آ ای ه ن ژ حی ط س م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا ا ه ت س ی س و و ا و د و ش ی م ل ص ت م ی س ی ط ا ن غ م ت ا ذ ه ب م و و ا پ ت ا ذ کیفیت. میشوند جدا محلول ز ا ت ن گ م ک م ک ه ب ت س ب و ی گ ژ ی و و ل ی م ی ب ی ک ت تی ن آ ا ه دی ا ب ه ب ل گ ن ا ه. د ش ا ب ش و ن ی ا د ه د ن ن ک د و د ح م ل م ا و ع ز ا د ن ا و ت ی م ه چ ل ی م ت س ی س و و ا ی ب ی ک ت ت ش ی ب تی ن آ د ش ا ب دی ا ب ت س ی س و و ا ل ص ت م ا ب ه د ش ت د ق ه ب ت س ب ی ت ش ی ب ه ب ه ب ل ا ص ت ا ت د ق ن ی ا ت س ا ن ک م م و د و ش ی م ل ص ت م ت س ب ع ن ا م ا ه ن د ش ت س ی س و و ا د ه ل ح م زی ا س ا د ج ی ی ا ه ن ت س ا ن ک م م ن د ا د ن ا ک ت ش و و ت س ب ت ا ذ ه ز ا د ن ا. د و ش. د ش ا ب ه ت ش ا د ث ا ن آ ه ب ت س ی س و و ا ل ا ص ت ا ن ا ز ی م ب ب ج و م ا ت س ی س و و ا ت ف ا ی ز ا ب ن ی ت ال ا ب قی ف ا ای ه ن ا ک ت ت ا ذ ع م ج ت ث ع ا ب ی ا ه ی ا د ن ا ک ت ه ک تی و ص د شده ت س ی س و و ا ا ب س ا م ت ح ط س ش ه ا ک و ز ک م د ی س ی ط ا ن غ م. ) )8 د و ش ی م ا ه چ ز ا ک ی چ ی ه د ی د گ ص خ ش م ق ی ق ح ت ن ی ا د ل م ا ک ی ز ا س ا د ج و ص ی ل خ ت ی ی ا ن ا و ت ه د ش م ا ج ن ا ش و ت ش ا د ن ا ا ه ی ص ل ا خ ا ن ی ا س و ی ت ک ا ب ز ا ا ه ت س ی س و و ا ه ی ه ت و ظ ن م ه ب خالص اووسیست ه ب ی ب ا ی ت س د ی ا ب ا ذ ل ن ی ت ه ب. د ی د گ ه د ا ف ت س ا ن و ی س ا ت ل ی ف ش و ز ا ن ژ ی ت ن آ ش و ق ی ق ح ت ن ی ا د ه س ی ا ق م ش و ا ه چ د ه ج ی ت ن و ط ه ب که گدید ازیابی د ص د 5 5 ساکاز از ه د ا ف ت س ا ی ل ی م د ت س ی س و و ا ن و ی ل ی م 0 4 ص ی ل خ ت ه ب ج ن م ط س و ت م ا ب ه ا م ه ی ی ا ی ت ک ا ب ی گ د و ل آ ن ی ت م ک و د ی د گ ت ی ل ه د ه ا ش م ش و ن ی ا د ه د ش ص ی ل خ ت ی ا ه ت س ی س و و ا ی ا ی ا ز م ز ا ز ا ک ا س ن د و ب س ت س د د و ن ا ز ا. د ی د گ ی د ا ی ز د ا د ع ت د ی د گ ب ج و م ه ک ت س ا ش و ن ی ا گ ی د. د ن و ش ی ز ا س ا د ج م ک ه ن ی ز ه ا ب ز ی م ت ا ت ب س ن ت س ی س و و ا و بی چ ش ه ا ک د Tris-EDTA ف ا ب و ت ا ز ا ه د ا ف ت س ا م د ق د ا ذ ل. ت ش ا د ی ی ا ز س ب ش ق ن ع و ف د م زی ا س ن گ م ه 5 5 ز ا ک ا س ل و ل ح م ز ا ه د ا ف ت س ا ا ب ه ع ل ا ط م ن ی ا د ل و ا ه ی ل و ا ص ی ل خ ت ه ب م ا د ق ا ع و ف د م ه ن و م ن ی و ب د ص د ن ی ا ز ا ل ص ا ح ی ا ه ت س ی س و و ا و د ی د گ ا ه ت س ی س و و ا ت ل ی ف ز ا ا ه ی ت ک ا ب ت ش ی ب ه چ ه ن د و د ز ت ه ج ش و د و م ل ی ا س و و ا ه ل و ل ح م. د ش ه د ا د و ب ع ی ز ل و ل س و ت ی ن ل ا م ت ح ا ا ت د ی د گ ل ی ت س ا ن و ی س ا ت ل ی ف ل ح ا م د ه د ا ف ت س ا ز ا س پ. د و ش ف ذ ح ی ج ا خ ی ا ه ی گ د و ل آ و ض ح ت ل ی ف وی ا ه ت س ی اووس ز ا ی غ می ج چ ی ه ن و ی س ا ت ل ی ف و ه د ش ن گ م ه ای ه م ج و ا ه ی ت ک ا ب ه ش ال. د ن ت ش ا د ن ا ق ت ش ک د. د ن د ک و ب ع نی و ک ی م 3 ذ ف ن م ز ا ه د ش د خ

14 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 8 8 ی ی ا ی ت ک ا ب ه ن و م ن ت س ی س و و ا ص ی ل خ ت ه د ش ه ب ش و ه ش ال د ن چ ه د ک ن د ش ی ت ک ا ب چ ی ه د ص د 55 ساکاز ا ه ی ت ک ا ب ه ب ح و ض و ی ز پ و ک س و ک ی م ی و ن ه د ه ا ش م ت ا م و ک بی ز ا ه د ا ف ت س ا د ن ا و ت ی م م ا ن ی ا ت ل ع د ی د گ م ی س ا ت پ ص ی ل خ ت ه ب ن ا و ن ع د و م ه د ن ا د ه گ ن ه د ا ف ت س ا. د ش ا ب ع و ف د م ن ا م ه و ت ا و ط د ه ک ش و ا ظ ت ن ا ص ی ل خ ت ت س ی س و و ا ه ن و م ن ی ی ا ی ت ک ا ب ت ش ک د ت ف ی م د. ک ن د ش باکتی چ ی ه ز ی ن ن و ی س ا ت ل ی ف ش و ه ب ه د ش نشان حاض مطالعه تخلیص جهت ه ک د ا د ی اا ا هه ه ه ن و م ن ز ا م و و ا پ کیپتوسپویدیوم ی ا ه ت س ی س و و ا ی و ا ح د ا ی ز ا د ق م محححلول اساس ت س ی س و و ا ز ا ک ا س ی ز ل و ل س و ت ی ن ی اا ا ه ت ل ی ف ز ا ه د ا ف ت س ا د ا ه ن ش ی پ. د ش ا ب ب س ا ن م چبی میزان ب ی ز ا س و ا ن ش ش و تکمیلی وش و د ص د 5 5 ن و ک ی م 3 د ن ا و ت ی ی ی م ه ک ی ی اا ا هههههه ه نه و م ن د ه ک د و ش ی ی م ی ب چ ت ه ج ت ا ز ا حتما داند بالایی و ظ ن م ه ب ن ی ن چ م ه. گدد استفاده سازی همگن و ی ی ا د ز ص ی ل خ ت ی و ا ح ی اا ا هه ه ه ه ه ه ن و م ن ز ا ت س ی س و و ا ه ی ل و ا ی ز ا س ا د ج و ظ ن م ه ب ت س ا بهت اووسیست ز ا ک ا س ل و ل ح م ز ا ا ه ت س ی س و و ا کمی مقدا ن ا و ن ع ه ب و د د ص د 5 5 د ن ن ا م ه ت ف ش ی پ ی ا ا ا ا ا ا شه ش ش ش ش ش و ز ا ی ل ی م ک ت ش و ت س ی س و و ا ت ش ی ب ت ف ا ی ز ا ب د ص د ا ب ی ف ا گ و ت ا م و ک و ن و م ی ا. د و م ن ه د ا ف ت س ا ک ش ت ح ط ت ا ا ب ت ع ا ل ح م ز ا ه ع ل ا ط م ن ی ا ی ا ج ا ی ا ه ه ن ی ز ه ن ال ک ی ل م ن س ک ا و م ا د و ی ط و ن ا ی ز ب آ و ح ط ب ط ق ن ی ق ق ح م ه ل ی س و ن ی د ب د ی د گ ن ی م ا ت ی ژ و ل و ت ا پ و ن و م ی ا ی م ل ع ن ی ا ه ع ل ا ط م د. ن ا د ی م ک ش ت د و خ ا ز ا ن ی ل و ئ س م ه ط و ب م ز ا ب ا ع ب ا ن م ن ی ئ ت و پ ه ی ه ت و ی ی ا س ا ن ش ( (. ا ه د ا ز م ی ه ا ب ا 1. ی ا ت ک د ه ل ا س. م و و ا پ م و ی د ی و پ س و ت پ ی ک p23 ب ی ک ت و ن ی ک ش ز پ م ا د ه د ک ش ن ا د. 9 2 ه ا م ش شناسی ل گ ن ا ی ص ص خ ت. ن ا ه ت ه ا گ ش ن ا د. ت پوبازگانی ی ق ت ظ ن ی ز. م ی ن ا گ ی ه م ج ت. ی ا ف 2. و م و ی د ی و پ س و ت پ ی ک 0( (.. غ ی م ز و. ن ا ه ت ش خ ب و ن ت ا ا ش ت ن ا. ل و ا پ ا چ. ز و ی د ی و پ س و ت پ ی ک 3. Arrowood, M.J., Donaldson, K. (199). Improved purification methods for calf derived Cryptosporidium parvum oocysts using discontinuous sucrose and cesium chloride gradients. Journal of Eukaryot Microbiology 43 : Arrowood, J.M., Sterling, R.CH. (1987). Isolation of Cryptosporidium oocysts and sporoziote using discontinous sucrose and isopycnic percoll gradients. Journal of Parasitology 73: Entrala, E., Molina-Molina, J., Rosales- Lombardo, M., Sanchez-Moreno, M., Mascaro-Ilazcano, C. (2000). Cryptosporidium parvum: oocysts purification using potassium bromide discountinuos gradient. Veterinary Parasitology 92: Garcia, L.S., Bruckner, D.A., Brewer, T.C., Shimizu, R.Y. (1983). Techniques for the recovery and identification of Cryptosporidium oocysts from stool specimens. Journal of Clinical Microbiology 18: Kuczynska, E., Shelton, D.R., Pachepsky, Y. (2005). Effect of bovine manure on Cryptosporidium parvum oocyst attachment to soil. Applied and Environmental Microbiology 71: Kilani, R.T., Sekla, L. (1987). Purification of Cryptosporidium oocysts and sporozoites by cesium choloride and percoll gradient. American Journal of Tropical Medicine and Hygiene 3:

