: ک ی ن و ر ت ک ل ا ت س پ

Save this PDF as:

Μέγεθος: px
Εμφάνιση ξεκινά από τη σελίδα:

Download ": ک ی ن و ر ت ک ل ا ت س پ"


1 : 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ک ی م ه ی ش ن م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ه د و ل آ ت ا ن ا و ی ح ع و ف د م ز ا ی ت ک ا ب د ق ا ف م و و ا پ *1 ی م ا غ ض ل ص ی ف ن ا ی د ی م ا ا ه ز ه د ا ز م ی ه ا ب ا ه ه ل ا ی غ ص ا ب ن ی ز ن ا ی ا ش ز ی و پ 1 ه- و گ ن ا ی ا ن ا ه ت ن ا ه ت ه ا گ ش ن ا د ی ک ش ز پ م ا د ه د ک ش ن ا د لشناسی گ ن ا ی د 1 : ت ف ا ی د خ ی ا ت ن م ه ب 1 2 : ش ی ذ پ خ ی ا ت ه د ی ک چ ت ا ن ا و ی ح د ا ز و ن و ی ن م ی ا ص ق ن ا چ د د ا ف ا د ه ک د ش ا ب ی م ن ا و ی ح و ن ا س ن ا ن ی ب ک ت ش م ی ا ه ت خ ا ی ک ت م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ا ه ب آ ع ب ا ن م ص و ص خ ب ط ی ح م ی گ د و ل آ ث ع ا ب ه د و ل آ ی ا ه م ا د ز ا ه د ش ع ف د ی ا ه ت س ی س و و ا. د ش ا ب ی م ا ز ی ا م ی ب ا ه ه ل ا س و گ ص و ص خ ب ه ب ا ه ت س ی س و و ا گ ی د ف ط ز ا و د ش ا ب ی ا م ی ب گ ز ا غ آ د ن ا و ت ی م ت س ی س و و ا م ک د ا د ع ت ی ت ح ه ک ن ی ا ه ب ه ج و ت ا ب. د ن و ش ی م ی ح ط س ی ا ه ش و ت س ا ه د ش ش ال ت ه ا و م ه و ه ت ف گ ا ق ن ی ق ق ح م ه ج و ت د و م ه ت خ ا ی ک ت ن ی ا د ن م و ا ق م ل و ا د ت م ی ا ه ه د ن ن ک ی ن و ف ع د ض و د و ش ه ن ی ه ب ت س ی س و و ا م ک د ا د ع ت ی ا ا د ی ط ی ح م ی ا ه ه ن و م ن د ی ت ح م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ص ی ل خ ت و ی ز ا س ا د ج ی ل و ک ل و م و ی ک ی ژ و ل و ن م ی ا ت ا ع ل ا ط م و ظ ن م ه ب ا ه ی ص ل ا خ ا ن ی ا س و ی ی ا ی ت ک ا ب ی ا ه ی گ د و ل آ ز ا ی ا ع و ص ل ا خ ال م ا ک ی ی ا ه ت س ی س و و ا ت س ی س و و ا ه ب د ن ا ه ت س ن ا و ت ن ک ی چ ی ه ی ل و د ن ا ه د و ب ز ی م آ ت ی ق ف و م حدودی تا د ن ا ه د ش ه د ا ف ت س ا کنون تا که مختلفی ی ا ه ش و. گدد فاهم و ظ ن م ه ب ق ی ق ح ت ن ی ا د. د ش ا ب ی م ی ت ک ا ب ز ا ی ا ع ت س ی س و و ا ه ب ی ب ا ی ت س د ق ی ق ح ت ن ی ا ز ا ف د ه. د ن ن ک ا د ی پ ت س د ی ت ک ا ب ز ا ی ا ع ل و ل ح م م ا ع ط ک م ن ل و ل ح م ز ا ه د ا ف ت س ا ل م ا ش ی ز ا س و ا ن ش ش و ا ه چ ا د ت ب ا کیپتوسپویدیوم ی ا ه ت س ی س و و ا ه ی ل و ا ی ز ا س ا د ج ی ا ب ش و ن ی ت ه ب د ص د 5 5 ز ا ک ا س ل و ل ح م. د ی د گ ه د ا ف ت س ا د ص د 5 5 ز ا ک ا س ل و ل ح م و ل و ک ی ا ف ی ن ا ک ل پ ی ت ظ ل غ ب ی ش ز ا ک ا س ت ل ی ف ز ا ه ا م ه ی ا ه ی ص ل ا خ ا ن ی ا س و ی ت ک ا ب ف ذ ح ت ه ج. د ی د گ ی ب ا ی ز ا م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ه ی ل و ا ی ز ا س ا د ج ن و ی س ا ت ل ی ف ز ا ل ص ا ح ی ا ه ت س ی س و و ا ه ک د ا د ن ا ش ن ه د ش ج ا خ ت س ا ی ا ه ت س ی س و و ا ز ی ل ا ن آ. د ی د گ ه د ا ف ت س ا ) ن و ک ی م 3 ذ ف ا ن م ا ب ( ز ل و ل س و ت ی ن ت س د ز ا ص ی ل خ ت ن ی ح د ا ه ت س ی س و و ا ز ا ی د ا ی ز د ا د ع ت ه چ گ ا. د ی د گ ی ب ا ی ز ا 0 3 ا ه ن آ د ص د و د و ب ی ت ک ا ب ه ن و گ ه ز ا ی ا ع. د ن ش ا ب ی م ب س ا ن م ا ی س ب س ک ی م و ئ ت و پ ت ا ش ی ا م ز آ ی ا ب ه د ش ص ی ل خ ت ی ا ه ت س ی س و و ا ا م ا د ن ت ف ن و ی س ا ت ل ی ف ی ز ا س و ا ن ش ت س ی س و و ا م و ا پ م و ی د ی و پ س و ت پ ی ک : ی د ی ل ک ت ا م ل ک ن ا ی ا ش ز ی و پ : ل و ئ س م ه د ن س ی و ن : ن ف ل ت. ن ا ی ا ن ا ه ت ن ا ه ت ه ا گ ش ن ا د ی ک ش ز پ م ا د ه د ک ش ن ا د ی س ا ن ش ل گ ن ا ه و گ : س د آ : ک ی ن و ت ک ل ا ت س پ

2 و 1 و ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 7 ه م د ق م ت س ا ا س ک ل پ م ک پی ا شاخه از ی ا ه ت خ ا ی ک ت م و ی د ی و پ س و ت پ ی ک ه ک ه ی ال کی ا و س م ای ه ل و ل س ی ا ه د و ث ک ا ه ه م ه ب ش ی پ دی ن چ ا ت. د ه د ی م ا ق م ج ا ه ت د و م ا ن ا ا د ن ا و ن ع ک ی ل گ ن ا ت ص ف ب ل ط ل و ا د ت م ی غ ح ط م د و ب د ی ا ه د و ی ا ز ی ا م ی ب ل م ا ع ک ی ن ا و ن ع ه ب ن و ن ک ا لی و ه ب ن ا ی ال ت ب م د ه ژ ی و ب م ا د و ن ا س ن ا ک ت ش م ای ه ی ا م ی ب ص ق ن ی ن م ی ا د و م ه ج و ت ا ق ه ت ف گ ت س ا. )2 ( ه ل م ج ز ا ه د و ل آ ی ا ه م ا د ط س و ت ه د ش ع ف د ی ا ه ت س ی س و و ا ع ب ا ن م د ن ن ا م ط ی ح م ن د ش ه د و ل آ ب ج و م د ن ا و ت ی م ه ل ا س و گ ی ح ط س ب آ. د و ش ش ا ز گ ه د ش ت س ا ه ک د ن ا و ت ی م م و و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا گی د و ل آ د. ش ا ب ا ب ه ج و ت ه ب ت م و ا ق م د ا د ع ت م ک گ ز ا غ آ ا ه ت س ی س و و ا ه ب ی ع ط ق ن ا م د د و ج و م د ع و ل و ا د ت م کنندههای ضدعفونی م و ی د ی و پ س و ت پ ی ک ه ی ل ع م و ز ل ص ی خ ش ت ت یس س و و ا د ا د ع ت ا ب ی ی ا ه ه ن و م ن د ی ت ح م و و ا پ م و ی د ی و پ س و ت پ ی ک م ک د و ج و ب س ک ی م و ئ ت و پ د ا ی ز و ص ل ا خ. د ا د م ا ج ن ا ت ا ق ی ق ح ت ی ل و ک ل و م و د ا د ع ت ه ب ووم ا پ کیپتوسپویدیوم ی و ت س ی س و و ا ز ا ی ن د ا د. ) 1 ( ن و ن ک ا ت ) )2 ز ا ک ا س ل و ل ح م ز ا ه د ا ف ت س ا د ن ن ا م ی ف ل ت خ م ی ا ه ش و ) 3 2 ( % 5 5 ز ا ک ا س ل و ل ح م ) و 9 )5 م ا ع ط ک م ن ل و ل ح م ب ی ش ل ک پ ی ت ظ ل غ ) 1 ( ع ط ق ن م ی غ ه ب ز ا ک ا س و ظ ن م ه ا م ه ص ی ل خ ت ا ب ب ی ش ی ت ظ ل غ ی ا ه ت س ی س و و ا ب ی ن ت ب م ی ا ه ش و. ت س ا شده استفاده و ک ذ م ه ت خ ا ی ک ت ص ی ل خ ت ز ا ق ی ط ک ی ت ن گ م و ن م ی ا ت ه ج ی ز ا س ا د ج ش ا ز گ ز ی ن م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ه د ش ت س ا. ) )8 گ ا ه چ د ش و ک ی ت ن گ م و ن و م ی ا ن ی ا ا م ا د ن ش ا ب ی م ی ز ا س ا د ج ل ب ا ق ص ل ا خ ی ا ه ت س ی س و و ا ش و ا ه ب ت ل ع ی ن ا گ ه ی ه ت د ا و م د و م ز ا ی ن ه ش ی م ه ا ه ت س ی س و و ا د ن ا و ت ب ه ک ی ش و ا ذ ل. د ش ا ب ی م ن ی ذ پ ن ا ک م ا ن ا ز ا ز ا ه ن و گ ه ی ص ل ا خ ا ن ی ز ا س ا د ج د ن ک ش ق ن ک ت ن ی ا ه ب ط و ب م ی س ک ی م و ئ ت و پ ت ا ق ی ق ح ت د ا ی م ه م. د و م ن د ه ا و خ ا ف ی ا ه ت خ ا ی ا ک ش و و د ا و م ی ا ه ت س ی س و و ا ه ی ل و ا جداسازی و ه ن و م ن ی و آ ع م ج م و ا پ م و ی د ی و پ س و ت پ ی ک ز و ی د ی و پ س و ت پ ی ک ه ب ک و ک ش م ی ل ا ه س ا گوسالههای از ش ی ا م ز آ ا ب ن ا ه ت ه ا گ ش ن ا د د ا ب آ ن ی م ا ی ت ا ق ی ق ح ت ه س س و م ل ا ت ک ه ن و م ن ت ا م و ک بی ا ت ع و ف د م م ی س ا ت پ ی و آ ع م ج 2/5 د ص د د ش ه ف ا ض ا و و م ه ه ب م ج ح ن آ ه ا گ ش ی ا م ز آ ا ه ه ن و م ن. د ی د گ ل ق ت ن م ی ک ش ز پ م ا د ه د ک ش ن ا د ی س ا ن ش ل گ ن ا ن ا م ز ش ي ا م ز آ د 4 ه ج د ي ت ن ا س د ا گ ي ا د ه گ ن ه ي ه ت ش ت س گ ع و ف د م ي ا ه ه ن و م ن ز ا ه ا گ ش ی ا م ز آ د. د ن شد. د ی د گ ی ز ی م آ گ ن ه د ش ح ال ص ا ن و س ل ن ل ی ذ ش و ا ب و ب ا ب 04 نمایی ت ش د ا ب ی ز ی م آ گ ن ز ا س پ ا ه ش ت س گ پ و ک س و ک ی م ی و ن 20 ز ا ش ی ب گی د و ل آ د ه ا ه ت س ی س و و ا ن ا د ی م. د ی د گ ع ا ب ش ا ز ا د ی د ع و ف د م ز ا DNA ج ا خ ت س ا ه د ه ا ش م و د ت و ص د و ج و م و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا پ ک س و ک ی م ا ب ه د ا ف ت س ا م ا د ق ا ز ا ه ب ل و ل ح م ص ی ل خ ت ز ا ک ا س م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا پلیماز) PCR ( ی ا ه ی ج ن ز ش ن ک ا و م ا ج ن ا و د و م ی ا ه ت س ی س و و ا ه ک ن ی ا ی ل و ک ل و م د ی ی ا ت و ظ ن م ه ب ی ی ا س ا ن ش د گ ن ی ز ی م آ ل ی ذ ن و س ل ن ح ال ص ا ه د ش ز ا DNA ج ا خ ت س ا د ن ش ا ب ی م م و ا پ م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا و ک ذ م ا ب ه د ا ف ت س ا ز ا ت ی ک DNA ( ل م ع ل ا و ت س د س ا س ا ب ) extraction kit, MBST, Iran ش ن ک ا و م ا ج ن ا ی ا ب ن آ ز ا س پ. ت ف ی ذ پ م ا ج ن ا ه د ن ز ا س ی ا ه ی ج ن ز ز ا م ی ل پ ز ا ی ا ه م ی ا پ F1=(5`aagctcgtagttggatttctg 3`) ی ص ا ص ت خ ا و ب ع ش ن م `5)=R1 taaggaacaacctccaatctc (`3

3 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ز ا م و ی د ی و پ س و ت پ ی ک س ن ج 18S ribosomal RNA ن ژ DNA ز ا ت ي ل و ك ي م ک ی و ظ ن م ن ی ا ه ب د. ی د گ ه د ا ف ت س ا ج ا خ ت س ا ت ی ل و ک ی م ه ه د ش ت ه ج ی ث ك ت ه د ا ف ت س ا. د ش ت ی ل و ک ی م 2 PCR buffer 10x ن ا ز ی م 0 1 dntp (10 ز ا ت ی ل و ک ی م 2 MgCl 2 50) mm) ت ی ل و ک ی م 3 mm) Reverse 20) µm) و Forward 20) µm) م ی ا پ 0/5 ا ب و د ت ی ل و ک ی م ه د ش ی ط ق ت م ی ز ن آ ل ی ت س ا Taq ه ب ز ا م ی ل پ ی ا ه ز ا د ن ا (5U/μl) ه ک م ج ح و ب آ ی ی ا ه ن ه ا گ ت س د د و ه د ش ه ف ا ض ا د ش ا ب ت ی ل و ک ی م ش ن ک ا و ل ک ی س و م ت (MWG Germany) ا ب ه م ا ن ب 5 9 ه ج د و د ه ی ل و ا ت ش س ا و و ظ ن م ه ب ه ق ی ق د 5 ت د م ه ب گاد سانتی د ا گ تی ن ا س ه ج د 5 9 ه م ا ن ب ا ب ه خ چ 5 3 DNA ه ت ش ه ی ن ا ث 5 4 ت د م ه ب د ا گ تی ن ا س ه ج د 8 5 ه ی ن ا ث 5 4 ت د م ه ب ل ی م ک ت ت ه ج و ه ی ن ا ث 5 4 ت د م ه ب د ا گ تی ن ا س ه ج د 2 7 ی ی ا ه ن ی ث ک ت ت خ ا س ک م ه ق ی ق د ه د ت د م ه ب د ا گ ی ت ن ا س ه ج د 2 7 DNA م ا ج ن ا. ت ف ی ذ پ ت ه ج ن ی ی ع ت و ز ا گ آ ل ژ ز ا PCR ل و ص ح م ا د ت ب ا م و و ا پ گونه تشخيص UV ه ع ش ا ت ح ت د ی ا م و ب م و ی د ی ت ا ا ب ی ز ی م آ گ ن ز ا س پ ج ا خ ت س ا ص ی ل خ ت م وو ا پ فی د ا ت ت س ا ن ی ا و ه د ش ص ی ل خ ت ا ب. د ی د گ ه د ا ف ت س ا ز ا د ه م ا د ا م ی ا پ ل و ص ح م صی ا ص ت خ ا PCR ) F2=5`catattactatttttttttttag 3`( و ص ح م د و م م ی ا پ ه د ش ی ب ا ی ز ا ط ق ف د ز ا ا ق و د م ی ا پ. ت ف گ لی ب ق ف د ا ت د و ج و م م و و ا پ ه ن و گ ه ک ل ی ک ش ت ه ن و گ ز ا ه د ش ی د ی ت و ئ ل ک و ن ه د و ب و د ی د ی ت و ئ ل ک و ن ف د ا ت ز ا ن ژ ز ا ت م س ق ن ی ا گ ی د ای ه ه ن و گ ی گ ی د ل ی ک ش ت ه د ش. ت س ا ی ث ک ت ک م DNA ت ح ت ه ج د 0 5 ه ب ا ه گ ز ا غ آ ل ا ص ت ا ي ا م د ( ه د ش ک ذ ط ی ا ش م ا ج ن ا R1 و F2 ای ه م ی ا پ ا ب ) ت ف ا ي ش ه ا ك د ا گ ي ت ن ا س د ص د 1/5 ز ا گ آ ل ژ وی ب PCR ل و ص ح م. ت ف گ د ی ا م و ب م و ی د ی ت ا ا ب ي ز ي م آ گ ن ز ا س پ ه د ش ز و ف و ت ک ل ا. ت ف گ ا ق ی ب ا ی ز ا د و م UV ه ع ش ا ت ح ت زی ا س ه د و ل آ م و ا پ و بی ج ت ه ل ا س و گ د ی ی ا ت و ص ی خ ش ت ز ا س پ م و ی د ی و پ س و ت پ ی ک ه ب م و ی د ی و پ س و ت پ ی ک ی ل و ک ل و م ز ا ت س ی س و و ا د ا ی ز د ا د ع ت ه ب ی ب ا ی ت س د و ظ ن م ه ب م و و ا پ د ل و ت م ه ز ا ت ن ی ا ت ش ل و ه گوساله اس ک ی د ح ا و ع ب ن م ک ی ه س س و م ز ا ضدکیپتوسپویدیوم پادتن د ق ا ف د ا م ز ا ه د ش و د ا م و ا گ ع و ف د م ز ا. د ش ب ا خ ت ن ا د ا ب آ ن ی م ا ی ت ا ق ی ق ح ت گدید تهیه گستش سازی آلوده ز ا ل ب ق گوساله مدفوع د و م و ی ز ی م آ گ ن ه د ش ح ال ص ا ن س ل ن ل ی ذ ش و ه ب و ه ک و ط ن ا م ه ( د و خ ه ک ی ا ه ل ا س و گ. ت ف گ ا ق ی ب ا ی ز ا د ت س ی س و و ا د و ج و ظ ا ح ل ز ا ش د ا م و ) ت ف ی م ا ظ ت ن ا ی ا ع ی ط ی ح م ه ب ی ب ج ت ی گ د و ل آ ی ا ب د و ب ی ف ن م ع و ف د م ز و غ آ ز ا ظ ن د و م گوساله. شد ه د ا د ل ا ق ت ن ا ت س ی س و و ا ز ا م ت س ی س ف ی ع ض ت جهت تولد ز ا س پ ت ع ا س 4 2 و م و ح م ل ه چ. د ی د گ ق ی ز ت ن آ ه ب ن و ز ا ت م ا ز گ د 0 1 mg/kg ی ن م ی ا ت ش ه ت ع ا س س پ ز ا د ل و ت ه ب ه ل ا س و گ ه د ی ن ا و خ م و و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا ا د د ج م ن و ز ا ت م ا ز گ د ای ه گی د و ل آ ه ل ا س و گ ه ب ن ا ز ی م ت ع ا س ق ی ز ت س پ ی ی ا ی ت ک ا ب ز ا. د ی د گ mg/kg د ل و ت ز ی ن ت ه ج ت ع ا س ه ب س پ ن ا م ه ی ی گ ش ی پ ز ا ن ي س ا س ك و ل ف و ن ا د ش د ل و ت و ن ا ز ی م ز ا ه ب ق ی ز ت ع و ف د م ل ا ه س ا م ئ ال ع ن ی ل و ا ز و ب ا ب د ع ب ز و ج ن پ. د ی د گ د ص د 2/5 م ی س ا ت پ ت ا م و ک ی ب ت و ا ج م د و ی و آ ع م ج ه ا گ ش ی ا م ز آ ل ق ت ن م. د ی د گ س پ ز ا ه ی ه ت ش ت س گ و ک ذ ی ا ه ش ش و ه د ش ح ال ص ا ن و س ل ن ل ی ذ ی ز ی م آ گ ن ه د ش ی ل و ک ل و م د ال ا ب و ض ح ت س ی س و و ا ز و ز ا. د ش د ی ی ا ت ع و ف د م د م و و ا پ م و ی د ی و پ س و ت پ ی ک ي و آ ع م ج ه ب م ا د ق ا گی د و ل آ ز ا س پ ز و 1 1 ا ت م ج ن پ د د ص د 2/5 ت ا م و ک ی ب ت و ا ج م د و گدید مدفوع ی ا م د 4 C ی ا د ه گ ن. د ش ا ه ت س ی س و و ا ا ب ز ا ه د ا ف ت س ا

4 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 8 7 ی ا ه ش و ف ل ت خ م ز ا ع و ف د م ج ا خ ت س ا و ص ی ل خ ت ع و ف د م د و ب ال ا ب ع و ف د م ی ب چ ه ک ی د ا و م د. د ی د گ ی و آ ع م ج ه د ش د ت و ا ج م. د ن د ش ه د ا د ا ق ت ا و د ص د ی ا ه ش و ف ل ت خ م ص ل ا خ ت ا م و ک ی ب ی ز ا س ع و ف د م ز ا م و و ا پ م و ی د ی و پ س و ت پ ی ک ه ن و م ن ه د ش ی و آ ع ع ع م ج ع ع ع و ف د م ز و دی ی و پ س و ت پ ی ک تجبیبه بهوش م ی س ا ت پ 2/5 م ج ح ب ا ب 3 ه ا م ش ز ا ل ص ا ح ت د م آب ط و ل خ م و ا ب خ آ ك ل ا ه د ا د و ب ع ت س ی س و و ا ه ک ی ا ه ه ه ه ه ل ا س و گ ز ا ا ب د ش ه د و ل آ از ب ي ت ت ه ب ل و ل ح م. د ش ي ا اا كه ك ك ك ك ك ك ل ا ه ب ه ق ي ق د د و د ص ی ل خ ت ز ا ل ب ق د ش ژ و يف ت ن ا س ه ق ي ق د 0 1 د ه ن و م ن ز ا ی ی ا ی ت ک ا ب ت ش ک ط ی ح م. د ی د گ ش ا م ش ل ص ا ح ی ا ا یه ی ی ی ن و ل ک و ت ف ی ذ پ به ت ي ا ه ن م ا ج ن ا LB د ای اا ا ا ته تت ت ت س ی سس س س س س س س س س س سس س س س س س و و ا ج ا خ ت س ا و ظ ن م د و م زی ای ا ا شه و م و و ا پ م م م م و ی د ی و پ س و ت پ ی ک ت: ف گ ا ق ه د ا ف ت س ا 1 سازی- خالص ع: ا ب ش ا ک م ن ب آ ز ا ه د ا ف ت س ا ا ب م و و ا پ کیپتوسپویدیوم ت س ی س و و ا ز ا م ج ح ک ی ) ( ن ا ا ک م ه و و ی ل ش و ق ب ا ط م 1 ا ب ت س ی س و و ا حاوی مدفوع ه ن و م ن م 0 ج ح ع ا ب ش ا ل و ل ح م ه ب ب آ م ج ح ک ی و ط و ل خ م ) م ا ع ط ک م ن ( م ی د س د ی ل ک ی م ا آ ی و ن آ ا ق ه د ا د. د ش ه ب ت د م g ط ق م و.0 گدید سانتیفوژ ی ال ا ب ل و ل ح م ه ق ی ق د و ب آ ی ز ه ی ال ( ی ن ا ی م ت م س ق ب آ ک م ن ) ع ا ب ش ا ی و ا ح و ph= 7/2 ا ب PBS ا ب ه ک د و ب ه د ش ا د ج ی ا ه ت س ی س و و ا ت ح ت g ه ب ت د م ه د ه ق ی ق د ژ و ف ی ت ن ا س د ی د گ ت م و ت ی س و م ه ج د م م ال ی و ب ا ه ت س ی س و و ا د ا د ع ت. ) 2 2 ( و ش ا م ش ی و ن پ و ک س و ک ی م ب ا ب 0 4 ی ی ا م ن ت ش د ا ب حجم شده شماش اووسیستهای ن ا ز ی م ( ل و م ف ق ب ط ز ا ت ی ا ه ن د گدید. محاسبه ) ا ز ه ه د ظ ن د و م ه ن و م ن ل ی ذ ش و ه ب و ه ی ه ت ش ت س گ ه د ش ا د ج ی ا ه ت س ی س و و ا ز ا س پ. د ی د گ ی ز ی م آ گ ن م گ و ه د ش ح ال ص ا ن و س ل ن ص ی ل خ ت ت ش ک ی ی ا ی ت ک ا ب ه ن و م ن د ط ی ح م د. ی د گ ش ا م ش ل ص ا ح ای ه نی و ل ک و ت ف ی ذ پ LB 2 سازی- خالص ع: ا ب ش ا ز ا ک ا س ز ا ه د ا ف ت س ا ز ا م ا ج ن ا ا ب م و و ا پ کیپتوسپویدیوم ت س ی س و و ا ت ی ل ی ل ی م 5 ) ( ن ا ا ک م ه و ت ن ک ش و ق ب ا ط م ب و س ز ا ک ا س ع ا ب ش ا ی و ا ح ه ب ت س ی س و و ا ی ب و خ ا ب ط و ل خ م 0 3 و ی ل ی م ت ح ت ت ی ل ل و ل ح م g ه ب ا ب ا ه چ ل م ع ن ی ا. د ی د گ ژ و ف ی ت ن ا س ه ق ی ق د 0 2 ت د م ی و ا ط ق م ب آ ت ی ل ی ل ی م ک ی ا ب ه و گدید تکا ا ب ل و ل ح م ح ط س ز ا ا ه ت س ی س و و ا و ه ت خ ی ز ا ک ا س ل و ل ح م ت پ ی پ ه ت خ ی و ت س ا پ د ش و ه ب ی و آ ع م ج ت د م ه د ز ن ا پ ن و د ه ق ی ق د PBS (ph=7.2) و ت ح ت g ش و د ه چ ن آ د ن ن ا م ت ی ا ه ن د. ) )2 د ی د گ ژ و ف ی ت ن ا س گدید. شماش اووسیستها شد بیان ع ا ب ش ا ک م ن ب آ ل ی ذ ش و ه ب و ه ی ه ت ش ت س گ ه د ش ا د ج ی ا ه ت س ی س و و ا ز ا ز ا س پ. د ی د گ ی ز ی م آ گ ن م گ و ه د ش ح ال ص ا ن و س ل ن ص ی ل خ ت ت ش ک ی ی ا ی ت ک ا ب ه ن و م ن د ط ی ح م د. ی د گ ش ا م ش ل ص ا ح ای ه نی و ل ک و ت ف ی ذ پ LB 3 سازی- خالص م ا ج ن ا ا ب م و و ا پ کیپتوسپویدیوم ت س ی س و و ا کل: ی ا ف ی ن ا ک ل پ ی ت ظ ل غ ب ی ش ز ا ه د ا ف ت س ا ق ب ا ط م ش و ب م ال و ) ( ن ا ا ک م ه ی ا ه م ج ح ز ا ب ی ت ت ه ب د ص د و /5 ل و ک ی ا ف ز ا ب ا ب ت ظ ل غ 0/5 د ص د ا ت د ص د ی و ک ی م ج ح ع ی ا م ب ی ت ت ن ی د ب و د ش ه د ا د ا ق ی م ا آ ه ب ت س ی س و و ا ی و ا ح س پ س. د ی د گ د ا ج ی ا ی ن ا ک ل پ ی ت ظ ل غ ب ی ش ا ب ن و ت س ک ی ژ و ف ی ت ن ا س ق ا ت ا ی ا م د د ه ق ی ق د 0 ت د م ه ب g ت ح ت. د ی د گ ا ه ت س ی س و و ا د ه ی ال ل و ک ی ا ف 0/5 د ص د د ن ا ب و ی و آ ع م ج ا ه ه ی ال ه ن ا گ ا د ج و ط ه ب ه ک د ن د ا د ل ی ک ش ت