15 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م 18. Sheather, A.L. (1923). The detection of intestinal protozoa and mange parasites by a flotation technique. Journal of Comparative Pathology 3: Truong, Q., Ferrari, B.C. (200). Quantitative and qualitative comparisons of Cryptosporidium faecal purification procedures for the isolation of oocysts suitable for proteomic analysis. International Journal for Parasitology 3: Upton, S.J. (1997). In vitro cultivation. In: Fayer, R. (Ed.) Cryptosporidium and Cryptosporidiosis. CRC Press, Boca Raton, FL: Waldman, E., Tzipori, S., Forsyth, J.R. (198). Separation of Cryptosporidium species oocysts from feces by using a percoll discontinuous density gradient. Journal of Clinical Microbiology 23: Winter, G., Andrew, A.G., Williams, L.K., Slade, M.B. (2000). Characterization of a major sporozoite surface glycoprotein of Cryptosporidium parvum. Functional and Integrative Genomics 1: Wooley, R.E., Jones, M.S. (1983). Action of EDTA-TRIS and antimicrobial agent combination on selected pathogenic Bacteria. Veterinary Microbiology 8: Koompapong, K., Sutthikornchai, C.H., Sukthana, Y. (2009). Cryptosporidium oocyst detection in water samples: Flotation technique enhanced with immunofluorescence is as effective as immunomagnetic sepration method. Korean Journal of Parasitology 47: Liao, S.H.F., DU, C.H., Yang, S.H., Healey, M.C. (2001). Alteration of Cryptosporidium parvum (Apicomplexa: Eucoccidiorida) oocyst antigens following bleach treatment. Acta Protozoologica 40: Lumb, R., Lanser, J.A., O'Donoghue, P.J. (1988). Electrophoretic and immunoblot analysis of Cryptosporidium oocysts. Immunology and Cell Biology : McCuin, R.M., Clancy, J.L. (2005). Methods for the recovery, isolation and detection of Cryptosporidium oocysts in wastewaters. Journal of Microbiological Methods 3: Meloni, B.P., Thompson, R.C. (199). Simplified methods for obtaining purified oocysts from mice and for growing Cryptosporidium parvum in vitro. Journal of Parasitology 82: Merry, R.J. (1997). Viability of Cryptosporidium parvum during ensilage of perennial ryegrass. Journal of Applied Microbiology 82: O Brien, C.N., Jenkins, M.C. (2007). A rapid method for producing highly purified Cryptosporidium parvum oocysts. Journal of Parasitology 93: Rosales, M.J., Lazcano, C.M., Arnedo, T., Castilla, J.J. (1994). Isolation and identification of Cryptosporidium parvum oocysts with continuous percoll gradients and combined alcian bluegiemsa staining. Acta Tropica 5: Scott, C.A. Smith, H.V., Gibbs, H.A. (1994). Excretion of Cryptosporidium parvum oocysts by a herd of beef suckler cows. Veterinary Record 134: 172.

16 Journal of Veterinary Microbiology, Volume 8, Issue 2, 2012 Presenting an Appropriate Method for Isolation of Bacteria Free Cryptosporidium parvum Oocysts Shayan, P. 1 *, Asghari, Z. 1, Ebrahimzadeh, E. 1, Omidian, Z. 1, Zarghami, F Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran Received Date: 5 Jan 2013 Accepted Date: 9 Feb 2013 Abstract Cryptosporidium parvum is a zoonotic protozoan which causes disease in immunocompromised patients and newborn animals especially calves. The oocysts excreted by infected animals are introduced into the environment and water. Since the low number of oocyst can cause infection and there is no effective disinfectant against cryptosporidium, the investigation dealing with the cryptosporidiosis is of growing interest among many researchers. Therefore, they try to improve the existing isolation methods of C. parvum oocysts even in environmental samples with small number of oocysts, to obtain much purified oocysts for immunological and molecular studies. Different methods have gained some success on the isolation of cryptosporidium, but they didn t result in obtaining completely pure oocysts. The aim of the present study was to try to develop an isolating system for bacteria free oocysts. For this aim, four flotation methods have been used to isolate the C. parvum oocysts from the feces, including NaCl floatation, sucrose floatation, ficoll gradient and 55% sucrose floatation. A floatation method based on 55% sucrose was evaluated as the best method for the primary isolation of Cryptosporidium oocytes. The nitrocellulose filter (with 3µm pore size) was used to remove bacteria and other contaminants. Our results suggest that the oocysts isolated using filtration were free of bacteria and the amount of pure oocysts was 30%. Although the amount of isolated oocysts was limited, the isolated pure oocysts can be used for proteomics studies. Keywords: Cryptosporidium parvum, Oocyst, Floatation, Filtration *Corresponding author: Shayan, P. Address: Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran. Tel:

ر ک ش ل ن س ح ن د م ح م ب ن ی ز ن. ل و ئ س م ه د ن س ی و ن ( ی ر ک ش ل &

ر ک ش ل ن س ح ن د م ح م ب ن ی ز ن. ل و ئ س م ه د ن س ی و ن ( ی ر ک ش ل & ن- س ح ی ژ ر ن ا ل ا ق ت ن ا ر د ر ا و ی د ي ر ي گ ت ه ج و د ی ش ر و خ ش ب ا ت ه ی و ا ز و ت ه ج ه ط ب ا ر ل ی ل ح ت ) ر ال ر ه ش ي د ر و م ه ع ل ا ط م ( ي ر ي س م ر گ ي ا ه ر ه ش ر د ن ا م ت خ ا س ل خ

Διαβάστε περισσότερα

ی ن ل ض ا ف ب ی ر غ ن ق و ش ه ی ض ر م ی ) ل و ئ س م ه د ن س ی و ن ( ا ی ن ل ض ا ف ب ی ر غ 1-

ی ن ل ض ا ف ب ی ر غ ن ق و ش ه ی ض ر م ی ) ل و ئ س م ه د ن س ی و ن ( ا ی ن ل ض ا ف ب ی ر غ 1- ر د ی ا ه ل ی ب ق ی م و ق ب ص ع ت ای ه ی ر ی گ ت ه ج و ی ل ح م ت ا ح ی ج ر ت ر ی ث أ ت ل ی ل ح ت و ن ی ی ب ت زابل) ن ا ت س ر ه ش ب آ ت ش پ ش خ ب و ی ز ک ر م ش خ ب : ی د ر و م ه ع ل ا ط م ( ن ا ر ا ی ه

Διαβάστε περισσότερα

ی ا ک ل ا ه م ی ل ح ر

ی ا ک ل ا ه م ی ل ح ر ل- ال ج ه) ن و م ن م د ر م ت ک ر ا ش م د ر ک و ر ا ب ر ه ش ه د و س ر ف ا ه ت ف ا ب ز ا س و ن ) س و ل ا چ ر ه ش 6 ه ل ح م : د ر و م 1 ل م آ م ظ ع ل ال ج ر و ن د ح ا و م ال س ا د ا ز آ ه ا گ ش ن ا د ر ه

Διαβάστε περισσότερα

ت خ ی م آ ر ص ا ن ع ز ا ن ا گ د ن ن ک د ی د ز ا ب ی د ن م ت ی ا ض ر ی س ر ر ب د

ت خ ی م آ ر ص ا ن ع ز ا ن ا گ د ن ن ک د ی د ز ا ب ی د ن م ت ی ا ض ر ی س ر ر ب د ه ت خ م آ ر ص ا ع ز ا ا گ د ک د د ز ا ب د م ت ا ض ر س ر ر ب د ال م ج ر ب ر گ ش د ر گ ب ا ر ا ز ا ب خالر امر ا ر ا ا ر ه ت ا ر ه ت ه ا گ ش ا د ت ر د م ه د ک ش ا د ا گ ر ز ا ب ت ر د م ه و ر گ ر ا د ا ت س

Διαβάστε περισσότερα

1 2 Marsick & Watkins 3. Saw, Wilday & Harte 4 -Chen & Kuo 5. Liao,Chang & Wu 6 -Garvin

1 2 Marsick & Watkins 3. Saw, Wilday & Harte 4 -Chen & Kuo 5. Liao,Chang & Wu 6 -Garvin ي ش ز و م آ ت ي ي د م و ی ب ه ه م ا ن ل ص ف ا س م گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 زمستان 4 ه ا م ش م ت ش ه ل ا س 1 1 1-10 3 ص ص ه د ن ی گ د ا ی ن ا م ز ا س ای ه ه ف ل ؤ م ت س ب ا ک ا ب

Διαβάστε περισσότερα

ل ی ل خ د و و ا د ه ا ر ج ا ه م ز ا ن ه ب 3 د ن ک م ی ل س ی ف ر ش ا د ی ش ر ف : ه د ی ک چ.

ل ی ل خ د و و ا د ه ا ر ج ا ه م ز ا ن ه ب 3 د ن ک م ی ل س ی ف ر ش ا د ی ش ر ف : ه د ی ک چ. شی ز و م آ ت دیری م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و می ال س ا د ا ز آ ه ا گ ش ن ا د 5931 پاییز 3 ه ر ا م ش م ه د ل ا س 5 1 1-12 3 ص ص ی ل ی ل خ د و و ا د ه ب ی ل غ ش ت ی ا ض ر ی ر گ ی ج ن

Διαβάστε περισσότερα

ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا ی ز ر ا )

ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا ی ز ر ا ) ه) ن و م ن ی ش ه و ژ پ ی- م ل ع ه م ا ن ل ص ف ی ن ا س ن ا ی ا ی ف ا ر غ ج ر د و ن ی ا ه ش ر گ ن 1396 بهار م و د ه ر ا م ش م ه ن ل ا س ی ر ه ش ت ی ر ی د م ه ب ن ا د ن و ر ه ش د ا م ت ع ا ن ا ز ی م ی ب ا

Διαβάστε περισσότερα

2 - Robbins 3 - Al Arkoubi 4 - fry

2 - Robbins 3 - Al Arkoubi 4 - fry ف ص ل ن ا م ه ر ه ب ر ی و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م ش م ا ر ه 3 پاییز 3931 ص ص -6 4 1 1 1 2 ح م ی د ب ر ر س ی ر ا ب ط ه ب ی ن ر ه ب ر ی

Διαβάστε περισσότερα

ر ی د م ی د ه م ن ر ی د م ن ا س ح ا ن

ر ی د م ی د ه م ن ر ی د م ن ا س ح ا ن ز ا س م ه ی ر ا م ع م ی ح ا ر ط و ی م ی ل ق ا ش ی ا س آ ی ا ه ص خ ا ش ی س ر ر ب ن ا ج ن ز ر ه ش م ی ل ق ا ا ب ی ر ی د م ی د ه م ن ا ر ی ا ن ا ر ه ت ر ت ش ا ک ل ا م ی ت ع ن ص ه ا گ ش ن ا د ی ر ه ش ی ز ی

Διαβάστε περισσότερα

2

2 م ط ا ل ع ه) ف ص ل ن ا م ه ر ه ب ر ی و م د ر ت آ م و ز ش د ا ن ش گ ا ه آ ز ا د ا س ال م و ا ح د گ ر م س ا ر س ا ل ه ف ت م ش م ا ر ه ب ه ا ر 9 3 ص ص -8 3 7 ح س ن ع ل ب ر ر س ر ا ب ط ه م ا ن ر ه ب ر ت ح

Διαβάστε περισσότερα

م ح ق ق س ا خ ت ه () ک ا ر ش ن ا س- ف ص ل ن ا م ه ر ه ب ر ی و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م. ش م ا ر ه 1 ب ه ا ر 3 9 3 1 ص ص -8 6 1 1 3 4 1

Διαβάστε περισσότερα

ش ز و م آ ت ی ر ی د م د ش ر ا س ا ن ش ر ا ک. 4

ش ز و م آ ت ی ر ی د م د ش ر ا س ا ن ش ر ا ک. 4 ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 تابستان 2 ه ر ا م ش. م ت ش ه ل ا س 9 4-5 6 ص ص ه ل خ ا د م م د ع و ی ل د ا ب ت ن ی ر ف آ ل و

Διαβάστε περισσότερα

ن ا ب ر ق د ا و ج د م ح م ن

ن ا ب ر ق د ا و ج د م ح م ن ه ک ب ش ت ی ض و و ی ژ و ل و ف م و ئ ژ ا ب ن آ ه ط ب ا و ی ن و ک س م ی ا ه ز ا س و ت خ ا س ه س و ت ل ی ل ح ت ی ل ز ن ا ن ب ه ش ج ن پ ه ی ح ا ن : ی و م ه ل ا ط م ی ه ش ن و ت ا ف ا ص ت و ل ق ن و ل م ح 1 ه

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س م ز 4 ه ر ا م ش م ت ف ه ل ا س 7 5-70 ص ص ه ر و د م و س ل ا س ن ا ز و م آ ش ن ا د ن

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3 9 3 1 ر ا ه ب 1 ه ر ا م ش. م ت ش ه ل ا س 5 4-8 5 ص ص EFQM ی ل ا ع ت ل د م س ا س ا ر ب ی ن ا م ز

Διαβάστε περισσότερα

ا د ی بن ت و ی ولا ی ذ ار گ د ف ه ما ن ت

ا د ی بن ت و ی ولا ی ذ ار گ د ف ه ما ن ت ي ش ز و م آ ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا س م ز 4 ه ر ا م ش م ف ه ل ا س 1 4-55 ص ص ه ط س و م ع ط ق م ر خ د ن ا ز و م آ ش ن ا د س ر

Διαβάστε περισσότερα

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 م و ر د م ط ا ل ع ه :) پژوهشهای جامعه شناختی سال نهم / شماره سوم / پاییز 49 Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 ب ر ر س ی ر ا ب ط ه ب ن ی ا ن ه ا ی ا خ ال ق ی و خ و د ک ا ر

Διαβάστε περισσότερα

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3

Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 م ط ا ل ع ه) پژوهشهای جامعه شناختی سال نهم / شماره سوم / پاییز 49 Journal of Sociological researches, 2015 (Autumn), Vol.9, No. 3 ر ت ب ه ب ن د ی ع و ا م ل م و ث ر ب ر ا ر ز ی ا ب ی ع م ل ک ر د م د ی ر

Διαβάστε περισσότερα

ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر غ ا ر م ن ا ت س ر ه ش ه ط س و ت م س ر ا د م 3

ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر غ ا ر م ن ا ت س ر ه ش ه ط س و ت م س ر ا د م 3 ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س ب ا ت 2 ه ر ا م ش م ت ف ه ل ا س 1 3 1-4 4 1 ص ص ن ا ر دبی نی ا م ز ا س د ه ع ت و تی

Διαβάστε περισσότερα

Gholami, S. Ph.D student of Educational Psychology, University of Tabriz, Iran

Gholami, S. Ph.D student of Educational Psychology, University of Tabriz, Iran Journal of Industrial/Organization Psychology Vol. 4/Issue14/Spring 2013 PP: 2135 ف ص ل ن ا م ه ر و ا ن ش ن ا س ص ن ع ت / س ا ز م ا ن س ا ل چ ه ا ر م. ش م ا ر ه چ ه ا ر د ه م بهار 2931 ص ص : 3 5 2 1 1

Διαβάστε περισσότερα

ن ه ع ال م ط ا بی ان ز م

ن ه ع ال م ط ا بی ان ز م ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ار س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 4931 بهار 1 ه ر ا م ش م ه ل ا س 5 7-4 9 ص ص ش ق ه ع ل ا ط م ا ب ا م ز ا س ر گ د ا ر ب ر ا ز گ ت م د خ ر ب

Διαβάστε περισσότερα

ATLAS green. AfWA /AAE

ATLAS green. AfWA /AAE مج م و ع ة ا لم ن ت ج ا ت K S A ا إل ص د ا ر ا ل د و ل ي ٠ ١ مج م و ع ة ا لم ن ت ج ا ت ٠ ٣ ج و ھ ر ة( ع د ت خ ص ص ة م TENVIRONMENTALLY FRIENDLY PRODUC ح د د ة م ا ل ھ و ي ة و ا ال ب ت ك ا ر و ا ل ط م و

Διαβάστε περισσότερα

2. Cropanzano, Byrne, Bobocel & Rupp 3. Maslach, & Leiter 4. Kivimaki,, Elovainio,., Vahtera., & Ferrie 5. Masterson., Lewise, Goldman, & Taylor 6.