5 ی 0 ل ی م ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ی س ب. د ی د گ و ه ه ی ال ه ن ا گ ا د ج ا ب PBS ل ی ت س ا ا ب ه س و ژ و ف ی ت ن ا س g ت ح ت ph= 7/2 ی ا ا د ش و د ه چ ن آ د ن ن ا م ت ی ا ه ن د. ) 0 1 ( د ش ه د ا د و ش ت س ش د. ی د گ ش ا م ش ا ه ت س ی س و و ا د ش ن ا ی ب ع ا ب ش ا ک م ن ب آ ل ی ذ ش و ه ب و ه ی ه ت ش ت س گ ه د ش ا د ج ی ا ه ت س ی س و و ا ز ا ز ا س پ. د ی د گ ی ز ی م آ گ ن م گ و ه د ش ح ال ص ا ن و س ل ن ص ی ل خ ت ت ش ک ی ی ا ی ت ک ا ب ه ن و م ن د ط ی ح م د. ی د گ ش ا م ش ل ص ا ح ای ه نی و ل ک و ت ف ی ذ پ LB 4 سازی- خالص م ا ج ن ا ا ب م و و ا پ کیپتوسپویدیوم ت س ی س و و ا ه: د ش ح ال ص ا د ص د 5 5 ز ا ک ا س ل و ل ح م ز ا ه د ا ف ت س ا ا ب ) ( ن ا ا ک م ه و ت ن ی و ش و ز ا و ظ ن م ن ی ا ی ا ب ا ب ا ب ه س ا ت و د ع و ف د م ه ن و م ن. د ش ه د ا ف ت س ا ت ا ی ی غ ت ی م ک ه ق ی ق د ه د ت د م ه ب g 0 ت ح ت PBS (ph=7.2) 0 5 ن و ک ل ا ف د چبی زدودن ی ا ب سپس. شد سانتیفوژ 1 ی ت ی ل ی ل ی م ه و ال ع ب ت ا م ج ح ک ی ا ب ه ن و م ن ز ا ت ی ل. د ش ط و ل خ م ب و خ د ص د 1 م ی د س ت ا ن ب ک ی ب م ج ح ه س ه ی ال. د ی د گ ژ و ف ی ت ن ا س g 0 ت ح ت ه ق ی ق د 0 1 ت د م ه ب و د ش ه ت خ ی و د ف ظ ی ال ا ب ت م س ق د د و ج و م ی ب چ ه ی ال ب و س ه گ ن ه ت ش ا د. د ش د ت و ص ب چ ن د و ب ت ا ن د و د ز ی ا ب. د ش ی م ا ک ت ه ا ب و د ه ل ح م ن ی ا ع و ف د م ت ه ج Tris-EDTA ف ا ب ز ا ه د ن ا م ی ق ا ب ی ب چ ن د و د ز و ه ق ی ق د ه د ت د م ه ب g 0 ت ح ت و ه د ا ف ت س ا و ش ت س ش و ژ و ف ی ت ن ا س ی ل ی م. ) 9 1 ( د ش ا ک ت ه ل ح م ن ی م ه ه ا ب و د 0 4 ا ب ه ل ص ا ح ت س ی س و و ا ی و ا ح ع ی ا م ز ا ت ی ل ی ل ی م 5 ت ی ل ز ا ک ا س 5 5 د ص د ک ن خ ب و خ ط و ل خ م ی م ا آ ه ب خنک بسیا ط ق م ب آ ت ی ل ی ل ی م 0 1 و د ی د گ ظف. شد تشکیل جدا قسمت و د و شد یخته ن آ ی و ه ق ی ق د 0 2 ت د م ه ب g 0 ت ح ت ژ و ف ی ت ن ا س د ی م ا آ ه ب ا ق ط ق م ه د ا د د. د ش ت م س ق ه س ت م س ق ال ا ب ه ی ال ال م ا ک ی ن ا ی م ا د ج ل م ا ش ل م ا ش ه ی ال ب آ ی ا ه ت س ی س و و ا ه. د ش ل ی ک ش ت ه ل و ل ه ت د ب و س ه ی ال و ه د ش و ا ن ش PBS (ph=7.2) ا ب ه ن ا گ ا د ج و ط ه ب ا ه ت م س ق ز ا م ا د ک. ) 3 2 ( د ش ژ و ف ی ت ن ا س ه ق ی ق د ه د ت د م ه ب g 0 ت ح ت ی ا ه ت س ی س و و ا ه ت م س ق ه ب ت و ص ه ن ا گ ا د ج ک م ن ب آ ش و د ه چ ن آ د ن ن ا م ت ی ا ه ن د و ی و آ ع م ج ع ا ب ش ا ن ا ی ب د ش ا ه ت س ی س و و ا ش ا م ش د. ن د ی د گ ز ا ل ی ذ ش و ه ب و ه ی ه ت ش ت س گ ه د ش ا د ج ی ا ه ت س ی س و و ا ز ا س پ. د ی د گ ی ز ی م آ گ ن م گ و ه د ش ح ال ص ا ن و س ل ن ص ی ل خ ت ت ش ک ی ی ا ی ت ک ا ب ه ن و م ن د ط ی ح م د. ی د گ ش ا م ش ل ص ا ح ای ه نی و ل ک و ت ف ی ذ پ LB 5- ه د ا ف ت س ا ای ه ی ت ک ا ب م: و و ا پ ز ا ه ا م ه ای ه ش و ا ب ی ل ی م ک ت ت ه ج م ا ج ن ا ش ه ا ک م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا ی ا ه ت س ی س و و ا ا ب ه ا م ه ی ا ه ی ت ک ا ب ش ه ا ک و ظ ن م ه ب ف ا ب ز ا ه د ا ف ت س ا ش و ه س ز ا م و و ا پ م و ی د ی و پ س و ت پ ی ک ه د ن ن ک ز ی ل ن و ی س ا ت ل ی ف ی ت ک ا ب ه د ا ف ت س ا ه د ا ف ت س ا. د ش د ز ا ک ی ت و ی ب ی ت ن آ ش و ه د ا ف ت س ا ث و م ز ا و ف ا ب ت س ی س و و ا ی و ا ح ب و س ی ز ا س و ا ن ش ز ا ل ب ق ه د ن ن ک ز ی ل ق ی ق م ی د س ت ی ل ک و پ ی ه ا ب م و و ا پ م و ی د ی و پ س و ت پ ی ک ا ب ه س ه ق ی ق د 0 1 ز ا د ع ب و و ا ج م 0 1 ه ب 1 ت ب س ن ه ب ه د ش ا ب ب و س ن گ م ه ط و ل خ م س پ س. د ی د گ م ا ج ن ا و ش ت س ش MBST ت ی ل و ک ی م و 5 2 ف ا ب ه د ن ن ک ز ی ل ت ی ل و ک ی م ی ت ک ا ب TritonX و ت خ ا س 0 2 ت ک ش ت ی ل و ک ی م 7 3 ی ا م ن ب د ه ق ی ق د 0 3 ت د م ه ب ) 10mg/ml( م و ز و ز ی ل ت ی ل ی ل ی م 4 ه م ا د ا د. د ش ه د ا د ا ق د ا گ ی ت ن ا س ه ج د ن گ م ه ط و ل خ م ز ا ت ی ل ی ل ی م 2 ی و ی م ا آ ه ب ل و ک ی ا ف ا ق ه د ا د د ش و ه ب ت د م 0 3 ه ق ی ق د ت ح ت g ه. د و ب ه ی ال ه س شامل حاصل محلول. گدید سانتیفوژ م ا د ک و ش ت س ش ز ا ا ه ه ی ال ه د ا د ه ب. د ش و ط ه ن ا گ ا د ج ای ه ت س ی س و و ا ا ب PBS (ph=7.2) ی و آ ع م ج ه د ش ب. د ی د گ ه ب س ا ح م و ش ا م ش ت م و ت ی س و م ه ج د م م ال وی ی ز ی م آ گ ن جهت یکی ش ت س گ و د ا ه ت س ی س و و ا ن ی ا ز ا

6 ) ی و ص ت 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 0 8 م گ ی ز ی م آ گ ن ی گ ی د و ه د ش ح ال ص ا ن و س ل ن ل ی ذ ه ب. د و ب ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا گ ی د ش و. گدید تهیه ی ت ن آ و ت ش ک ت س ی س و و ا ی و ا ح ل و ل ح م ز ا و ظ ن م ن ی ا ) Disk diffusion( ن ژ و ف ی د ک س ی د ش و ه ب م ا گ و ی ب ی ت ن آ. ت ف گ م ا ج ن ا ی س ا ن ش ب و ک ی م ه ا گ ش ی ا م ز آ ط س و ت ن و س ک ا ی ت ف س ل م ا ش ه د ا ف ت س ا د و م ی ا ه ک ی ت و ی ب و )Ciprofloxacin( ن ی س ا س ک و ل ف و پ ی س ) Ceftriaxone( ن ا و ن ع ه ب ن و س ک ا ی ت ف س. د و ب ) Ceftazidime( م ی د ی ز ا ت ف س ط ق م ب آ ت ی ل ی ل ی م 9. شد انتخاب حساس بیوتیک ی ت ن آ ک ی ت و ی ب ی ت ن آ د و پ ی م گ ک ی ل ا ی و ا ب ا ل ی ت س ا ن ا ی ح ن ب ب ا ج ی ز ا س و ا د ت ک ش ت خ ا س س ک ا ت ف س ی و ا ح ل و ل ح م ز ا ت ی ل و ک ی م د و د ح و ط و ل خ م ه ب ک ح ت م صفحه وی و ه د ک ه ف ا ض ا ن آ ه ب ت س ی س و و ا. د ش ه د ا د ا ق ه ا گ ش ی ا م ز آ ی ا م د د ب ش ک ی ت د م ز ا ه ل ح م ن ی ا ز ا د ع ب و ل ب ق و د ش م ا ج ن ا و ش ت س ش س پ س ی ز ی م آ گ ن و ه ی ه ت ش ت س گ ت س ی س و و ا ی و ا ح ل و ل ح م م و س ش و. ت ف گ ت و ص ی ی ا ی ت ک ا ب ت ش ک و م گ. د و ب ن و ی س ا ت ل ی ف ز ا ه د ا ف ت س ا ه ن و م ن ز ا ی ت ک ا ب ن د و د ز ت ه ج و ت ن ی و ش و ز ا ه د ا ف ت س ا ا ب ه ی ل و ا ی ز ا س ص ل ا خ ز ا س پ. د ش ه د ا ف ت س ا ز ل و ل س و ت ی ن ت ل ی ف ز ا 0( ( ن ا ا ک م ه ق ی ق PBS (ph=7.2) ت ی ل ی ل ی م 0 1 د ا ه ت س ی س و و ا ه د ش س ک ی ف ن آ ه د ن ا د ه گ ن د ه ک ت ل ی ف ز ا و ه د ی د گ ز ا PBS (ph=7.2) ت ی ل ی ل ی م 0 5. د ش ه د ا د و ب ع د و ب ن ا ش ه ز ا د ن ا ه ط س ا و ه ب ا ه ت س ی س و و ا د ش ه د ا د و ب ع ت ل ی ف. د ن د ک و ب ع ا ه ی ت ک ا ب و د ن د ن ا م ت ل ی ف ی و و PBS (ph=7.2) ک م ک ه ب ت ل ی ف ی و ی ا ه ت س ی س و و ا و ب ع ع ی ا م. د ش ی و آ ع م ج ت ق د ا ب و ی م ا آ ه ب ل پ م س ی ل ی م 0 1 ا ب م ه ت ل ی ف. گدید جمعآوی نیز ت ل ی ف ز ا ه د ک ی و ل ی ت س ا ف ظ ک ی د PBS (ph=7.2) ت ی ل ز ا ا ه ت س ی س و و ا ه د ن ا م ی ق ا ب ا ت د ش ه د ا د ا ق ن ا ز ل ه ح ف ص ه ک ن ی ا ز ا ن ا ن ی م ط ا ی ا ب س پ س. د ن و ش ا د ج ت ل ی ف ا ه ت س ی س و و ا د ی ا ه ذ ف ن م ت ل ی ف ی ق ا ب د ن ن ا م ن ا ب و ه د ا د ا ق ه د ن ا د ه گ ن د ل ب ق حالت بعکس ت ل ی ف ا PBS (ph=7.2) ی و ش ت س ش س و ک ع م م ا ج ن ا. د ی د گ د ا د ع ت م ال وی ب ه ل ح م ه ز ا ه د ش عآوی م ج ای ه ت س ی س و و ا ج د م ت م و ت ی س و م ه ش ا م ش و ه ب س ا ح م. د ی د گ ز ا ن ی ا ل ی ذ ی ز ی م آ گ ن ت ه ج ی ک ی ش ت س گ و د ا ه ت س ی س و و ا ه ی ه ت م گ ی ز ی م آ گ ن ی گ ی د و ه د ش ح ال ص ا ن و س ل ن د. ی د گ ج ی ا ت ن ه ب ک و ک ش م ی ل ا ه س ا ی ا ه ه ل ا س و گ ع و ف د م ی ا ه ه ن و م ن ز ا ز و ی د ی و پ س و ت پ ی ک ه ا گ ش ی ا م ز آ د ل گ ن ا ی س ا ن ش ش ت س گ ی ز ی م آ گ ن ه د ش ح ال ص ا ن و س ل ن ل ی ذ ش و ه ب و ه ی ه ت 4 د ا ع ب ا ه ب ی و ک م ا س ج ا صوت به ا ه ت س ی س و و ا. د ی د گ گدید مشاهده سبز زمینه د ز م ق گ ن ه ب ن و ک ی م ا ت ی ت ب ث م ی ی ا م ن ه ک ی ا ه ه ن و م ن ز ا ا ه ت س ی س و و ا ج ا خ ت س ا. 1( ه ا م ش د ص د ه ب ا ب ن ا د ی م ی ا ا د د ی د 4-5 پ و ک س و ک ی م د د ع ا ب ت س ی س و و ا گ ز ب د ن د و ب م ی ا پ و د ا ب DNA ی ا ه ی ج ن ز ش ن ك ا و د. د ی د گ م ا ج ن ا د ن د و ب ه د ش ی ح ا ط 18S rrna ن ژ ز ا ه ک R1 و F1 ز ا ه ک د م آ ت س د ه ب ز ا ب ت ف ج ه ز ا د ن ا ه ب لی و ص ح م ظ ا ح ل ا ه م ی ا پ و د ه ز ا د ن ا و ا ب ه ع ط ق د ا د ع ت ن ی ب ی ا ه د ی ت و ئ ل ک و ن ا ه ن آ ی ب ا ب ه ل ک ش ت م. ت ش ا د ز ا ای ب لی ا و ت ن ی ی ع ت ا ب DNA ک م ی ث ک ت ش و ز ا م و ی د ی و پ س و ت پ ی ک ه ن و گ م ی ا پ F2 و R1 ه د ا ف ت س ا د ي د گ ه ك ه ج ي ت ن ن ی ا ی و ص ت ( د و ب ز ا ب ت ف ج ه ز ا د ن ا ه ب لی و ص ح م واکنش 2(. ه ا م ش ق ی ط ن ی ا ه ب م و و ا پ م و ی د ی و پ س و ت پ ی ک تهای س ی س و و ا ه د ا د ص ی خ ش ت و ک ذ م ت ا ش ی ا م ز آ م ا ج ن ا ا ب ن ا ی ا ه ی ا د ج م ج ن پ ز و ز ا ی ب ج ت ش و ه ب ه د ش ه د و ل آ ه ل ا س و گ. د ش س پ ز ا ه د و ل آ ی ز ا س ع و ش ه ب ع ف د ت س ی س و و ا