2. Cropanzano, Byrne, Bobocel & Rupp 3. Maslach, & Leiter 4. Kivimaki,, Elovainio,., Vahtera., & Ferrie 5. Masterson., Lewise, Goldman, & Taylor 6. و ب و ش ش ز و م آ ت ر د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و م ال س ا د ا ز آ ه ا گ ش ن ا د 3 9 3 1 ر ا ه ب 1 ه ر ا م ش. م ت ش ه ل ا س 9 9-4 1 1 ص ص ت ل ا د ع ن ی ب ط ا ب ت ر ا ن ی ی ب ت ر د

Διαβάστε περισσότερα

ق ل ر ا ق د ا ج س 2 م ی ر ک ر و پ د ی س 3

ق ل ر ا ق د ا ج س 2 م ی ر ک ر و پ د ی س 3 ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 4931 بهار 1 ه ر ا م ش م ه ل ا س 5 9-5 1 1 ص ص د ا و ج ت ا س س ؤ م ش ه و ژ پ ا س ا ش ر ا ک ا ه ف ر ح ا ه

Διαβάστε περισσότερα

(Camelus dromedarius)

(Camelus dromedarius) س ع ی د و 6 ن ش ر ی ه م ی ک ر ب ی و ل و ژ ی د ا م پ ز ش ک ی / د و ر ه ی ا ز د ه م ش م ا ر ه د و م 1 4 9 3 پ ی ا پ ی 0-9 1: 3 7 9 ج د ا س ا ز ی ک و ه ا ن ه ا ی ر ا ن ی و ش ن ا س ا ی ی گ و ن ه ه ا ی ا ن

Διαβάστε περισσότερα

ي ش ز و م آ ت ي ر ي د م و ی ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 2 9 3 1 ن ا ت س ب ا ت 2 ه ر ا م ش م ت ف ه ل ا س 5 4-8 5 ص ص د ا ز آ ه ا گ ش ن ا د ن ا ي و ج ش ن ا

Διαβάστε περισσότερα

ا ر ف ی و ن ع م ی ر ب ه ر ل د م س ا س ا ر ب 2

ا ر ف ی و ن ع م ی ر ب ه ر ل د م س ا س ا ر ب 2 ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 تابستان 2 ه ر ا م ش. م ت ش ه ل ا س 9 5 1-9 7 1 ص ص ن ا ر ب د ه ا گ د د ز ا و ن ع م ر ب ه ر ا ه

Διαβάστε περισσότερα

ی ا و ق ت د و ع س م ن

ی ا و ق ت د و ع س م ن ه د ک چ ت م ال س ر گ ش د ر گ ه ع س و ت ر د ر ث و م ل م ا و ع د ب ت و ل و ا و ا س ا ش ر و پ ل ر ب ک ا ل ع د س ا ر ا ا ه ف ص ا ه و ژ پ ص خ ا ش ه ا گ ش ه و ژ پ ر ا د ا ت س ا ا و ق ت د و ع س م ا ر ا ا ه ف

Διαβάστε περισσότερα

Phallocryptus spinosa ر ا

Phallocryptus spinosa ر ا 0 8 7 ا و لي ن گ ز ا ر ش م ش ا ه د ه Phallocryptus spinosa ا س ت ا ن ه ا ی ا ز و ي ز د ف ا ر س د ر ج ن و ب Anostraca( )Crustaceae; اي ر ا ن ب ه ر و ز 4 4 2 آ ت ش ب ا ر *, ر ا م ي ن م ن ا ف ف ر ن ا ص ر

Διαβάστε περισσότερα

ر ک خواهد کمک ر گ ی د ن ا م ز ا س ر د ی ر ا ک م ا ج ن ا ه ب د ا ی ز ل ا م ت ح ا ه ب و ر ا ک ک ی م ا ج ن ا ر د ی ن ا م ز ا س 6

ر ک خواهد کمک ر گ ی د ن ا م ز ا س ر د ی ر ا ک م ا ج ن ا ه ب د ا ی ز ل ا م ت ح ا ه ب و ر ا ک ک ی م ا ج ن ا ر د ی ن ا م ز ا س 6 م ط ا ل ع ه) ک م ا ل ف ص ل ن ا م ه ه ب ی و م د ي ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ م س ا س ا ل ه ش ت م. ش م ا ه 2 تابستان 3931 ص ص -8 5 1 1 9 3 پ ی ش ب ی ن ی ف ت ا ش ه و ن د ی

Διαβάστε περισσότερα

: ک ی ن و ر ت ک ل ا ت س پ

: ک ی ن و ر ت ک ل ا ت س پ 3 9 3 1 م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ر ک ی م ه ی ر ش ن 3 4 1 13 5 : 9 2 ی پ ا ی پ ر د ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب ی ر و ت س ا پ س و ک و ک و

Διαβάστε περισσότερα

ص خ ش ش ن ا د ت ی ر ی د م ت ر ا ه م و ی ن ا م ز ا س ت ی ا م ح ز ا ک ا ر د ا ن ی ب ه ط ب ا ر ی س ر ر ب س

ص خ ش ش ن ا د ت ی ر ی د م ت ر ا ه م و ی ن ا م ز ا س ت ی ا م ح ز ا ک ا ر د ا ن ی ب ه ط ب ا ر ی س ر ر ب س ر 2 ف د ا ه ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 3931 تابستا 2 ه ر ا م ش. م ت ش ه ل ا س 7 2-7 4 ص ص ص خ ش ش ا د ت ر د م ت ر ا ه م و ا م ز ا س

Διαβάστε περισσότερα

ف ص ل ن ا م ه ر ه ب ر و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م. ش م ا ر ه 2 تابستان 3931 ص ص -7 8 6 7 ت ب ن ر ا ب ط ه ب ن ف ر ه ن گ س ا ز م ا ن و س ال

Διαβάστε περισσότερα

Employees in Oil Refinery Company

Employees in Oil Refinery Company Journal of Industrial/Organization Psychology Vol 3/Issue10/Spring 2012 PP: 73-84 ی ن ا م ز ا س / ی ت ع ن ص ی س ا ن ش ن ا و ر ه م ا ن ل ص ف 1 9 3 1 ر ا ه ب م ه د ه ر ا م ش م و س ل ا س 3 7-4 8 : ص ص ن ا

Διαβάστε περισσότερα

2. Knowledge Management

2. Knowledge Management ز و م آ ت در م و ر ب ر م ا ن ل ص ف ر ا س م ر گ د ح ا و م ال س ا د ا ز آ ا گ ن ا د 5 9 3 1 ر ا ب 1 ر ا م م د ل ا س 1 0 1-9 1 1 ص ص ن س ح ل ک ر ا د ا ر د ن ا م ز ا س ت م ال س ا ب ن ا د ت ر د م ر ا ر ق ت

Διαβάστε περισσότερα

د ا ز ز ا ب ه ش ر و ال د ن

د ا ز ز ا ب ه ش ر و ال د ن ه د ا ز ز ا ب ه ش ر و ال د ن ا ر م ا ک 3 9 3 1 م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ر ک ی م ه ی ر ش ن 1 3 1-12 4 : 9 2 ی پ ا ی پ ی ا ه ه ی و س ی و ر ی ن ا ر ی ا ل س ع ر و ب ن ز

Διαβάστε περισσότερα

Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους

Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους Οι 5 πυλώνες της πίστης: Μέρος 2 Πίστη στους αγγέλους أركان اإلميان - الركن الثاين : اإلميان ابملالئكة Άχμαντ Μ. Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org - Τζαμί «Σάλαφ ους Σαάλιχ»

Διαβάστε περισσότερα

Bacaan Doa dan Dzikir serta Taubat pilihan

Bacaan Doa dan Dzikir serta Taubat pilihan ijk Bacaan Doa dan Dzikir serta Taubat pilihan Dibawah ini adalah Dzikir Nabawiyah yang dibaca / diajarkan oleh Rasulullah SAW untuk ummatnya dan Nabi Muhammad SAW menganjurkan untuk diamalkan semua ummatnya.

Διαβάστε περισσότερα

الركن الخامس من اركان االيمان اإليمان باليوم

الركن الخامس من اركان االيمان اإليمان باليوم Οι 6 πυλώνες της πίστης: Μέρος 5 Πίστη στην Ημέρα της Κρίσης الركن الخامس من اركان االيمان اإليمان باليوم اآلخر Άχμαντ Μ.Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org Τζαμί «Σάλαφ ους

Διαβάστε περισσότερα

S Ô Ñ ª ^ ھ ھ ھ ھ ا حل م د هلل ا ل ذ ي أ ك ر م ا ل ب رش ي ة ة ب م ب ع ث ا ل ر مح ة ا مل ه د ا ة و ا ل ن ع م ة املسداة خرية خ ل ق ا هلل ا ل ن ب ي ا مل ص ط ف ى و ا ل ر س و ل ا مل ج ت ب ى ن ب ي ن ا و إ م

Διαβάστε περισσότερα

خ ہ ت ارف ادب جا زہ [+ ا ] through a cough and hiccough, he still had a rough

خ ہ ت ارف ادب جا زہ [+ ا ] through a cough and hiccough, he still had a rough ا ک( و ا ہ خان ب ری" ا جم ح د ث ان تح ات ا ہ پ جاب ) اج ) خ ا اور ت ظ ا واز ہ خ ہ ہ ا با د ا پر پا جا وا زبا وں ا ک روا ت ہ ان وت اور خ ا ا ار ں ت اد پا ا جاتا ہ تبد اں وت ات وا ن وجہ و وع پز ر وت ں جو

Διαβάστε περισσότερα

Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur.

Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur. ( ijk Assalamu 'Alaikum Wr.Wb. Pak Dasrul, Benar sekali Allah memberi informasi dalam Quran dan lebih-lebih melalui lisan RasulNya Muhammad SAW tentang siksa dan nikmat kubur. Kepada Fir'un di dalam kuburnya

Διαβάστε περισσότερα

الركن الثالث من أركان اإليمان: اإليمان بالكتب

الركن الثالث من أركان اإليمان: اإليمان بالكتب Οι 6 πυλώνες της πίστης: Μέρος 3 Πίστη στα βιβλία του Αλλάχ الركن الثالث من أركان اإليمان: اإليمان بالكتب Άχμαντ Μ.Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας www.islamforgreeks.org Τζαμί «Σάλαφ ους Σαάλιχ»

Διαβάστε περισσότερα

نقػ افؽبظبزی و گسارغ دهی در پیؽگیری از خطبهب در بیمبرظتبنهب

نقػ افؽبظبزی و گسارغ دهی در پیؽگیری از خطبهب در بیمبرظتبنهب اصلی مقبله مجله ارتقبی ایمنی و پیؽگیری از مصذومیت هب ز ض 2. قوبض 2. تبثؿتبى 393 نفحبت 73 تب 84 (Original Article) نقػ افؽبظبزی و گسارغ دهی در پیؽگیری از خطبهب در بیمبرظتبنهب 2 * امیر اؼکبن نصیری پور پوران

Διαβάστε περισσότερα

ارزیابی ريش ای مختلف برآيرد تبخیر بر مبىای تابص در ایستگا سیى پتیک سمىان

ارزیابی ريش ای مختلف برآيرد تبخیر بر مبىای تابص در ایستگا سیى پتیک سمىان ارزیابی ريش ای مختلف برآيرد تبخیر بر مبىای تابص در ایستگا سیى پتیک سمىان 3 1 مسع د سمیعی حاتم حیاتی میالد میرزائی -1 - واسض اس اسضذ آتخيضداسي اداس ول ه لاتغ يثيؼل آتخيلضداسي ا ل اى فلاسسmassamie@yahoo.com

Διαβάστε περισσότερα

هکا یک ساز ا ضار ا/ سال 1395/ د ر 6/ ضوار 4/ صفح DOI: **** حرارتی س ل ل ای دا طج ی کارض اس ارضذ ه ذسی هکا یک دا طگا عل م ف ى بابل بابل 2

هکا یک ساز ا ضار ا/ سال 1395/ د ر 6/ ضوار 4/ صفح DOI: **** حرارتی س ل ل ای دا طج ی کارض اس ارضذ ه ذسی هکا یک دا طگا عل م ف ى بابل بابل 2 ی س ا هکا یک ساز ا ضار ا/ سال 395/ د ر 6/ ضوار 4/ صفح 262-249 مجله علم ی ژپو هش ی م کانیک سازه اه و شاره اه DOI: **** اثر افسایص تعذاد چیذهاى ل ل یال گرم بر رفتار ر ب هاد تغییر فاز د ذ در هبذل حرارتی س

Διαβάστε περισσότερα

a;$ ag\a$ d D lb\ a;$ d d\ a$ d Dcn\

a;$ ag\a$ d D lb\ a;$ d d\ a$ d Dcn\ Ἀρχιμ. Ἀριστοβούλου Κυριαζῆ, Μαθήματα ἐκκλ. Μουσικῆς 1 Μέρος 1 ον, Θ. Λειτουργία Ἀραβική διά ἀρχαρίους, ἦχος πλ. Δ على للحن الثامن Beginning of the Divine Liturgy Ἦχος πλ. Δ weνη1 \s;$ s;cn\ s;$ 1a5 \

Διαβάστε περισσότερα

کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص

کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص کار گا آه سضی کاربزد آهار زم افشار SPSS در پژ ص عضو By:Reza Mazloum, PhD candidate 1 سیدرضا مظلوم ىیأت علمی دانشکده پرستاری و مامایی دکتری پرستاری rmazlomr@mums.ac.ir آهار تحلیلی یا است باطی Analytic Statistics

Διαβάστε περισσότερα

Tarbiat Modares University

Tarbiat Modares University Tarbiat Modares University From the SelectedWorks of Dr Alireza Zolfaghari December 25, 2012 تحليل تأثيرات استفاده از عايقهاي تغيير فاز دهنده بر - 25 ميزان مصرف ساالنه انرژي ساختمان در اقليم تهران Alireza

Διαβάστε περισσότερα

تحميمبت ه بث آة ايطاى Iran-Water Resources Research

تحميمبت ه بث آة ايطاى Iran-Water Resources Research تحميمبت ه بث آة ايطاى Iran-Water Resources Research ؾبل ز ن قوبض 3 ظهؿتبى 1393 38-5 Assessment of changes in hydro-meteorological variables upstream of Helmand Basin during the last century using CRU data

Διαβάστε περισσότερα

اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی

اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی صفحههای 281-290 اثر عصارۀ آبی بادرنجبویه officinalis( )Melissa بر پاسخ ایمنی و عملکرد جوجههای گوشتی *2 1 فائزه عبدینژاد و مهرداد محمدی 1. دانشآموخته کارشناسیارشد گروه علوم دامی دانشکدۀ علوم کشاورزی دانشگاه

Διαβάστε περισσότερα

ا جزء ا ثا ا شد ػ ذشج ح

ا جزء ا ثا ا شد ػ ذشج ح ا جزء ا ثا ا شد ػ ذشج ح ) ش د ج ( ا صخش وا د ا ض ح ) 4 : ( 1 و 10 Holy_bible_1 ا ضؤاي ثاي اخش 9-4: او 10 ج ؼ ششت ا ششاتا احذا س ح ا - أل وا ا ششت صخشج س ح ح ذاتؼر 1Co 10:4 ا صخشج وا د ا ض ح. ال جشب ا ض

Διαβάστε περισσότερα

انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا

انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا اال ل االخس زؤ 17 1: Holy_bible_1 انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا 3( صفس زؤ ا د ا انال ذ 17 1: ف ه ا ز أ ر ص ق ط د ػ د ز ج ه ك د ف ض غ د ان ػ ه ق ائ

Διαβάστε περισσότερα

Εἰρηνικά Θείας Λειτουργίας Κλασσικά Ἦχος ςeνη1

Εἰρηνικά Θείας Λειτουργίας Κλασσικά Ἦχος ςeνη1 Εἰρηνικά Θείας Λειτουργίας Κλασσικά Ἦχος ςeνη1 nassj\pa #gif j \ndcnf: j[ aa\x#pa duaγ d \ndlb Κσ ρι ε ε λε ε ε η ζον Κσ ρι ε ε λε ε ε η ζον Ya a ra ab u u u ur 7am Ya a ra ab u u u ur 7am Го спо ди по

Διαβάστε περισσότερα

Analytical study on the ballistic behavior of thin laminated composite plates based on Tsai-Hill and maximum strain criterions

Analytical study on the ballistic behavior of thin laminated composite plates based on Tsai-Hill and maximum strain criterions 5-6 صص شماره 6 دوره 693 شهریور مدرس مکانیک مهندسی مجله پژوهشی علمی ماهنامه مدرس مکانیک مهندسی mme.modares.ac.ir سای- معیارهای براساس چندالیه کامپوزیتی نازک ورقهای بالستیک رفتار تحلیلی بررسی ماکسیمم کرنش

Διαβάστε περισσότερα

سرآغاز

سرآغاز ی کبریه نقش حیطشنی درة 4 شة به 394 صفحة 5-37 ری قئشهر یهرد ردخنۀ طرف رب آب در جد گنکلره گنففره بقیندۀآفتکشهی 4 3 حدپر حن ردي حيدرض * بهريفر ندر طهري كي kmyrthri@yhoo.om نر پردی در تربیت دنشگه ز حیطزیت

Διαβάστε περισσότερα

ال حش ذ باىض س. Holy_bible_1 اىشب ت. Rom 13:9

ال حش ذ باىض س. Holy_bible_1 اىشب ت. Rom 13:9 ال حش ذ باىض س Holy_bible_1 اىشب ت س ت 9 :13 Rom 13:9 ( SVD )أل»ال حض ال حقخو ال حغشق ال حش ذ باىض س ال حشخ «إ ما ج ص ت أخش ج عت ف ز اىني ت:»أ ححب قش بل م فغل«. ( ALAB )أل اى صا ا»ال حض ال حقخو ال حغشق

Διαβάστε περισσότερα

Refugee Phrasebook/Greece March 2016-c

Refugee Phrasebook/Greece March 2016-c Refugee Phrasebook/Greece March 2016-c Arabic / Farsi / Urdu / Greek alphabet / Greek phonetic / English These icons come from the The Noun Project (CC-BY 3.0, not edited). Source: https://thenounproject.com/.