7 .) ) 1 ه ا م ش ی و ص ت ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ز و ت ف ه ل و ط د و د و م ن م و و ا پ م و ی د ی و پ س و ت پ ی ک ه ل ا س و گ ع و ف د م ز ا ت س ی س و و ا ن و ی ل ی م د و د ح ی ل ا و ت م ی و آ ع م ج. د ی د گ ای ه ت س ی س و و ا ص ی ل خ ت ه د ش ز ا ی ب ا ی ز ا د و م ي ك ي ت ن ژ ل ت ن ك ت ه ج ه د ش ه د و ل آ ه ل ا س و گ و ط ن ا م ه و گفت قا PCR ش و ا ب ي ل و ك ل و م د د ج م ه ك د ش ه د ا د ن ا ش ن و د ي ي ا ت ي ل ب ق ج ي ا ت ن ت ف ي م ا ظ ت ن ا ه ك ي ا ه ت س ي س و و ا. د ن د و ب م و و ا پ د ق ی ق ح ت ع ف د ض ا ح ه د ش ط و ب م ای ه ش و م و ی د ی و پ س و ت پ ی ک ه ب ف ل ت خ م ل م ا ش م و و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا ص ل ا خ زی ا س ای ه ش و تی ظ ل غ شیب اشباع ز ا ک ا س ع ا ب ش ا ک م ن ب آ ز ا ه د ا ف ت س ا نی ا ک ل پ ح ال ص ا ل ک ی ا ف ه د ش و ه د ا ف ت س ا و ا ن ش زی ا س. د ی د گ ا ب ا ب ز ا ک ا س ه ج و ت ه ب 5 5 ال ا ب د ص د ن د و ب ی س ب د و م ع و ف د م ی ا ه ه ن و م ن د ی ی ا ی ت ک ا ب ی گ د و ل آ ش ال ت د ی د گ ت ه ج ش ه ا ک ای ه ی ت ک ا ب ه ا م ه ز ی ل ف ا ب ز ا ه د ا ف ت س ا د ن ن ا م ی ل ی م ک ت ش و ز ا ا ه ت س ی س و و ا ه د ن ن ک ه د ا ف ت س ا ی ت ک ا ب ز ا ت ل ی ف ه د ا ف ت س ا ز ا ی ز ل و ل س و ت ی ن ی ت ن آ ا ب ک ی ت و ی ب ب س ا ن م و ن و ک ی م 3 ذ ف ا ن م ز ی ا س. د شو ه د ا ف ت س ا ا ه ت س ی س و و ا ص ی ل خ ت و جداسازی ت ه ج ا ه ت س ی س و و ا ز ا ی د ا د ع ت ع ا ب ش ا ک م ن ب آ ش و د و ا ن ش ن ا ز ی م د ن د ش ن ی د ا ی ز و ه ا م ه ل و ل س ی ا ه ت س ی س و و ا و ی ت ک ا ب و ا ن ش د و ج و ه د ش ز ی ن. ت ش ا د گ ن ش و و د ه د ن آ ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا ی ز ی م آ ی ا ا د ن ا ز ی م ی گ د و ل آ ال ا ب ه ب ا ه ی ت ک ا ب و د ا و م و ه د ش و ا ن ش ی ا ه ت س ی س و و ا د ا د ع ت ن ی گ ن ا ی م. د ن د و ب د ئ ا ز ش ا م ش ی ل ا و ت م ه د ش 0 1 ب ی و 7/8 0 5 م ال د ت م و ت ی س و م ه ک ی ی ل ی م د ت ی ل ه س. د و ب ا ک ت د ا د ع ت د ن د ش ن شناو و ه د ن ا م ی ق ا ب ب و س د که اووسیستهایی 0 1 د ی ل ی م ت ی ل. د و ب د ا د ع ت ی ا ه ی ن و ل ک ی ت ک ا ب ت ق د و د د ع : 1 ت ق د شده شماش د و ا ن ش ت س ی س و و ا ه ا م ه ش و د ن د ش ن ز ا ک ا س و ه د ه ا ش م ه ا م ه. د ش ی ا ه ت س ی س و و ا ع ا ب ش ا ب و س ن ی ن چ م ه و ا ن ش ی د ا د ع ت ن ا ز ی م ن ا ز ی م ه د ش ز ا ا ه ت س ی س و و ا ل ب ا ق ی د ا ی ز ه د ه ا ش م ی ه ج و ت ی ت ک ا ب. د ش گ ن ش و و د ه د ن آ ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا ی ز ی م آ ی ا ا د ن ا ز ی م ی گ د و ل آ ال ا ب ه ب ا ه ی ت ک ا ب و د ا و م و ه د ش و ا ن ش ی ا ه ت س ی س و و ا د ا د ع ت ن ی گ ن ا ی م. د ن د و ب د ئ ا ز ش ا م ش ی ل ا و ت م ظ ن ه د ش ب ی و م ال ت م و ت ی س و م ه. د و ب ت ی ل ی ل ی م ک ی د 0 1 د ه س ا ک ت د و م ه ی ال د ل ک ی ا ف ی ن ا ک ل پ ی ت ظ ل غ ب ی ش ش و د ه ی ال ( ت ق 0/5 د ص د ) ل ک ی ا ف ه ب ه ا م ه د و ج و ی د ا ی ز ی ل و ل س ی ا ه ه د و ت و ی ت ک ا ب ا ه ت س ی س و و ا ا ی س ب ی ت ک ا ب ب ه و ال ع م ه ب و س ت م س ق د. ت ش ا د ن ا ز ی م د ه ل ب ا ق و د ی ه ج و ت ت س ی س و و ا د و ج و. ت ش ا د د ن ی ا و ی ل و ل س ی ا ه ه د و ت ز ا ا ه ت س ی س و و ا ه ی ال ک ی ک ف ت ش و ن ی ا ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا. د و ب ا و ش د ا ه ی ت ک ا ب ی ت م ک ز ا ک ا س و د ه ب و ه ب ش و ا ه ی ت ک ا ب ع ا ب ش ا و گ ن و ب آ ی ز ی م آ د ا و م ک م ن د ئ ا ز ی ا ا د د ع ا ب ش ا ن ا ز ی م ه س ی ا ق م. د ن د و ب ی گ د و ل آ ا ب ش و د ا د ع ت د ت م و ت ی س و م ه م ال ی و ب ه د ش ش ا م ش ی ا ه ت س ی س و و ا ا ک ت ی ل ا و ت م د ک ی ی ل ی م ت ی ل د و ب د ن د ش و ا ن ش خوبی به ا ه ت س ی س و و ا ز ا ک ا س ش و د ی و ط ه ک د ب و س ن آ ت س ی س و و ا ل ب ا ق ی ه ج و ت ی ا ه ت س ی س و و ا ا ب ه ا م ه ی ت ک ا ب ن ا ز ی م. د ی د گ ن ه د ه ا ش م د و ب ا ه ش و ی ا س ز ا ت م ک ش و ن ی ا ز ا شده جمعآوی ی ا ه ده و ت ی ل و ل س و ی ل و ل س ا ه ت س ی س و و ا ه د ه ا ش م ه. د ی د گ ن م ا د ک د ا ه ی ت ک ا ب ی ا ه ه ی ال ه د و ت ی ی ا ز ج م ه د ن آ ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا. د ن د ش و ا ن ش ه ب ی گ د و ل آ ن ا ز ی م ن ی ت م ک ی ا ا د ی ز ی م آ گ ن ش و و د. د ن د و ب ل ب ق ش و ه س ا ب ه س ی ا ق م د د ئ ا ز د ا و م و ا ه ی ت ک ا ب. د و ب د د ع : 1

8 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 2 8 ش ا م ش و ه د ش و ا ن ش ی ا ه ت س ی س و و ا د ا د ع ت ن ی گ ن ا ی م 0 1 ی ل ا و ت م ا ک ت ش ش د ت م و ت ی س و م ه م ال ی و ب ه د ش ی ت ک ا ب ی ا ه ی ن و ل ک د ا د ع ت. د و ب ت ی ل ی ل ی م ک ی د 0 4 ی و ص ت ( د و ب د د ع ک ی : 1 ت ق د ه د ش ش ا م ش. ) 1 ه ا م ش ی ا ه ت س ی س و و ا ا ب ه ا م ه ی ا ه ی ت ک ا ب ش ه ا ک و ظ ن م ه ب ز ی ل ف ا ب ز ا ه د ا ف ت س ا د ن ن ا م ی ب ن ا ج ی ا ه ش و ز ا ه د ش ص ی ل خ ت ه د ا ف ت س ا ن و ی س ا ت ل ی ف و ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا ه د ن ن ک ن ت ف ن ی ب ز ا ث ع ا ب د ن چ ه ه د ن ن ک ز ی ل ف ا ب ز ا ه د ا ف ت س ا. د ش ن ا ک م ا ص ی ل خ ت ل ح ا م ی ط د ا م ا د ش ا ه ی ت ک ا ب ش و د. د ش ن س ی م ا ه ت س ی س و و ا ز ا ا ه ن آ الشه جداسازی ای ه ش ت س گ د س ک ا ت ف س ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا ز ا د ع ب و ل ب ق شده آمیزی گ ن ک ی ت و ی ب ی ت ن آ ز ا ه د ا ف ت س ا ز ا س پ ا ه ی ت ک ا ب ل ک ش ی ی غ ت ه ی ل و ا ه ز ا د ن ا ز ا ی م ک ا ه ت س ی س و و ا و د و ب ح ض ا و پ و ک س و ک ی م ی س ب د و د ن د و ب ه د ش ت ک چ و ک ا ه ت س ی س و و ا ا د ج ل ک ش ی ی غ ت و ب ی خ ت ی ن و ت ک ل ا د ی پ و ک س و ک ی م ن و ت ک ل ا ش ی ا م ز آ ( د ی د گ ه د ه ا ش م ن ا م ل آ خ ی ن و م ه ا گ ش ن ا د ی ک ش ز پ م و ل ع ه د ک ش ن ا د ه ا گ ش ی ا م ز آ ش و د. ) د ش م ا ج ن ا ی ی ا ب ی ک ش ی د ه م ت ک د ظ ن ی ز ا ه ت س ی س و و ا ی گ د و ل آ ن ا ز ی م ظ ن ز ا ن و ی س ا ت ل ی ف ز ا ه د ا ف ت س ا ی ت ک ا ب ز ا ی ا ع ت ل ی ف ی و ی ا ه ت س ی س و و ا ی ت ک ا ب ه ب ت ل ی ف س و ک ع م ی و ش ت س ش ز ا ل ص ا ح ی ا ه ت س ی س و و ا و د ا د ع ت ش و ن ی ا د. د ن ت ش ا د ی ت ک ا ب ه ب ط س و ت م ی گ د و ل آ ز ا ب د ص د و ه د ا ت ف ا ی گ ت ل ی ف ن و د ا ه ت س ی س و و ا ز ا ی د ا ی ز. د ش ه ب س ا ح م د ص د 0 3 ا ه ت س ی س و و ا ت ف ا ی ل. ک ی ا ف ی ن ا ک ل پ ی ت ظ ل غ ب ی ش و د ص د 5 5 ز ا ک ا س ش و ه ب م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ج ا خ ت س ا ه س ی ا ق م : 1 ی و ص ت ت س ی س وو ا ا ب ه ا م ه ی ا ه ی ت ک ا ب ی س ب و ظ ن م ه ب د ص د 0/5 ل ک ی ا ف الیه گم ی ز ی م آ گ ن 2-. ی ز ا س خالص از ل ب ق ع و ف د م ه ن و م ن ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن 1- و ه د ش ن شناو که هستند ی ی ا ه ت س ی س و و ا گ ن ی ب ا ی و کمنگ صوتی نگ ه ب کوی اجام ل ک ی ا ف ش و ز ا حاصل سوب گم آمیزی گ ن 3-. م و و ا پ م و ی د ی و پ س و ت پ ی ک ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن 5-. د ه د ی م ن ا ش ن ا ل ک ی ا ف ش و ز ا حاصل اووسیست ی و ا ح ه ی ال ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن 4-. د ن و ش ی م ه د ه ا ش م ب و س د ی و ا ح ه ی ال ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن 7-. د ص د 5 5 ز ا ک ا س ش و ز ا حاصل سوب ز ا ه د ش ح ال ص ا ن س ل ن ل ی ذ ی ز ی م آ گ ن -. ل ک ی ا ف ش و ز ا حاصل سوب. ت ل ی ف ق ی ط ز ا ص ی ل خ ت ز ا د ع ب ت س ی س و و ا 8-. د ش ا ب ی م % 5 5 ز ا ک ا س ش و ز ا ل ص ا ح ت س ی س و و ا

9 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م س پ س و ) 3 د ن ا ب ( د ن د ش ه د ا د ی ث ک ت,F1) (R1 ی ص ا ص ت خ ا ی ا ه م ی ا پ ا ب ا د ت ب ا م و پاو م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ز ا ه د ش ج ا خ ت س ا DNA 2: ی و ص ت. د ش ا ب ی م DNA 100bp ک ا م 1 د ن ا ب. ) 2 د ن ا ب ( د ش ه د ا د ی ث ک ت,F2) (R1 ی ا ه م ی ا پ ا ب PCR ل و ص ح م م و و ا پ م و ی د ی و پ س و ت پ ی ک ه ن و گ ن ی ی ع ت ت ه ج ی ی گ ه ج ی ت ن و ث ح ب م و ی د ی و پ س و ت پ ی ک ک ت ی ا ه ت خ ا ی ز ا ه خ ا ش پی ا ث ک ا ی ا ه د و سلولهای مسواکی ه ی ال ه ک ت س ا ا س ک ل پ م ک ن ا ا د ه ه م ا ز و ی د ی و پ س و ت پ ی ک م ت س ی س ی ن م ی ا د و م د ت ی م ه ا ن ا ک د و ک ا ی س ب م ج ا ه ت. د ا د و د ا ف ا د ا ق ل ا س ی ا ا د د ه د ی م ص ق ن ه م ه د و د ح ه ک د ا د خ ه د ح ت م ت ال ا ی ا ی ک ا و ل ی م ه ش د ی ی گ ه د و ل آ شه آشامیدنی ب آ سیستم طیق از ف ن ا ز ه د ن د ش ا و د و م گ م ش ا ز گ د ی د گ )8 و. ) 1 ی ش ا ن ی م و گ م ن ا ز ی م ) ( ن ا ا ک م ه و ا ک س ن ی ز ا ک ی ن م ی ا م ت س ی س ص ق ن ا ب د ا ف ا د س ی ز و ی د ی و پ س و ت پ ی ک ز ا 0 5 د ص د ک ذ م و و ا پ م و ی د ی و پ س و ت پ ی ک. د ن د ک د ه ک ت س ا ا ذ غ و ب آ ق ی ط ز ا ه ل ق ت ن م ی ا ه ت خ ا ی ک ت. ) )1 د ا د ی د ا ی ز ت ی م ه ا ی ک ش ز پ م ا د و ی ک ش ز پ س ی ز و ی د ی و پ س و ت پ ی ک ی د ا ی ز د ا ج ی ا. د ن ک ی م د ی ا ه ه ل ا س و گ ا ه ی ا د و ا گ ه ز ا ت د ل و ت م ت ا ا س خ ه د ش ه ب ع و ف د م ه ا م ه ت س ی س و و ا ن و ی ل ی ب 0 3 ا ت و حساسند عفونت ع ف د. د ن ن ک ی م د ه ع ل ا ط م ت ا ک س ا و ن ا ا ک م ه د ل ا س ی ا ه و ا گ ع و ف د م م گ ه د ت س ی س و و ا ا ت ا ه ت س ی س و و ا ع ف د. ت س ا ه د ش ش ا ز گ م ل ا س ه ا ظ ه ب غ ل ا ب ث ع ا ب ی گ د و ل آ ی گ د و ل آ ه ب ی ا س ط ی ح م ا ه م ا د و و ع ب ا ن م ن ا س ن ا ب آ د ه ا و خ ی ح ط س. د ش و ل ا ق ت ن ا ت ا ع ل ا ط م د ت س ی س و و ا ک د ن ا ا ی س ب د ا د ع ت ی ی ا س ا ن ش جهت زیادی سطحی آبهای ع ب ا ن م خصوص به ط ی ح م و ا ه م ا د ع و ف د م م ا ج ن ا ه د ش ت س ا. ) )1 ت ی ه ا م ت خ س و م و ا ق م ضدعفونی اکث ه ب ه ک م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا ی ا ه ه د ن ن ک ل و ا د ت م د ن م و ا ق م ع ف د ی د ا ق م ل ب ا ق ه ج و ت ه ک م ل ا س ه ا ظ ه ب ی ت ح ا ی ا م ی ب ی ا ه م ا د ط س و ت ت س ی س و و ا ن ا م د د و ج و م د ع و د و ش ی م ط ی ح م ی ز ا س ه د و ل آ ه ب ج ن م