Διαβάστε περισσότερα

ΠΡΟΦΗΤΗ ΜΟΥ Ο ΜΗΝΑΣ ΤΟΥ. Aaqa ka Mahinah

ΠΡΟΦΗΤΗ ΜΟΥ Ο ΜΗΝΑΣ ΤΟΥ. Aaqa ka Mahinah Aaqa ka Mahinah Ο ΜΗΝΑΣ ΤΟΥ ΠΡΟΦΗΤΗ ΜΟΥ Αυτό το φυλλάδιο γράφτηκε στα ουρντού (πακιστανικά) από τον Σαίχ-ε-Ταρίκατ Αμίρ-ε-Άχλ-ε-Σούννατ, ιδρυτή της Δάβατ-ε-Ισλάμι, Αλλάμα Μολάνα Αμπου Μπιλάλ Μουχάμμαντ

Διαβάστε περισσότερα

هل تعبير والذي يأتي هو مضاف رؤيا 11:

هل تعبير والذي يأتي هو مضاف رؤيا 11: هل تعبير والذي يأتي هو مضاف 11 رؤيا 11: Holy_bible_1 الشبهة " 11 يقول البعض أن تعبير " الذي يأتي" في رؤيا 11: قائلين نشكرك ايها الرب االله القادر على كل شيء الكائن والذي كان والذي يأتي ألنك اخذت قدرتك

Διαβάστε περισσότερα

شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران )

شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران ) شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران ) 1 فاطمه کریمي دانشجوي دوره کارشناسي ارشد رشته مدیریت فناوري اطالعات دانشگاه آزاد اسالمي تهران ایران fatima.karimi04@gmail.com

Διαβάστε περισσότερα

ΘΕΛΩ ΝΑ ΑΝΟΡΘΩΣΩ ΤΟΝ ΕΑΥΤΟ ΜΟΥ

ΘΕΛΩ ΝΑ ΑΝΟΡΘΩΣΩ ΤΟΝ ΕΑΥΤΟ ΜΟΥ میں س دھرنا چاہتا ہوں Mayn Sudharna Chahta hon ΘΕΛΩ ΝΑ ΑΝΟΡΘΩΣΩ ΤΟΝ ΕΑΥΤΟ ΜΟΥ Αυτό το φυλλάδιο γράφτηκε στα ουρντού (πακιστανικά) από τον Σαίχ-ε-Ταρίκατ Αμίρ-ε-Άχλ-ε-Σούννατ, ιδρυτή της Δάβατ-ε-Ισλάμι,

Διαβάστε περισσότερα

Eacs Dsszs d d aa; f d dssaa[ Γ d d. ns\ ae s f: d d za d d a \a;#cd.k\ zaqe d d s

Eacs Dsszs d d aa; f d dssaa[ Γ d d. ns\ ae s f: d d za d d a \a;#cd.k\ zaqe d d s Ἀρχιμ. Ἀριστοβούλου Κυριαζῆ, Μαθήματα ἐκκλ. Μουσικῆς 1 Μέρος 2 ον, Ὀκτώηχος, Δοξολογία Ἑλληνο-Ἀραβική, Ἦχος πλ. Δ Δοξολογία Ἦχος πλ δ,weνη1 Eacs Dsszs d d aa; f d dssaa[ Γ d d Δ ν ν μα ζνη ησ δεη μαλ ηη

Διαβάστε περισσότερα

ا جزء ا ضابع ا شد ع اخطاء حشج ت ش د ط ب ا خشب

ا جزء ا ضابع ا شد ع اخطاء حشج ت ش د ط ب ا خشب ا جزء ا ضابع ا شد ع اخطاء حشج ت ش د ط ب ا خشب 19-17 : 19 Holy_bible_1 ا ضؤاي ى ىخف ف حع ا ا ض خ ب د ب ا ى حذم ش ف س ز ا خالص ا ذي ا ظ ب د ذ ا م ف حشج ا ظ ب ا ى خشب خ شى ع عخمذ ا ا ض خ ظ ب ع ى ط ب ب ع ى

Διαβάστε περισσότερα

Άχμαντ Ελντίν Θάνατος: Το αναπόφευκτο γεγονός και η επίγεια προετοιμασία του Μουσουλμάνου. Θάνατος:

Άχμαντ Ελντίν Θάνατος: Το αναπόφευκτο γεγονός και η επίγεια προετοιμασία του Μουσουλμάνου. Θάνατος: Θάνατος: Το αναπόφευκτο γεγονός και η επίγεια προετοιμασία του Μουσουλμάνου كل نفس ذائقة املوت του Άχμαντ Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας Τζαμί Σάλαφ ους Σάλιχ (πρώην αρ- Ραχμάν) Αθήνα, 2016 Δεν

Διαβάστε περισσότερα

ﻰﺿﺎﻳﺭ ﻥﺎﺘﺴﺑﺩ ﻢﺸﺷ ۱۳۹١

ﻰﺿﺎﻳﺭ ﻥﺎﺘﺴﺑﺩ ﻢﺸﺷ ۱۳۹١ رياضى ششم دبستان ۱۳۹١ وزارت آموزش و پرورش سازمان پژوهش و برنامه ريزی آموزشی برنامهريزی محتوا و نظارت بر تا ليف: دفتر تا ليف کتابهای درسی ابتدايی و متوسطه نظری نام کتاب: رياضی ششم دبستان ۳۴/۶ مو ل فان:

Διαβάστε περισσότερα

الغشاء البولميري مطعم بالصبغات العضوية الستخدامها فعالة ليزرية ذات استقرا ريه عالية علي جهاد كاطع / جامعة ذي قار / كلية العلوم / قسم الفيزياء الخالصة

الغشاء البولميري مطعم بالصبغات العضوية الستخدامها فعالة ليزرية ذات استقرا ريه عالية علي جهاد كاطع / جامعة ذي قار / كلية العلوم / قسم الفيزياء الخالصة دراسة تكوين الغشاء البولميري مطعم بالصبغات العضوية الستخدامها فعالة ليزرية ذات استقرا ريه عالية علي جهاد كاطع / جامعة ذي قار / كلية العلوم / قسم الفيزياء كأوساط تمممي هممما بمممصن نة غممم ومممري مممي ممم

Διαβάστε περισσότερα

انض دخ TC يز بثم انض دخ انطبفش CC لذ ثهغ انزكشاس االن ه نالن م C نذ ان غبء ان ش ؼبد 0.44 اكثش ي ػعف يب ف

انض دخ TC يز بثم انض دخ انطبفش CC لذ ثهغ انزكشاس االن ه نالن م C نذ ان غبء ان ش ؼبد 0.44 اكثش ي ػعف يب ف اسرجبؽ رعذد اشكبل اندCYP17 يع يزالصيخ رك ظ ان جب غ PCOS نذ غبء يسبفظخ طالذ انذ / انعشاق Plymorphism of CYP17 for Polycystic Ovarian Syndrome in Women of Salah Al-Din Provence/ Iraq عم م زغ انعبط * عبدل

Διαβάστε περισσότερα

Archive of SID. یا یات کار دی وا د لا جان مقدمه 1 2 چکیده 1 SDE. ا درس الکترونیکی:

Archive of SID.  یا یات کار دی وا د لا جان مقدمه 1 2 چکیده 1 SDE. ا درس الکترونیکی: ج ه ر یا یات کار دی وا د لا جان سال م ماره ١ (ایپپی ٢۴ ھار ٨٩ ص ص ٩٣-١٠١ مقایسه عددی جواب معادله دیفرانسیل تصادفی با نوفه سفید گاوسی و پواسونی رمضان رضاییان رحمان فرنوش. چکیده دانشکده علوم پایه دانشگاه

Διαβάστε περισσότερα

pfe d s d za d daa;fdssdh{aa\#a;cd.j\

pfe d s d za d daa;fdssdh{aa\#a;cd.j\ Ἀρχιμ. Ἀριστοβούλου Κυριαζῆ, Μαθήματα ἐκκλ. Μουσικῆς 1 Μέρος 2 ον, Ἑλληνο-Ἀραβική Δοξολογία ἦχος Α Δοξολογία Ἑλληνο-Ἀραβική Ἦχος Α,qe.Πα2 pfe d s d za d daa;fdssdh{aa\#a;cd.j\ Γο ξα ζοι ηυ δει ξαν ηι ηο

Διαβάστε περισσότερα

1223/2 LATIH TUBI PENDIDIKAN ISLAM 2005 SET 2. 1 (a) Tulis semula petikan ayat al-quran berikut dan letakkan tanda baris dengan sempurna. ...

1223/2 LATIH TUBI PENDIDIKAN ISLAM 2005 SET 2. 1 (a) Tulis semula petikan ayat al-quran berikut dan letakkan tanda baris dengan sempurna. ... 4 3 ( 1223/2 LATIH TUBI PENDIDIKAN ISLAM 2005 1 (a) Tulis semula petikan ayat al-quran berikut dan letakkan tanda baris dengan sempurna. ß ÏΒ σßϑø9$# ãνn= 9$# â ρ à)ø9$# à7î=yϑø9$# uθèδ ωî) tµ9î) Iω Ï%!$#

Διαβάστε περισσότερα

یکاروخ یاهدیئولکوردیه یرب میزنآ یزاس لدم ندرک خرس نغور بذج هدش هعطق ینیمز بیس :یدیلک یاه هژاو

یکاروخ یاهدیئولکوردیه یرب میزنآ یزاس لدم ندرک خرس نغور بذج هدش هعطق ینیمز بیس :یدیلک یاه هژاو 21 1392 پاییز 21-36 صفحه 1 شماره اول سال غذایی نوین فناوریهای و علوم فصلنامه روغن جذب کاهش روی خوراکی هیدروکلوئیدهای و آنزیمبری تأثیر شده قطعه سیبزمینی سرخکردن طی 2 خیابانی صوتی محمود و 2* نیا دهقان جالل

Διαβάστε περισσότερα

چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش

چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش مهندس وحيد گودرزي چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش 1- مقدمه موتوره ای DC اولین وس یله تبدیل ان رژی الکتریکی به ان رژی مکانیکی بودند. موتورهای

Διαβάστε περισσότερα

3 24: فدخلن و لم يجدن جسد الرب يسوع

3 24: فدخلن و لم يجدن جسد الرب يسوع Holy_bible_1 م قب 3:24 امرة ش ػ م قب 3:24 3 24: فدخلن و لم يجدن جسد الرب يسوع امخى يبك أقن وى أؽظبء امنجي فظنح امقراء األقضر, خدؽو وب اموخع عبح ا ذؼث ش " D it a,b,d,e,ff2,l,r1 ( ايغر امونح غ ؽنى ؽده امز

Διαβάστε περισσότερα

Refugee Phrasebook/Greece March 2016-a

Refugee Phrasebook/Greece March 2016-a Refugee Phrasebook/Greece March 2016-a Standard Arabic / English [ ر. ] / Farsi / Greek phonetic / Greek alphabet / Kurdish (Kurmancî) / Urdu These icons come from the The Noun Project (CC-BY 3.0, not

Διαβάστε περισσότερα

الزجبعبد ا ؼ ذ ا جذ ٠ ذ عفش ا ال ١٠

الزجبعبد ا ؼ ذ ا جذ ٠ ذ عفش ا ال ١٠ الزجبعبد ا ؼ ذ ا جذ ٠ ذ عفش ا ال ١٠ Holy_bible_1 87 ال ١٠ 8 901»خ شا غىشا ال رششة ا ذ ث ن ؼه ػ ذ دخ ى ا خ ١ خ االجز بع ى ال ر ر ا. فشضب د ش ٠ ب ف اج ١ ب ى H8354 drink ת שת H413 אל H4191 ye die: תמתו H408

Διαβάστε περισσότερα

الزجبعبد ا ع ذ ا جذ ٠ ذ عفش اس ١ ب

الزجبعبد ا ع ذ ا جذ ٠ ذ عفش اس ١ ب الزجبعبد ا ع ذ ا جذ ٠ ذ عفش اس ١ ب Holy_bible_1 363 اس ١ ب 12 :5 (SVD) اع ع زا أ ٠ ب ا شعت ا جب ا عذ ٠ ا ف ا ز ٠ أع ١ ال ٠ جصش. آرا ال ٠ غ ع. H5530 O סכל להם H5971 people, עם H2063 this, ז H5869 which

Διαβάστε περισσότερα

Electricity and Energy

Electricity and Energy Electricity and Energy - 1 - Standards: 22.1: Distinguish alternating current (AC) from direct current (DC) and know why household electricity is AC and not DC. 22.2: Know that household electrical energy

Διαβάστε περισσότερα

الزجبصبد ا ؿ ذ ا جذ ذ صفش ش ؼ

الزجبصبد ا ؿ ذ ا جذ ذ صفش ش ؼ الزجبصبد ا ؿ ذ ا جذ ذ صفش ش ؼ Holy_bible_1 071 ش ؼ 5 :0 ال مف إ ضب ف ج ه و أ ب ح بره. و ب و ذ ؽ صى أو ؿه. ال أ ه (SVD) ال أرشوه. H376 any man אי ש H834 as כא שר H5973 with עמך H2416 of thy life: חייך H3320

Διαβάστε περισσότερα

Jinnat ka Badshah Ο ΒΑΣΙΛΙΑΣ ΤΩΝ ΤΖΙΝ

Jinnat ka Badshah Ο ΒΑΣΙΛΙΑΣ ΤΩΝ ΤΖΙΝ ج ن ات کا بادشاھ Jinnat ka Badshah Ο ΒΑΣΙΛΙΑΣ ΤΩΝ ΤΖΙΝ Αυτό το φυλλάδιο γράφτηκε στα ουρντού (πακιστανικά) από τον Σαίχ-ε-Ταρίκατ Αμίρ-ε-Άχλ-ε-Σούννατ, ιδρυτή της Δάβατ-ε-Ισλάμι, Αλλάμα Μολάνα Αμπου Μπιλάλ

Διαβάστε περισσότερα

The Fragments of Heraclitus

The Fragments of Heraclitus The Fragments of Heraclitus Introduction When reading the fragments of Heraclitus, we are reading what a dozen people a long time ago said Heraclitus said a long time ago. We are reaching back two thousand,

Διαβάστε περισσότερα

اقحجبصبت انع ذ انجذ ذ ي صفش اخجبس اال بو اال ل انثب

اقحجبصبت انع ذ انجذ ذ ي صفش اخجبس اال بو اال ل انثب اقحجبصبت انع ذ انجذ ذ ي صفش اخجبس اال بو اال ل انثب Holy_bible_1 481 اخجبس اال بو اال ل 41 41: أ ب أك ن أثب ك ن اث ب, ال أ زع سح ح ع ك ب زعح ب ع انز كب (SVD) H1931 and he והוא H3808 and I will לא H5493

Διαβάστε περισσότερα

Samundari Gumbad. (Τα δικαιώματα των γονιών στο Ισλάμ)

Samundari Gumbad. (Τα δικαιώματα των γονιών στο Ισλάμ) رى Samundari Gumbad ΩΚΕΑΝΙΟΣ ΤΡΟΥΛΟΣ (Τα δικαιώματα των γονιών στο Ισλάμ) Αυτό το φυλλάδιο γράφτηκε στα Ούρντου(Πακιστανικά) από τον Σαίχ-ε-Ταρίκατ Αμίρ-ε-Άχλ-ε-Σούννατ, ιδρυτή της Δάβατ-ε-Ισλάμι, Αλλάμα

Διαβάστε περισσότερα

ﯽﺳﻮﻃ ﺮﯿﺼﻧ ﻪﺟاﻮﺧ ﯽﺘﻌﻨﺻ هﺎﮕﺸﻧاد

ﯽﺳﻮﻃ ﺮﯿﺼﻧ ﻪﺟاﻮﺧ ﯽﺘﻌﻨﺻ هﺎﮕﺸﻧاد دانشگاه صنعتی خواجه نصیر طوسی دانشکده برق - گروه کنترل آزمایشگاه کنترل سیستمهای خطی گزارش کار نمونه تابستان 383 به نام خدا گزارش کار آزمایش اول عنوان آزمایش: آشنایی با نحوه پیاده سازی الکترونیکی فرایندها

Διαβάστε περισσότερα

مسائل فیزیک هالیدی & رزنیک

مسائل فیزیک هالیدی & رزنیک حرکت در مسیر مستقیم )حرکت یک بعدی( حمیدرضا طهماسبی سرعت متوسط و تندی متوسط 1. هنگام یک عطسه ی شدید چشمان شما ممکن است برای 0.50s بسته شود. اگر شما درون خودرویی در حال رانندگی با سرعت 90km/h باشید ماشین

Διαβάστε περισσότερα

المعجم اإلنجليزي الفرنسي العربي لمصطلحات ضعف المناعة األولي. محمد واورير Mohamed OUAOURIR. أحمد عزيز بوصفيحة Ahmed Aziz Bousfiha

المعجم اإلنجليزي الفرنسي العربي لمصطلحات ضعف المناعة األولي. محمد واورير Mohamed OUAOURIR. أحمد عزيز بوصفيحة Ahmed Aziz Bousfiha Dictionary English French Arabic terms of PID Dictionnaire Anglais Français Arabe des termes des DIP المعجم اإلنجليزي الفرنسي العربي لمصطلحات ضعف المناعة األولي محمد واورير Mohamed OUAOURIR أحمد عزيز بوصفيحة

Διαβάστε περισσότερα

Κπ ξη ε ε θε θξα α μα πξν νο ζε εη ζα α α θνπ. ζπ κη α α α κα α ε λσ πη ν ν ν νλ ζνπ ε. da;sss;sssss;ss;sss;sss;s