10 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 4 8 ا ق ن ی ق ق ح م ه ج و ت ز ک م د ا ه ت خ ا ی ک ت ن ی ا ی ع ط ق ی ا ه ش و ی و ب ت ا ق ی ق ح ت ه ک ن ی ا م غ ی ل ع. ت س ا ه د ا د ف ل ت خ م ج ا خ ت س ا م و و ا پ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا شوع قبل سالها از ی ط ی ح م ی ا ه ه ن و م ن ی ا س و ع و ف د م ز ا ه ک ی ی ا ه ش و ه ب ی ب ا ی ت س د ت ه ج ا ه ش ال ت ت س ا ه د ش ه و ال ع ب ت ف ا ی ز ا ب د ا د ع ت ی ال ا ب ت س ی س و و ا ج ت ن م ه ب ن ا ن چ م ه د و ش ی ت ک ا ب ز ا ی ا ع ی ی ا ه ت س ی س و و ا ج ا خ ت س ا ه م ا د ا ه ب. د ا د ه ب و ظ ن م م ا ج ن ا ت ش ک ک ت ه ت خ ا ی ی ب ا ی ت س د س ک ی م و ئ ت و پ ت ا ع ل ا ط م و م و ی د ی و پ س و ت پ ی ک د ا د ع ت ا ه ی ص ل ا خ ا ن ا ه ی ت ک ا ب ا ذ ل ی د ا ی ز ه ب ی و ض ت س ی س و و ا ی ا د ه گ ن. د ش ا ب ی م ی ا ع نی ال و ط ز ا ن ی ن چ م ه ت د م ی ت ک ا ب ش ه ا ک و ی ا س د ا د ع ت ای ه ت س ی س و و ا ه ک ن ی ا ه ب ه ج و ت ا ب. د ن ک ی م ک م ک م و ی د ی و پ س و ت پ ی ک ه ن و م ن ز ا شده استخاج کیپتوسپویدیوم ای ه ت س ی اووس د ن ش ا ب ی م ه ا م ه ی د ا ی ز ای ه گی د و ل آ ا ب ه ا و م ه ع و ف د م ش و د و م. د ش ا ب ا ه ی گ د و ل آ ت ا ع ل ا ط م د و ج و م ه د ا ف ت س ا ن ا ش ن د ی ا ب ه د ا د د ا ق ت س ا ه ب ف ذ ح ی ا ب ن ی ا ل و ص ح ت ا ع ل ا ط م جهت مناسب ت ی ف ی ک و ت ی م ک ا ب ی ی ا ه ن ی ئ ت و پ س ک ی م و ئ ت و پ م و ی د ی و پ س و ت پ ی ک ل ق ا د ح ت ی ف ی ک. ) 1 ( ت س ا ز ا ی ن د و م ص ل ا خ ال م ا ک ت س ی س و و ا ه د ا ف ت س ا ب ه و ال ع ع و ف د م ز ا ه د ش ص ی ل خ ت ی ا ه ت س ی س و و ا ه ن و م ن ه ی ل و ا ی گ د و ل آ ن ا ز ی م ه ب ص ی ل خ ت ب س ا ن م ش و ز ا ی گ ت س ب ه د و ل آ ه ل ا س و گ ز ا ی ا د ب ه ن و م ن ش و و ع و ف د م. د ا د ه ب ن ی ا و ظ ن م د ت ا ق ی ق ح ت د ی ا ب ز ا ش و ه د و ل آ د ک ی ت و ی ب ی ت ن آ ز ی و ج ت ا ب ه ا م ه ه ل ا س و گ ی ب ج ت ی ز ا س ت س ی س و و ا ی ال ا ب د ا د ع ت ه ب ی ب ا ی ت س د و ظ ن م ه ب ز ی م ت ی ط ی ح م ه د ا ف ت س ا. د و م ن ذ خ ا ه ن و م ن ز ا ه ل ا س و گ ه د و ل آ د ی ا ب ا ب م ا ج ن ا ف ا ط ا ط ی ح م ا ب س ا م ت ن و د ب و ل ا ت ک ش ی ا م ز آ ب د و ج و م ع و ف د م ی ا ه ه ن و م ن ی و آ ع م ج ز ا ی ت س ی ا ب. د و ش ق ی ق ح ت ن ی ا د. د و ش ی ا د د و خ ت د ش ه ب ن ی م ز ح ط س ی و ه ب ه ل ا س و گ بی ج ت سازی ه د و ل آ ن ی ل و ا ا ی س ب ش ال ت م غ ی ل ع ل ی ل د گی د و ل آ ط ی ح م ی ا د ه گ ن ج ن م ه ب ع ف د د. د ی د گ باکتی ه ب ال ا ب گی د و ل آ ا ب ه ا م ه ت س ی س و و ا ت ش ک ی ب و ک ی م س ی م و ف ی ن چ ی ل س ن ج و ه ن و گ ن ی ا )Bacillus licheniformis( س و ل ی س ا ب ی ت ک ا ب ص ی خ ش ت د ش ه س ا ی ت ک ا ب و ت ن ا ه د ا و ن ا خ ز ا ی ت ک ا ب چ ی ه و د ش ه د ا د د ک ن ه ک ال ا م ت ح ا ه ب ل ی ل د ث ا بی ت م و ا ق م و ه س ا ی ت ک ا ب و ت ن ا ای ه باکتی ت ا م و ک م ی س ا ت پ ب س و ل ی س ا ب ی ت ک ا ب ا ه ش ال ت. ت س ا ه د و ب م ی س ا ت پ ت ا م و ک بی ه ب س ی م و ف ی چ ی ل ت ی ق ف و م ا ب ت س ی س و و ا ه ن و م ن د ی ت ک ا ب ن ی ا حذف جهت ن ت ف ن ی ب ز ا صوت د ه ک ا چ د و ب ن ه ا م ه لی و ب ق ل ب ا ق ه د ا ف ت س ا د ن ن ا م ی ی ا ه ش و ط س و ت ا ه ه ن و م ن ن ی ا د باکتی د ک ی م ی ی غ ت ز ی ن ت س ی س و و ا شکل موث ک ی ت و ی ب تی ن آ ز ا ی ت ک ا ب ن ت ف ن ی ب ز ا ت و ص د تی ح ن آ ب ه و ال ع و ه ش ال ا ه ن آ ا ب چ ی ه شی و ز ا ت س ی س و و ا ا د ج. د ی د گ ن ل ک ش م س ک ی م و ئ ت و پ ت ا ق ی ق ح ت د باکتی ه ش ال و ض ح. د و ب د ه ا و خ ز ا س ا ت ای اا ا شه ش ش ش و ن و ن ک ن ی ق ق ق ق ق ق ق ح م ط س و ت فی ف ف ف ل ت خ م ت ت ت ت ت س ی س و و ا ززی ز ز ز ز ز ز ز ز ز ز ز ز ز ز ز ز ز ز ا س ا د ج منظو به ف ل ت خ م ع و دف م ز ا م م م و ی د ی و پ س و ت پ ی ک ( 0 5 ( ی( ز ا س و ا ن ش 0 شک گم ا ) ل ن ف لیت میلی ه د ا ف ت س ا ا ب ت ی ش. ت ت ت ت ت ت ت ت ت ت س ا ه د ش م ا ج ن ا ت ی ش ل و ل ح م ز ا ط ق م ب آ ت ی ل ی ل ی م و ا. ی س ا گ 9 ) 5 1 ( ( ( ( (( ( ( ( ( (( ( ( ( ( د ک ی ف ع م ا ب ی ز ا س و ا ن ش ش و ) ( ( ( ( ( ان ا ک م ه ت ی ش وش بهتین ن ا و ن ع ه ب ا ی ا ب بیماان د کیپتوسپویدیوزیس ه ی ص و ت ا اا ا هه ه ه ه ا گ ش ی ا م ز آ هت ج ل ک پ ز ا ) ( ( ( ( ( ( ن ا ا ک م ه ص ی خ ش ت. ) 2 1 ( کدند استفاده ا ه ت س ی س و و ا ه ب زی د ی ا ل و ل ح م و من د ل ا و. ) 5 1 ( د د د ن ا ه ه ه ه د و م ن ی ز ا س ا د ج و ی ز ا س خالص کدند ن ا ی ب ) ( ن ا ا ک م ه و د و و آ ا ب م و ی د ی و پ س و ت پ ی ک ای ه ت س ی س و و ا ه د ا ف ت س ا ش و ز ا

11 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ی ز ا س و ا ن ش ا ب ل و ل ح م ت ی ش ب ل غ ا ت ی ا ض ش خ ب ن ی ا د ه د ش ا د ج ی ا ه ت س ی س و و ا د ا د ع ت ه چ گ ا. د ش ا ب ی م ن و ی ت ک ا ب ی د ا ی ز ن ا ز ی م ا ب ه ا م ه ا ه ن آ ا م ا د و ب ال ا ب ش و ی ا س ی ا ه ی ص ل ا خ ا ن ی ع و ف د م و د ن م ز ا ی ن ه ل ح م ی ف ا ض ا ن ا م ز م ه ص ی ل خ ت ش و ز ا ا ه ن آ ا ذ ل. د ن د و ب ی ز ا س ص ل ا خ و د ن د ک ه د ا ف ت س ا ل ک پ و ز ا ک ا س ع ط ق ن م ی ت ظ ل غ ب ی ش م ال ع ا د ن د و م ن ش ی ب ز ا 4 3 د ص د ل ک ا ه ت س ی س و و ا ه ب و شدند جدا پکل ی ت ظ ل غ شیب محله د خالص شکل ن ی ا ا ه ت س ی س و و ا. ) )4 د ن د و ب ی ب ک ی م ت ن و ف ع ا ز و ی ا ع ز ا ی ا ه ی گ د و ل آ ز ا دی ا د ع ت ع ا ب ش ا ز ا ک ا س ش و د حاض مطالعه د ل ب ا ق ن ا ز ی م ب و س ه ا م ه و د ن د ش ن و ا ن ش ا ه ت س ی س و و ا ی د ا ی ز ن ا ز ی م ن ی ن چ م ه. د ش ه د ه ا ش م ت س ی س و و ا هی ج و ت ی ت ک ا ب. د ی د گ ش و ه ا م ه ای ه ت س ی س و و ا ی ز ی م آ گ ن ای ه ت س ی س و و ا ت س د ب ای ا د د. ن د و ب د ئ ا ز د ا و م و ا ه ی ت ک ا ب و ا ن ش ه د م آ ن ا ز ی م ز ا ه د ش ن آ گی د و ل آ د ه د ه ا ش م ه ال ا ب و د ه ب زی ا س و ا ن ش ز ا ه د ا ف ت س ا ا ب ) ( ن ا ا ک م ه و ی ن ال ی ک ل ک پ ت ن ا ی د ا گ و د ی ا ل ک م ی ز س تی ظ ل غ ب ی ش ک م ک ه ب ا م و ی د ی و پ س و ت پ ی ک ی ا ه ت س ی س و و ا ص ی ل خ ت ی ت ظ ل غ. د ن د و م ن ل ک پ ی ا ه ت س ی س و و ا ت ا ش ی ا م ز آ 3( و. ) 5 ا ه ن آ ا ل ص ا ح ی ی ا ی م ی ش و ی ب ن ی ا ش و ی ا ه ت س ی س و و ا ت ه ج ه ب و ز ا ز ا ت ا ش ی ا م ز آ م ی ز س ه ن و م ن ل ص ا ح د ی ا ل ک ی ک ی ژ و ل و ن و م ی ا ل ی ل د ه د ا ف ت س ا ز ا ز ا ی ل و ک ل و م ا ی ف ع م م ی ز س ع و ف د م ب ی ش و ت ه ج د ن د ک د ی ا ل ک ن ی ا د ن ی ا ب ه و ال ع. ت س ی ن صفه به ن و ق م و ه د و ب ن ا گ ن ک م م ه ک ه د ش ه د ا ف ت س ا ال ا ب و د ی ا ه ژ و ف ی ت ن ا س ز ا ش و. د ن ش ا ب ن س ت س د د ه ش ی م ه ت س ا د و و آ ی ت ظ ل غ و م ی ز س ن و س د ل ا ن و د د ی ا ل ک و ) ( ) g( ه ب ت د م ک ی م ا ج ن ا ت ع ا س ا ب ه د ا ف ت س ا ژ و ف ی ت ن ا س د ی ا م د ز ا و د 4 ب ی ش ال ا ب ه ج د ن ی ا د. ) 4 1 ( د ن د ک ا ه ت س ی س و و ا ی ز ا س ص ل ا خ ه ب م ا د ق ا گدید استخاج ی ت ک ا ب ز ا ی ا ع ی ا ه ت س ی س و و ا ه ع ل ا ط م ه ک. د ن د ش ت ه ج ت ا ع ل ا ط م ی ک ی ژ و ل و ن و م ی ا ب س ا ن م ی ب ا ی ز ا ل و ک ی ا ف ی ت ظ ل غ ب ی ش ز ا ) ) ن و س پ م ا ت و ی ن و ل م ه د ا ف ت س ا ش و م ع و ف د م ز ا ا ه ت س ی س و و ا سازی خالص بای ه ز ا ا ه ش و م ی ب ج ت ی ز ا س ه د و ل آ ز ا س پ ا ه ن آ. د ن د ک ش و م ج ا خ ت س ا ی ط ص ل ا خ ه د ک و ی ز ا س ت ه ج 3- ت ش ک ن و ی ل ی م ت س ی س و و ا ی ا ه ت س ی س و و ا. ) 1 1 ( د ن د ب ه ه ب ن آ ز ا م و و ا پ م و ی د ی و پ س و ت پ ی ک د ه ع ل ا ط م ض ا ح د ش و ب ی ش ی ت ظ ل غ ی ن ا ک ل پ ) ل ک ی ا ف د ص د 0/5 ت ق ه ی ال ( ظ ن د و م ه ی ال د ل ک ی ا ف ی د ا ی ز ی ل و ل س ی ا ه ه د و ت و ی ت ک ا ب ا ه ت س ی س و و ا ه ا م ه ه ب ی ت ک ا ب ب ه و ال ع م ه ب و س ت م س ق د. ت ش ا د د و ج و د. ت ش ا د د و ج و ت س ی س و و ا ی ه ج و ت ل ب ا ق ن ا ز ی م ا ی س ب ی ل و ل س ی ا ه ه د و ت ز ا ا ه ت س ی س و و ا الیه تفکیک ش و ن ی ا ز ا ه د م آ ت س د ب ی ا ه ت س ی س و و ا. د و ب ا و ش د ا ه ی ت ک ا ب و ی گ د و ل آ ن ا ز ی م ی ا ا د ی ز ی م آ گ ن ش و و د ه د ن ی ا ی ت م ک ه ب ا ه ی ت ک ا ب و د ا و م د ئ ا ز د. د ن د و ب ع ا ب ش ا ک م ن ب آ و ع ا ب ش ا ز ا ک ا س ه س ی ا ق م ا ب ش و ع ا ب ش ا ز ا ک ا س ه ل ی س و ب ی ز ا س ق ل ع م ز ا ) ( ن و ت پ آ ت ش ک د ا ه ن آ ز ا و د ب ه ه ب ا ه ت س ی س و و ا ج ا خ ت س ا د ه د ا ف ت س ا م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ل و ل س د و م ن. ) 1 ( و ه د و ب ع ی س ا ی س ب ش و ن ی ا ت س ا د ق ت ع م ) ( ی ا ف و د و ش ی م ت س ی س و و ا ز ا ی د ا ی ز ن ا ز ی م ت ف ا ی ز ا ب ه ب ج ن م ز ا ه د ش ی و آ ع م ج ی ا ه ت س ی س و و ا د ص د ش ی ا ز ف ا ی ا ب ا ه ب و س. ) )2 د ش ا ب ی م ب ق ا ع ت م ن و ی س ا ت ل ی ف ی ا ه ب آ ی ح ط س ب س ا ن م زی ا س و ا ن ش ش و ز ا ) 9 1 )88 ن ا ا ک م ه و ب م ال ه د ا ف ت س ا ا ه ت س ی س و و ا ص ی ل خ ت ای ب ک م ن ل و ل ح م ط س و ت د ن د و م ن. ) 0 1 ( ا ه ن آ ز ا ژ و ف ی ت ن ا س ب ی ش بای لی ا گ چ

12 ا) ب 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 8 د ا م ه ع ل ا ط م ج ی ا ت ن. د ن د ک ه د ا ف ت س ا ا ه ت س ی س و و ا ت ف ا ی ز ا ب ش و ه د ا ف ت س ا ز ا ل و ل ح م ک م ن م ا ع ط ع ا ب ش ا ا ب ج ی ا ت ن ی و ط ه ب ت ش ا د ن ت ق ب ا ط م ن ا ا ک م ه و ب م ال ت ا ع ل ا ط م ه ک دی ا د ع ت ای ه ت س ی س و و ا ز ا ا ه ت س ی س و و ا و ا ن ش ه د ش ز ی ن و ا ن ش ن ا ز ی م د ن د ش ن ی د ا ی ز و ه ا م ه ل و ل س و ن آ ز ا ه د م آ ت س د ب ای ه ت س ی س و و ا. ت ش ا د د و ج و ی ت ک ا ب ال ا ب گی د و ل آ ن ا ز ی م ای ا د ی ز ی م آ گ ن ش و و د ه د. د ن د و ب د ئ ا ز د ا و م و ا ه باکتی ه ب ت ن ی و و ن ا ا ک م ه ) ( ا ب ه د ا ف ت س ا ز ا ش و ه د ش د س د ص د 5 5 ز ا ک ا س ل و ل ح م ط س و ت شناوسازی ا ت ب س ن ن ا ز ی م ص ی ل خ ت ه ب ق ف و م ) 1/9 2 ص و ص خ م ن ز و ه ع ل ا ط م د ش و ن ی ا. ) 3 2 ( د ن د ش ا ه ت س ی س و و ا ز ا ی ی ال ا ب ض ا ح ز ی ن ه د ا ف ت س ا د ش و ج ن م ه ب ص ی ل خ ت ز ا ک ا س ش و د د. ی د گ م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا د ه ک ی و ط ه ب د ن د ش و ا ن ش ی ب و خ ه ب ا ه ت س ی س و و ا 5 5 % ب و س ن آ ت س ی س و و ا ل ب ا ق ی ه ج و ت ه د ه ا ش م. د ی د گ ن ز ا ه د ش ی و آ ع م ج ی ا ه ت س ی س و و ا ا ب ه ا م ه ی ت ک ا ب ن ا ز ی م ی ل و ل س ی ا ه ه د و ت و د و ب ا ه ش و ی ا س ز ا ت م ک ش و ن ی ا ا ه ت س ی س و و ا و ی ل و ل س ه د و ت ا ه ی ت ک ا ب. د ی د گ ن ه د ه ا ش م. د ن د ش و ا ن ش ی ی ا ز ج م ی ا ه یه ال د ا ت ب س ن م ا د ک ه ال ا ت ن ا و ن ا ا ک م ه ) ( ز ا ب ی ش ی ت ظ ل غ م ی س ا ت پ ت س ی س و و ا ص ی ل خ ت ت ه ج ) % 8 2 و 1 % % ( د ی ا م ب ه ه ب ن ا و ن ع. د ن د ب ی ا ه د ا م ا ه ن آ د د ه ع ل ا ط م س ت س د و د و خ ن ا ز ا م ی س ا ت پ ی ف ع م د ی ا م ب ا د ن د ک ه ب و د ی ت خ س ب ه و ال ع د ی ا ل ک م ی ز س و ل ک پ د ن د و م ن ن ا و ن ع. ) )5 د ن ش ا ب ی م ز ی ن ن ا گ م ا ج ن ا ه ج ت( ( ن ا ا ک م ه و گ ن ا ت م و ی د ی و پ س و ت پ ی ک ه ب ه س ی ا ق م ت س ی س و و ا ص ی ل خ ت ش و. د ن ت خ ا د پ ز ا ک ا س ا ب شناوسازی ساکاز ن و ی س ن ا پ س و س ای ه ش و ت ن ا ی د ا گ د ی ا ل ک ل ک پ ت ن ا ی د ا گ ه ا م ه ل و ک ی ا ف زی ا س و ا ن ش ش و ا ب ز ا ک ا س ت ن ا ی د ا گ م ی ز س ع ط ق ن م ا ه ن آ ه ع ل ا ط م د و م ای ه ش و ل ک پ گادیانت و ز ا ک ا س. د ن د و ب ل و ل س 9 /5 5 ( ا ه ن آ م ال ع ا ب د ص د ی( ت م و ت ی ا س و ل ف ل ک پ ه ا م ه س ا س ا د ن د و م ن ت ف ا ی ز ا ب ج ی ا ت ن ای ه ش و زی ا س و ا ن ش زی ا س و ا ن ش ت س ی س و و ا ا ب ا ب ی ت م و ت ی ا س و ل ف ن و ی س ن ا پ س و س ا ب ز ا ک ا س ز ا ک ا س ش و و و 0 3 /7 2 ( ت ش ک ز ا ک ا س ی ی ا س ا ن ش ت ن ا ی د ا گ د ص د ه ب ) ی ت م تو ی ا س و ل ف ی ی ا س ا ن ش ش و ا ب ت س ی س و و ا ت ف ا ی ز ا ب ب ی ت ت ش ا ز گ تی ظ ل غ ن ی ت ال ا ب د ن د و م ن ع ط ق ن م ت ف ا ی ز ا ب ه ک ز ا ک ا س ت س ی س و و ا ای ه ش و و ب ی ش م ی ز س تی ظ ل غ ا. د ن ا د د ی ا ل ک ل ک پ و ا ه ن آ ب ی ش ب ی ش ت س ی س و و ا می ک د ا د ع ت ص ی ل خ ت ی ی ا ن ا و ت ل و ک ی ا ف تی ظ ل غ تی ظ ل غ ب ی ش ش و د ی ت ک ا ب دگی و ل آ ن ا ز ی م. د ن ا د ا ل ک پ ه ا م ه 3/ ±0/ / ±0/ / ±0/ زی ا س و ا ن ش ک ذ 4 1 / ±0/ ص ی ل خ ت ه د ش ه ب ش و ی ز ا س و ا ن ش ب ی ش ا ب ن و ی س ن ا پ س و س م ی ز س. د ی د گ تی ظ ل غ ا ب ز ا ک ا س ز ا ک ا س ز ا ک ا س د ی ا ل ک ای ه ت س ی س و و ا ل ک پ ه ا م ه ا ی ت ک ا ب ه ب گی د و ل آ ن ی ت م ک ز ا ک ا س ا ب زی ا س و ا ن ش ی ت ک ا ب ت ش ک د و م د ا م ه ع ل ا ط م ج ی ا ت ن. ) 1 ( د ن د ا د ن ا ش ن ه ک ت ش ا د ن نی ا و خ م ه ن ا ا ک م ه و گ ن ا ت ت ا ق ی ق ح ت ا ب ال ا م ت ح ا ه ب ط ا خ. د ش ا ب ی م ا م ه ع ل ا ط م ه د ا ف ت س ا ز ا بی ت ا م و ک م ی س ا ت پ د ا ب زی ا س و ا ن ش ز ا ه د ا ف ت س ا ا ب ) ( ن ا ا ک م ه و ن ب ا ا 3 1/2 1 ص و ص خ م ن ز و ( طعام نمک ل و ل ح م م 0 گ د د ن ت ش ا د کمی اولیه گی د و ل آ که نمونههایی وی ب ) ت ی ل د ا د ع ت 1/ ± 0/ ت س ی س و و ا ا م ی ت ز ا ل ب ق. د ن د و آ ت س د ه ب م و و ا پ م و ی د ی و پ س و ت پ ی ک ی ت ک ا ب نی و ل ک ت ی ل ی ل ی م ه د 2/ د ا د ع ت ت ا ا ب د ش باکتی ت ا ا ب ا م ی ت ز ا س پ لی و د ی د گ ش ا م ش. د ک ن ا ب ه ج و ت ه ب ن ی ا ه ک د ت ش ی ب د ا و م ه ی ه ت ع ب ن م

13 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م ت س ی س و و ا ه ن و م ن ع و ف د م د ش ا ب ی م ه ک ال و م ع م ه ا م ه ا ب د کابدی وش ن ی ا ت س ا باکتی ه ب ی ی ال ا ب گی د و ل آ ا ب ا م ت ا ع ل ا ط م ج ی ا ت ن. ) 2 1 ( ت ش ا د د ه ا و خ ن ا ه ه ن و م ن ن ی ا ت ل ع ه ب د ن ا و ت ی م که نداشت خوانی هم ه ع ل ا ط م ن ی ا ج ی ا ت ن ت ال ا ب ن د و ب گی د و ل آ. د ش ا ب ا م ق ی ق ح ت د ه د ا ف ت س ا ای ه ه ت ف ا ی ) ( ( ش خ ب ه( ک ق ی ق ح ت ت ق ب ا ط م ض ا ح د ا د ی ی ا ی ت ک ا ب و ا ب ا ب ه ت ف ا ی ظ ن ه ن و م ن د و و آ ا ی س ا گ ع و ف د م و و د و م ن ا ا ک م ه ن ا ا ک م ه ت ی ا ض ا شیت محلول ا ب شناوسازی وش ف ی ص و ت د ن د ک ت ق ب ا ط م. د ا د ن ش و ب ی ش بی و ل ط م ج ی ا ت ن ت س ی س و و ا ص و ل خ ظ ن ز ا ل ک ی ا ف ظتی ل غ ز ا ت ن ا گ ی ا ه د ا م ل و ک ی ا ف ه ک ن ی ا ضمن نداشت پی د س ت س د د ی ه ا گ ش ی ا م ز آ ه د ه ش ی م ه و ت س ا ز ا ک ا س. د ش ا ب ی م ن زی ا س و ا ن ش ش و د ا د ع ت ه د ا ف ت س ا ز ا ی د ا ی ز ز ا ک ا س 5 5 ت س ی س و و ا د ص د ص ل ا خ. د ک د ا ج ی ا ا ه ش و ی ا س ا ب ه س ی ا ق م د ا ت س ی س و و ا گ ن و پ ا پ م و ک و ن ا ا ک م ه ) ( ز ا ن م ض زی ا س و ا ن ش ن ی ت ا ب ش و ا ب ن آ ه س ی ا ق م و ) 1/8 1 ص و ص خ م ن ز و ( ز ا ک ا س ک ی ت ن گ م و ن و م ی ا ت ه ج ص ی ل خ ت ا ه ت س ی س و و ا ه د ا ف ت س ا ا ن آ و د ا ه ن ش ی پ ا ز ا ک ا س ا ب زی ا س و ا ن ش ا ه ن آ. د ن د ک گان ا گ ن ی ت ن گ م و ن و م ی ا ش و و فی ع م ب س ا ن م و ن ا ز ا ضد بادی تی ن آ ک ی ت ن گ م و ن م ی ا ش و د. ) )8 کدند ذک تی ن آ ای ه ن ژ حی ط س م و ی د ی و پ س و ت پ ی ک ت س ی س و و ا ا ه ت س ی س و و ا و د و ش ی م ل ص ت م ی س ی ط ا ن غ م ت ا ذ ه ب م و و ا پ ت ا ذ کیفیت. میشوند جدا محلول ز ا ت ن گ م ک م ک ه ب ت س ب و ی گ ژ ی و و ل ی م ی ب ی ک ت تی ن آ ا ه دی ا ب ه ب ل گ ن ا ه. د ش ا ب ش و ن ی ا د ه د ن ن ک د و د ح م ل م ا و ع ز ا د ن ا و ت ی م ه چ ل ی م ت س ی س و و ا ی ب ی ک ت ت ش ی ب تی ن آ د ش ا ب دی ا ب ت س ی س و و ا ل ص ت م ا ب ه د ش ت د ق ه ب ت س ب ی ت ش ی ب ه ب ه ب ل ا ص ت ا ت د ق ن ی ا ت س ا ن ک م م و د و ش ی م ل ص ت م ت س ب ع ن ا م ا ه ن د ش ت س ی س و و ا د ه ل ح م زی ا س ا د ج ی ی ا ه ن ت س ا ن ک م م ن د ا د ن ا ک ت ش و و ت س ب ت ا ذ ه ز ا د ن ا. د و ش. د ش ا ب ه ت ش ا د ث ا ن آ ه ب ت س ی س و و ا ل ا ص ت ا ن ا ز ی م ب ب ج و م ا ت س ی س و و ا ت ف ا ی ز ا ب ن ی ت ال ا ب قی ف ا ای ه ن ا ک ت ت ا ذ ع م ج ت ث ع ا ب ی ا ه ی ا د ن ا ک ت ه ک تی و ص د شده ت س ی س و و ا ا ب س ا م ت ح ط س ش ه ا ک و ز ک م د ی س ی ط ا ن غ م. ) )8 د و ش ی م ا ه چ ز ا ک ی چ ی ه د ی د گ ص خ ش م ق ی ق ح ت ن ی ا د ل م ا ک ی ز ا س ا د ج و ص ی ل خ ت ی ی ا ن ا و ت ه د ش م ا ج ن ا ش و ت ش ا د ن ا ا ه ی ص ل ا خ ا ن ی ا س و ی ت ک ا ب ز ا ا ه ت س ی س و و ا ه ی ه ت و ظ ن م ه ب خالص اووسیست ه ب ی ب ا ی ت س د ی ا ب ا ذ ل ن ی ت ه ب. د ی د گ ه د ا ف ت س ا ن و ی س ا ت ل ی ف ش و ز ا ن ژ ی ت ن آ ش و ق ی ق ح ت ن ی ا د ه س ی ا ق م ش و ا ه چ د ه ج ی ت ن و ط ه ب که گدید ازیابی د ص د 5 5 ساکاز از ه د ا ف ت س ا ی ل ی م د ت س ی س و و ا ن و ی ل ی م 0 4 ص ی ل خ ت ه ب ج ن م ط س و ت م ا ب ه ا م ه ی ی ا ی ت ک ا ب ی گ د و ل آ ن ی ت م ک و د ی د گ ت ی ل ه د ه ا ش م ش و ن ی ا د ه د ش ص ی ل خ ت ی ا ه ت س ی س و و ا ی ا ی ا ز م ز ا ز ا ک ا س ن د و ب س ت س د د و ن ا ز ا. د ی د گ ی د ا ی ز د ا د ع ت د ی د گ ب ج و م ه ک ت س ا ش و ن ی ا گ ی د. د ن و ش ی ز ا س ا د ج م ک ه ن ی ز ه ا ب ز ی م ت ا ت ب س ن ت س ی س و و ا و بی چ ش ه ا ک د Tris-EDTA ف ا ب و ت ا ز ا ه د ا ف ت س ا م د ق د ا ذ ل. ت ش ا د ی ی ا ز س ب ش ق ن ع و ف د م زی ا س ن گ م ه 5 5 ز ا ک ا س ل و ل ح م ز ا ه د ا ف ت س ا ا ب ه ع ل ا ط م ن ی ا د ل و ا ه ی ل و ا ص ی ل خ ت ه ب م ا د ق ا ع و ف د م ه ن و م ن ی و ب د ص د ن ی ا ز ا ل ص ا ح ی ا ه ت س ی س و و ا و د ی د گ ا ه ت س ی س و و ا ت ل ی ف ز ا ا ه ی ت ک ا ب ت ش ی ب ه چ ه ن د و د ز ت ه ج ش و د و م ل ی ا س و و ا ه ل و ل ح م. د ش ه د ا د و ب ع ی ز ل و ل س و ت ی ن ل ا م ت ح ا ا ت د ی د گ ل ی ت س ا ن و ی س ا ت ل ی ف ل ح ا م د ه د ا ف ت س ا ز ا س پ. د و ش ف ذ ح ی ج ا خ ی ا ه ی گ د و ل آ و ض ح ت ل ی ف وی ا ه ت س ی اووس ز ا ی غ می ج چ ی ه ن و ی س ا ت ل ی ف و ه د ش ن گ م ه ای ه م ج و ا ه ی ت ک ا ب ه ش ال. د ن ت ش ا د ن ا ق ت ش ک د. د ن د ک و ب ع نی و ک ی م 3 ذ ف ن م ز ا ه د ش د خ