Κπ ξη ε ε θε θξα α μα πξν νο ζε εη ζα α α θνπ. ζπ κη α α α κα α ε λσ πη ν ν ν νλ ζνπ ε. da;sss;sssss;ss;sss;sss;s b K Ἀρχιμ Ἀριστοβούλου Κυριαζῆ, Μαθήματα ἐκκλ. Μουσικῆς 1 Μέρος 17 ον, Δευτέρα Ἁγίου Πνεύματος, Ἅπαντα Εἰς τόν Ἑσπερινόν τῆς Γονυκλισίας, Ἦχος Δ,ce.Πα zq zg D Go ] G s k fe: x ] K π ξη ε ε θε θξα α μα

Διαβάστε περισσότερα

هدف از این آزمایش آشنایی با برخی قضایاي ساده و در عین حال مهم مدار از قبیل قانون اهم جمع آثار مدار تونن و نورتن

هدف از این آزمایش آشنایی با برخی قضایاي ساده و در عین حال مهم مدار از قبیل قانون اهم جمع آثار مدار تونن و نورتن آزما ی ش سوم: ربرسی اقنون ا ه م و قوانین ولتاژ و جریان اهی کیرشهف قوانین میسقت ولتاژ و میسقت جریان ربرسی مدا ر تونن و نورتن قضیه ااقتنل حدا کثر توان و ربرسی مدا ر پ ل و تس ون هدف از این آزمایش آشنایی با

Διαβάστε περισσότερα

الزجبعبد ا ؼ ذ ا جذ ٠ ذ االعفبس ا مب ١ خ ا ثب ١ خ

الزجبعبد ا ؼ ذ ا جذ ٠ ذ االعفبس ا مب ١ خ ا ثب ١ خ الزجبعبد ا ؼ ذ ا جذ ٠ ذ االعفبس ا مب ١ خ ا ثب ١ خ Holy_bible_1 ٠ جذ شى ز ١ ر اج ف الزجبعبد االعفبس ا مب ١ خ ا ثب ١ خ ا ال ػذ ر افك و ا زشج بد ف ا ش ا ذ فش ا ذ ٠ د ٠ ذ ف ا ف جبرب رخز ف ر ب ب ػ ا ز ف ا غجؼ

Διαβάστε περισσότερα

PEPERIKSAAN PERCUBAAN SIJIL PELAJARAN MALAYSIA 2011

PEPERIKSAAN PERCUBAAN SIJIL PELAJARAN MALAYSIA 2011 SULIT 1223/1 Pendidikan Islam Kertas 1 September 2011 2 jam MAKTAB RENDAH SAINS MARA 1223/1 PEPERIKSAAN PERCUBAAN SIJIL PELAJARAN MALAYSIA 2011 PENDIDIKAN ISLAM Kertas 1 Dua jam 1 2 2 3 1 JANGAN BUKA KERTAS

Διαβάστε περισσότερα

ms[\zsο d xd d gaqaγ[ d]\d<#vg\si\dzaqζ d Dg aaγ[ d] \d<#qk.\

ms[\zsο d xd d gaqaγ[ d]\d<#vg\si\dzaqζ d Dg aaγ[ d] \d<#qk.\ .p Ἀρχιμ. Ἀριστοβούλου Κυριαζῆ, Μαθήματα Ἐκκλ. Μουσικῆς, Μέρος 6 ον 1 Λειτουργικά Β. Νικολαΐδου Ἀραβικά-Ρωσικά-Ρουμανικά, Ἦχος Γ Λειτουργικά Βασ. Νικολαΐδου Ἑλληνικά-Ἀραβικά-Ρωσικά Φορωδιακά 1 Ἦχος Γ t

Διαβάστε περισσότερα

تئوری جامع ماشین بخش سوم جهت سادگی بحث یک ماشین سنکرون دو قطبی از نوع قطب برجسته مطالعه میشود.

تئوری جامع ماشین بخش سوم جهت سادگی بحث یک ماشین سنکرون دو قطبی از نوع قطب برجسته مطالعه میشود. مفاهیم اصلی جهت آنالیز ماشین های الکتریکی سه فاز محاسبه اندوکتانس سیمپیچیها و معادالت ولتاژ ماشین الف ) ماشین سنکرون جهت سادگی بحث یک ماشین سنکرون دو قطبی از نوع قطب برجسته مطالعه میشود. در حال حاضر از

Διαβάστε περισσότερα

نکنید... بخوانید خالء علمی خود را پر کنید و دانش خودتان را ارائه دهید.

نکنید... بخوانید خالء علمی خود را پر کنید و دانش خودتان را ارائه دهید. گزارش کار آزمایشگاه صنعتی... مکانیک سیاالت ( رینولدز افت فشار ) دانشجویان : فردین احمدی محمد جاللی سعید شادخواطر شاهین غالمی گروه یکشنبه ساعت 2::0 الی رینولدز هدف : بررسی نوع حرکت سیال تئوری : یکی از انواع

Διαβάστε περισσότερα

BAB DUA: PENENTUAN WAKTU SOLAT DAN RUKHSAHNYA TERHADAP MUSAFIR

BAB DUA: PENENTUAN WAKTU SOLAT DAN RUKHSAHNYA TERHADAP MUSAFIR BAB DUA: PENENTUAN WAKTU SOLAT DAN RUKHSAHNYA TERHADAP MUSAFIR 2.1 PENDAHULUAN Ibadah solat merupakan ibadah fardu dan mempunyai kedudukan yang tinggi dalam Islam. Nabi Muhammad menekankan solat setelah

Διαβάστε περισσότερα

الزجبعبد ا ؼ ذ ا جذ ذ عفش صوش ب ا ج

الزجبعبد ا ؼ ذ ا جذ ذ عفش صوش ب ا ج الزجبعبد ا ؼ ذ ا جذ ذ عفش صوش ب ا ج Holy_bible_1 415 صوش ب 2 :3 فمبي ا شة ش طب : ] ز شن ا شة ب ش طب. ز شن ا شة ا زي اخزبس (SVD) أ سش. أف ظ زا شؼ خ زش خ ا بس [. H7854 Satan, ה שטן H1605 rebuke ויגער H413

Διαβάστε περισσότερα

پايداری Stability معيارپايداری. Stability Criteria. Page 1 of 8

پايداری Stability معيارپايداری. Stability Criteria. Page 1 of 8 پايداری Stility اطمينان از پايداری سيستم های کنترل در زمان طراحی ا ن بسيار حاي ز اهمييت می باشد. سيستمی پايدار محسوب می شود که: بعد از تغيير ضربه در ورودی خروجی به مقدار اوليه ا ن بازگردد. هر مقدار تغيير

Διαβάστε περισσότερα

(POWER MOSFET) اهداف: اسيلوسكوپ ولوم ديود خازن سلف مقاومت مقاومت POWER MOSFET V(DC)/3A 12V (DC) ± DC/DC PWM Driver & Opto 100K IRF840

(POWER MOSFET) اهداف: اسيلوسكوپ ولوم ديود خازن سلف مقاومت مقاومت POWER MOSFET V(DC)/3A 12V (DC) ± DC/DC PWM Driver & Opto 100K IRF840 منابع تغذيه متغير با مبدل DC به DC (POWER MOSFET) با ترانز يستور اهداف: ( بررسی Transistor) POWER MOSFET (Metal Oxide Semiconductor Field Effect براي كليد زني 2) بررسي مبدل DC به.DC كاهنده. 3) بررسي مبدل

Διαβάστε περισσότερα

برآورد فشار بهينه گل حفاري با استفاده از

برآورد فشار بهينه گل حفاري با استفاده از 104 شماره 73 برآورد فشار بهينه گل حفاري با استفاده از معيارهاي مختلف شکست در چاههاي انحرافي مطالعه موردي: چاه 2sk 5 ميدان نفتي سلمان * عبدالمجيد موحدينيا محمد کمال قاسم العسکري و محسن ياراحمدي دانشگاه

Διαβάστε περισσότερα

بسم ا الرحمن الرحيم الطلاب و الطالبات الكرام... ا ليكم جميع حلول كتاب فيزياء الحادي عشر و الما خوذة من كتاب دليل المعلم الفلسطيني في الفيزياء..

بسم ا الرحمن الرحيم الطلاب و الطالبات الكرام... ا ليكم جميع حلول كتاب فيزياء الحادي عشر و الما خوذة من كتاب دليل المعلم الفلسطيني في الفيزياء.. بسم ا الرحمن الرحيم الطلاب و الطالبات الكرام... ا ليكم جميع حلول كتاب فيزياء الحادي عشر و الما خوذة من كتاب دليل المعلم الفلسطيني في الفيزياء.. لمشاهدة كل ما هو ممتع و مفيد في فيزياء الحادي عشر تفضلوا

Διαβάστε περισσότερα

الحجبصبت ا ع ذ ا جذ ٠ ذ صفش ص ئ ١ اال ي ا ثب

الحجبصبت ا ع ذ ا جذ ٠ ذ صفش ص ئ ١ اال ي ا ثب الحجبصبت ا ع ذ ا جذ ٠ ذ صفش ص ئ ١ اال ي ا ثب Holy_bible_1 371 ص ئ ١ اال ي 11 :31 (SVD) أل ال ٠ حشن ا شة شعج أج اص ا عظ ١. أل لذ شبء ا شة أ ٠ جع ى شعجب. H3068 the LORD H1419 for his great הגדול H6213 to

Διαβάστε περισσότερα