14 5 2 ی پ ا ی پ م و د ه ا م ش م ت ش ه ه و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب و ک ی م ه ی ش ن 8 8 ی ی ا ی ت ک ا ب ه ن و م ن ت س ی س و و ا ص ی ل خ ت ه د ش ه ب ش و ه ش ال د ن چ ه د ک ن د ش ی ت ک ا ب چ ی ه د ص د 55 ساکاز ا ه ی ت ک ا ب ه ب ح و ض و ی ز پ و ک س و ک ی م ی و ن ه د ه ا ش م ت ا م و ک بی ز ا ه د ا ف ت س ا د ن ا و ت ی م م ا ن ی ا ت ل ع د ی د گ م ی س ا ت پ ص ی ل خ ت ه ب ن ا و ن ع د و م ه د ن ا د ه گ ن ه د ا ف ت س ا. د ش ا ب ع و ف د م ن ا م ه و ت ا و ط د ه ک ش و ا ظ ت ن ا ص ی ل خ ت ت س ی س و و ا ه ن و م ن ی ی ا ی ت ک ا ب ت ش ک د ت ف ی م د. ک ن د ش باکتی چ ی ه ز ی ن ن و ی س ا ت ل ی ف ش و ه ب ه د ش نشان حاض مطالعه تخلیص جهت ه ک د ا د ی اا ا هه ه ه ن و م ن ز ا م و و ا پ کیپتوسپویدیوم ی ا ه ت س ی س و و ا ی و ا ح د ا ی ز ا د ق م محححلول اساس ت س ی س و و ا ز ا ک ا س ی ز ل و ل س و ت ی ن ی اا ا ه ت ل ی ف ز ا ه د ا ف ت س ا د ا ه ن ش ی پ. د ش ا ب ب س ا ن م چبی میزان ب ی ز ا س و ا ن ش ش و تکمیلی وش و د ص د 5 5 ن و ک ی م 3 د ن ا و ت ی ی ی م ه ک ی ی اا ا هههههه ه نه و م ن د ه ک د و ش ی ی م ی ب چ ت ه ج ت ا ز ا حتما داند بالایی و ظ ن م ه ب ن ی ن چ م ه. گدد استفاده سازی همگن و ی ی ا د ز ص ی ل خ ت ی و ا ح ی اا ا هه ه ه ه ه ه ن و م ن ز ا ت س ی س و و ا ه ی ل و ا ی ز ا س ا د ج و ظ ن م ه ب ت س ا بهت اووسیست ز ا ک ا س ل و ل ح م ز ا ا ه ت س ی س و و ا کمی مقدا ن ا و ن ع ه ب و د د ص د 5 5 د ن ن ا م ه ت ف ش ی پ ی ا ا ا ا ا ا شه ش ش ش ش ش و ز ا ی ل ی م ک ت ش و ت س ی س و و ا ت ش ی ب ت ف ا ی ز ا ب د ص د ا ب ی ف ا گ و ت ا م و ک و ن و م ی ا. د و م ن ه د ا ف ت س ا ک ش ت ح ط ت ا ا ب ت ع ا ل ح م ز ا ه ع ل ا ط م ن ی ا ی ا ج ا ی ا ه ه ن ی ز ه ن ال ک ی ل م ن س ک ا و م ا د و ی ط و ن ا ی ز ب آ و ح ط ب ط ق ن ی ق ق ح م ه ل ی س و ن ی د ب د ی د گ ن ی م ا ت ی ژ و ل و ت ا پ و ن و م ی ا ی م ل ع ن ی ا ه ع ل ا ط م د. ن ا د ی م ک ش ت د و خ ا ز ا ن ی ل و ئ س م ه ط و ب م ز ا ب ا ع ب ا ن م ن ی ئ ت و پ ه ی ه ت و ی ی ا س ا ن ش ( (. ا ه د ا ز م ی ه ا ب ا 1. ی ا ت ک د ه ل ا س. م و و ا پ م و ی د ی و پ س و ت پ ی ک p23 ب ی ک ت و ن ی ک ش ز پ م ا د ه د ک ش ن ا د. 9 2 ه ا م ش شناسی ل گ ن ا ی ص ص خ ت. ن ا ه ت ه ا گ ش ن ا د. ت پوبازگانی ی ق ت ظ ن ی ز. م ی ن ا گ ی ه م ج ت. ی ا ف 2. و م و ی د ی و پ س و ت پ ی ک 0( (.. غ ی م ز و. ن ا ه ت ش خ ب و ن ت ا ا ش ت ن ا. ل و ا پ ا چ. ز و ی د ی و پ س و ت پ ی ک 3. Arrowood, M.J., Donaldson, K. (199). Improved purification methods for calf derived Cryptosporidium parvum oocysts using discontinuous sucrose and cesium chloride gradients. Journal of Eukaryot Microbiology 43 : Arrowood, J.M., Sterling, R.CH. (1987). Isolation of Cryptosporidium oocysts and sporoziote using discontinous sucrose and isopycnic percoll gradients. Journal of Parasitology 73: Entrala, E., Molina-Molina, J., Rosales- Lombardo, M., Sanchez-Moreno, M., Mascaro-Ilazcano, C. (2000). Cryptosporidium parvum: oocysts purification using potassium bromide discountinuos gradient. Veterinary Parasitology 92: Garcia, L.S., Bruckner, D.A., Brewer, T.C., Shimizu, R.Y. (1983). Techniques for the recovery and identification of Cryptosporidium oocysts from stool specimens. Journal of Clinical Microbiology 18: Kuczynska, E., Shelton, D.R., Pachepsky, Y. (2005). Effect of bovine manure on Cryptosporidium parvum oocyst attachment to soil. Applied and Environmental Microbiology 71: Kilani, R.T., Sekla, L. (1987). Purification of Cryptosporidium oocysts and sporozoites by cesium choloride and percoll gradient. American Journal of Tropical Medicine and Hygiene 3:

15 ی ا ه ت س ی س و و ا ی ز ا س ا د ج ت ه ج ب س ا ن م ی ش و ی ف ع م 18. Sheather, A.L. (1923). The detection of intestinal protozoa and mange parasites by a flotation technique. Journal of Comparative Pathology 3: Truong, Q., Ferrari, B.C. (200). Quantitative and qualitative comparisons of Cryptosporidium faecal purification procedures for the isolation of oocysts suitable for proteomic analysis. International Journal for Parasitology 3: Upton, S.J. (1997). In vitro cultivation. In: Fayer, R. (Ed.) Cryptosporidium and Cryptosporidiosis. CRC Press, Boca Raton, FL: Waldman, E., Tzipori, S., Forsyth, J.R. (198). Separation of Cryptosporidium species oocysts from feces by using a percoll discontinuous density gradient. Journal of Clinical Microbiology 23: Winter, G., Andrew, A.G., Williams, L.K., Slade, M.B. (2000). Characterization of a major sporozoite surface glycoprotein of Cryptosporidium parvum. Functional and Integrative Genomics 1: Wooley, R.E., Jones, M.S. (1983). Action of EDTA-TRIS and antimicrobial agent combination on selected pathogenic Bacteria. Veterinary Microbiology 8: Koompapong, K., Sutthikornchai, C.H., Sukthana, Y. (2009). Cryptosporidium oocyst detection in water samples: Flotation technique enhanced with immunofluorescence is as effective as immunomagnetic sepration method. Korean Journal of Parasitology 47: Liao, S.H.F., DU, C.H., Yang, S.H., Healey, M.C. (2001). Alteration of Cryptosporidium parvum (Apicomplexa: Eucoccidiorida) oocyst antigens following bleach treatment. Acta Protozoologica 40: Lumb, R., Lanser, J.A., O'Donoghue, P.J. (1988). Electrophoretic and immunoblot analysis of Cryptosporidium oocysts. Immunology and Cell Biology : McCuin, R.M., Clancy, J.L. (2005). Methods for the recovery, isolation and detection of Cryptosporidium oocysts in wastewaters. Journal of Microbiological Methods 3: Meloni, B.P., Thompson, R.C. (199). Simplified methods for obtaining purified oocysts from mice and for growing Cryptosporidium parvum in vitro. Journal of Parasitology 82: Merry, R.J. (1997). Viability of Cryptosporidium parvum during ensilage of perennial ryegrass. Journal of Applied Microbiology 82: O Brien, C.N., Jenkins, M.C. (2007). A rapid method for producing highly purified Cryptosporidium parvum oocysts. Journal of Parasitology 93: Rosales, M.J., Lazcano, C.M., Arnedo, T., Castilla, J.J. (1994). Isolation and identification of Cryptosporidium parvum oocysts with continuous percoll gradients and combined alcian bluegiemsa staining. Acta Tropica 5: Scott, C.A. Smith, H.V., Gibbs, H.A. (1994). Excretion of Cryptosporidium parvum oocysts by a herd of beef suckler cows. Veterinary Record 134: 172.

16 Journal of Veterinary Microbiology, Volume 8, Issue 2, 2012 Presenting an Appropriate Method for Isolation of Bacteria Free Cryptosporidium parvum Oocysts Shayan, P. 1 *, Asghari, Z. 1, Ebrahimzadeh, E. 1, Omidian, Z. 1, Zarghami, F Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran Received Date: 5 Jan 2013 Accepted Date: 9 Feb 2013 Abstract Cryptosporidium parvum is a zoonotic protozoan which causes disease in immunocompromised patients and newborn animals especially calves. The oocysts excreted by infected animals are introduced into the environment and water. Since the low number of oocyst can cause infection and there is no effective disinfectant against cryptosporidium, the investigation dealing with the cryptosporidiosis is of growing interest among many researchers. Therefore, they try to improve the existing isolation methods of C. parvum oocysts even in environmental samples with small number of oocysts, to obtain much purified oocysts for immunological and molecular studies. Different methods have gained some success on the isolation of cryptosporidium, but they didn t result in obtaining completely pure oocysts. The aim of the present study was to try to develop an isolating system for bacteria free oocysts. For this aim, four flotation methods have been used to isolate the C. parvum oocysts from the feces, including NaCl floatation, sucrose floatation, ficoll gradient and 55% sucrose floatation. A floatation method based on 55% sucrose was evaluated as the best method for the primary isolation of Cryptosporidium oocytes. The nitrocellulose filter (with 3µm pore size) was used to remove bacteria and other contaminants. Our results suggest that the oocysts isolated using filtration were free of bacteria and the amount of pure oocysts was 30%. Although the amount of isolated oocysts was limited, the isolated pure oocysts can be used for proteomics studies. Keywords: Cryptosporidium parvum, Oocyst, Floatation, Filtration *Corresponding author: Shayan, P. Address: Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran. Tel:

ر ی د م ی د ه م ن ر ی د م ن ا س ح ا ن

ر ی د م ی د ه م ن ر ی د م ن ا س ح ا ن ز ا س م ه ی ر ا م ع م ی ح ا ر ط و ی م ی ل ق ا ش ی ا س آ ی ا ه ص خ ا ش ی س ر ر ب ن ا ج ن ز ر ه ش م ی ل ق ا ا ب ی ر ی د م ی د ه م ن ا ر ی ا ن ا ر ه ت ر ت ش ا ک ل ا م ی ت ع ن ص ه ا گ ش ن ا د ی ر ه ش ی ز ی

Διαβάστε περισσότερα

ن ه ع ال م ط ا بی ان ز م

ن ه ع ال م ط ا بی ان ز م ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ار س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 4931 بهار 1 ه ر ا م ش م ه ل ا س 5 7-4 9 ص ص ش ق ه ع ل ا ط م ا ب ا م ز ا س ر گ د ا ر ب ر ا ز گ ت م د خ ر ب

Διαβάστε περισσότερα

ا ر ف ی و ن ع م ی ر ب ه ر ل د م س ا س ا ر ب 2

ا ر ف ی و ن ع م ی ر ب ه ر ل د م س ا س ا ر ب 2 ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ن ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ن ا د 3931 تابستان 2 ه ر ا م ش. م ت ش ه ل ا س 9 5 1-9 7 1 ص ص ن ا ر ب د ه ا گ د د ز ا و ن ع م ر ب ه ر ا ه

Διαβάστε περισσότερα

ی ا و ق ت د و ع س م ن

ی ا و ق ت د و ع س م ن ه د ک چ ت م ال س ر گ ش د ر گ ه ع س و ت ر د ر ث و م ل م ا و ع د ب ت و ل و ا و ا س ا ش ر و پ ل ر ب ک ا ل ع د س ا ر ا ا ه ف ص ا ه و ژ پ ص خ ا ش ه ا گ ش ه و ژ پ ر ا د ا ت س ا ا و ق ت د و ع س م ا ر ا ا ه ف

Διαβάστε περισσότερα

Phallocryptus spinosa ر ا

Phallocryptus spinosa ر ا 0 8 7 ا و لي ن گ ز ا ر ش م ش ا ه د ه Phallocryptus spinosa ا س ت ا ن ه ا ی ا ز و ي ز د ف ا ر س د ر ج ن و ب Anostraca( )Crustaceae; اي ر ا ن ب ه ر و ز 4 4 2 آ ت ش ب ا ر *, ر ا م ي ن م ن ا ف ف ر ن ا ص ر

Διαβάστε περισσότερα

: ک ی ن و ر ت ک ل ا ت س پ

: ک ی ن و ر ت ک ل ا ت س پ 3 9 3 1 م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ر ک ی م ه ی ر ش ن 3 4 1 13 5 : 9 2 ی پ ا ی پ ر د ی ز ا ئ ل ک و ن و ب ی ر ی س ک ا د ت ی ل ا ع ف ی س ر ر ب ی ر و ت س ا پ س و ک و ک و

Διαβάστε περισσότερα

ص خ ش ش ن ا د ت ی ر ی د م ت ر ا ه م و ی ن ا م ز ا س ت ی ا م ح ز ا ک ا ر د ا ن ی ب ه ط ب ا ر ی س ر ر ب س

ص خ ش ش ن ا د ت ی ر ی د م ت ر ا ه م و ی ن ا م ز ا س ت ی ا م ح ز ا ک ا ر د ا ن ی ب ه ط ب ا ر ی س ر ر ب س ر 2 ف د ا ه ي ش ز و م آ ت ي ر ي د م و ر ب ه ر ه م ا ل ص ف ر ا س م ر گ د ح ا و ي م ال س ا د ا ز آ ه ا گ ش ا د 3931 تابستا 2 ه ر ا م ش. م ت ش ه ل ا س 7 2-7 4 ص ص ص خ ش ش ا د ت ر د م ت ر ا ه م و ا م ز ا س

Διαβάστε περισσότερα

ف ص ل ن ا م ه ر ه ب ر و م د ي ر ي ت آ م و ز ش ي د ا ن ش گ ا ه آ ز ا د ا س ال م ي و ا ح د گ ر م س ا ر س ا ل ه ش ت م. ش م ا ر ه 2 تابستان 3931 ص ص -7 8 6 7 ت ب ن ر ا ب ط ه ب ن ف ر ه ن گ س ا ز م ا ن و س ال

Διαβάστε περισσότερα

د ا ز ز ا ب ه ش ر و ال د ن

د ا ز ز ا ب ه ش ر و ال د ن ه د ا ز ز ا ب ه ش ر و ال د ن ا ر م ا ک 3 9 3 1 م و د ه ر ا م ش م ه د ه ر و د / ی ک ش ز پ م ا د ی ژ و ل و ی ب ر ک ی م ه ی ر ش ن 1 3 1-12 4 : 9 2 ی پ ا ی پ ی ا ه ه ی و س ی و ر ی ن ا ر ی ا ل س ع ر و ب ن ز

Διαβάστε περισσότερα

انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا

انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا اال ل االخس زؤ 17 1: Holy_bible_1 انجزء انصانس نهسد ػه شث ح ا االنف ان اء انثدا ح ان ا ح اال ل االخس يضاف نضفس انسؤ ا 3( صفس زؤ ا د ا انال ذ 17 1: ف ه ا ز أ ر ص ق ط د ػ د ز ج ه ك د ف ض غ د ان ػ ه ق ائ

Διαβάστε περισσότερα


سرآغاز ی کبریه نقش حیطشنی درة 4 شة به 394 صفحة 5-37 ری قئشهر یهرد ردخنۀ طرف رب آب در جد گنکلره گنففره بقیندۀآفتکشهی 4 3 حدپر حن ردي حيدرض * بهريفر ندر طهري كي kmyrthri@yhoo.om نر پردی در تربیت دنشگه ز حیطزیت

Διαβάστε περισσότερα

ال حش ذ باىض س. Holy_bible_1 اىشب ت. Rom 13:9

ال حش ذ باىض س. Holy_bible_1 اىشب ت. Rom 13:9 ال حش ذ باىض س Holy_bible_1 اىشب ت س ت 9 :13 Rom 13:9 ( SVD )أل»ال حض ال حقخو ال حغشق ال حش ذ باىض س ال حشخ «إ ما ج ص ت أخش ج عت ف ز اىني ت:»أ ححب قش بل م فغل«. ( ALAB )أل اى صا ا»ال حض ال حقخو ال حغشق

Διαβάστε περισσότερα

شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران )

شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران ) شناسائي راهکار مناسب بکارگيري هوش تجاري با استفاده از مدل QFD ( مورد مطالعه بانک ملت استان تهران ) 1 فاطمه کریمي دانشجوي دوره کارشناسي ارشد رشته مدیریت فناوري اطالعات دانشگاه آزاد اسالمي تهران ایران fatima.karimi04@gmail.com

Διαβάστε περισσότερα

انض دخ TC يز بثم انض دخ انطبفش CC لذ ثهغ انزكشاس االن ه نالن م C نذ ان غبء ان ش ؼبد 0.44 اكثش ي ػعف يب ف

انض دخ TC يز بثم انض دخ انطبفش CC لذ ثهغ انزكشاس االن ه نالن م C نذ ان غبء ان ش ؼبد 0.44 اكثش ي ػعف يب ف اسرجبؽ رعذد اشكبل اندCYP17 يع يزالصيخ رك ظ ان جب غ PCOS نذ غبء يسبفظخ طالذ انذ / انعشاق Plymorphism of CYP17 for Polycystic Ovarian Syndrome in Women of Salah Al-Din Provence/ Iraq عم م زغ انعبط * عبدل

Διαβάστε περισσότερα

ا جزء ا ضابع ا شد ع اخطاء حشج ت ش د ط ب ا خشب

ا جزء ا ضابع ا شد ع اخطاء حشج ت ش د ط ب ا خشب ا جزء ا ضابع ا شد ع اخطاء حشج ت ش د ط ب ا خشب 19-17 : 19 Holy_bible_1 ا ضؤاي ى ىخف ف حع ا ا ض خ ب د ب ا ى حذم ش ف س ز ا خالص ا ذي ا ظ ب د ذ ا م ف حشج ا ظ ب ا ى خشب خ شى ع عخمذ ا ا ض خ ظ ب ع ى ط ب ب ع ى

Διαβάστε περισσότερα

هل تعبير والذي يأتي هو مضاف رؤيا 11:

هل تعبير والذي يأتي هو مضاف رؤيا 11: هل تعبير والذي يأتي هو مضاف 11 رؤيا 11: Holy_bible_1 الشبهة " 11 يقول البعض أن تعبير " الذي يأتي" في رؤيا 11: قائلين نشكرك ايها الرب االله القادر على كل شيء الكائن والذي كان والذي يأتي ألنك اخذت قدرتك

Διαβάστε περισσότερα

Άχμαντ Ελντίν Θάνατος: Το αναπόφευκτο γεγονός και η επίγεια προετοιμασία του Μουσουλμάνου. Θάνατος:

Άχμαντ Ελντίν Θάνατος: Το αναπόφευκτο γεγονός και η επίγεια προετοιμασία του Μουσουλμάνου. Θάνατος: Θάνατος: Το αναπόφευκτο γεγονός και η επίγεια προετοιμασία του Μουσουλμάνου كل نفس ذائقة املوت του Άχμαντ Ελντίν Διπλωματούχος Ισλαμικής Θεολογίας Τζαμί Σάλαφ ους Σάλιχ (πρώην αρ- Ραχμάν) Αθήνα, 2016 Δεν

Διαβάστε περισσότερα

Samundari Gumbad. (Τα δικαιώματα των γονιών στο Ισλάμ)

Samundari Gumbad. (Τα δικαιώματα των γονιών στο Ισλάμ) رى Samundari Gumbad ΩΚΕΑΝΙΟΣ ΤΡΟΥΛΟΣ (Τα δικαιώματα των γονιών στο Ισλάμ) Αυτό το φυλλάδιο γράφτηκε στα Ούρντου(Πακιστανικά) από τον Σαίχ-ε-Ταρίκατ Αμίρ-ε-Άχλ-ε-Σούννατ, ιδρυτή της Δάβατ-ε-Ισλάμι, Αλλάμα

Διαβάστε περισσότερα

ﻰﺿﺎﻳﺭ ﻥﺎﺘﺴﺑﺩ ﻢﺸﺷ ۱۳۹١

ﻰﺿﺎﻳﺭ ﻥﺎﺘﺴﺑﺩ ﻢﺸﺷ ۱۳۹١ رياضى ششم دبستان ۱۳۹١ وزارت آموزش و پرورش سازمان پژوهش و برنامه ريزی آموزشی برنامهريزی محتوا و نظارت بر تا ليف: دفتر تا ليف کتابهای درسی ابتدايی و متوسطه نظری نام کتاب: رياضی ششم دبستان ۳۴/۶ مو ل فان:

Διαβάστε περισσότερα

اقحجبصبت انع ذ انجذ ذ ي صفش اخجبس اال بو اال ل انثب

اقحجبصبت انع ذ انجذ ذ ي صفش اخجبس اال بو اال ل انثب اقحجبصبت انع ذ انجذ ذ ي صفش اخجبس اال بو اال ل انثب Holy_bible_1 481 اخجبس اال بو اال ل 41 41: أ ب أك ن أثب ك ن اث ب, ال أ زع سح ح ع ك ب زعح ب ع انز كب (SVD) H1931 and he והוא H3808 and I will לא H5493

Διαβάστε περισσότερα

Refugee Phrasebook/Greece March 2016-a

Refugee Phrasebook/Greece March 2016-a Refugee Phrasebook/Greece March 2016-a Standard Arabic / English [ ر. ] / Farsi / Greek phonetic / Greek alphabet / Kurdish (Kurmancî) / Urdu These icons come from the The Noun Project (CC-BY 3.0, not

Διαβάστε περισσότερα

Electricity and Energy

Electricity and Energy Electricity and Energy - 1 - Standards: 22.1: Distinguish alternating current (AC) from direct current (DC) and know why household electricity is AC and not DC. 22.2: Know that household electrical energy

Διαβάστε περισσότερα

الزجبعبد ا ؼ ذ ا جذ ٠ ذ عفش ا ال ١٠

الزجبعبد ا ؼ ذ ا جذ ٠ ذ عفش ا ال ١٠ الزجبعبد ا ؼ ذ ا جذ ٠ ذ عفش ا ال ١٠ Holy_bible_1 87 ال ١٠ 8 901»خ شا غىشا ال رششة ا ذ ث ن ؼه ػ ذ دخ ى ا خ ١ خ االجز بع ى ال ر ر ا. فشضب د ش ٠ ب ف اج ١ ب ى H8354 drink ת שת H413 אל H4191 ye die: תמתו H408

Διαβάστε περισσότερα

3 24: فدخلن و لم يجدن جسد الرب يسوع

3 24: فدخلن و لم يجدن جسد الرب يسوع Holy_bible_1 م قب 3:24 امرة ش ػ م قب 3:24 3 24: فدخلن و لم يجدن جسد الرب يسوع امخى يبك أقن وى أؽظبء امنجي فظنح امقراء األقضر, خدؽو وب اموخع عبح ا ذؼث ش " D it a,b,d,e,ff2,l,r1 ( ايغر امونح غ ؽنى ؽده امز

Διαβάστε περισσότερα

چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش

چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش مهندس وحيد گودرزي چگونگي عملكرد درايوهاي كنترل كننده دور موتورهاي الكتريكي بازرس فني برق واحد فني و مهندسي سيمان خاش 1- مقدمه موتوره ای DC اولین وس یله تبدیل ان رژی الکتریکی به ان رژی مکانیکی بودند. موتورهای

Διαβάστε περισσότερα

المعجم اإلنجليزي الفرنسي العربي لمصطلحات ضعف المناعة األولي. محمد واورير Mohamed OUAOURIR. أحمد عزيز بوصفيحة Ahmed Aziz Bousfiha

المعجم اإلنجليزي الفرنسي العربي لمصطلحات ضعف المناعة األولي. محمد واورير Mohamed OUAOURIR. أحمد عزيز بوصفيحة Ahmed Aziz Bousfiha Dictionary English French Arabic terms of PID Dictionnaire Anglais Français Arabe des termes des DIP المعجم اإلنجليزي الفرنسي العربي لمصطلحات ضعف المناعة األولي محمد واورير Mohamed OUAOURIR أحمد عزيز بوصفيحة

Διαβάστε περισσότερα

مسائل فیزیک هالیدی & رزنیک

مسائل فیزیک هالیدی & رزنیک حرکت در مسیر مستقیم )حرکت یک بعدی( حمیدرضا طهماسبی سرعت متوسط و تندی متوسط 1. هنگام یک عطسه ی شدید چشمان شما ممکن است برای 0.50s بسته شود. اگر شما درون خودرویی در حال رانندگی با سرعت 90km/h باشید ماشین

Διαβάστε περισσότερα

Κπ ξη ε ε θε θξα α μα πξν νο ζε εη ζα α α θνπ. ζπ κη α α α κα α ε λσ πη ν ν ν νλ ζνπ ε. da;sss;sssss;ss;sss;sss;s

Κπ ξη ε ε θε θξα α μα πξν νο ζε εη ζα α α θνπ. ζπ κη α α α κα α ε λσ πη ν ν ν νλ ζνπ ε. da;sss;sssss;ss;sss;sss;s b K Ἀρχιμ Ἀριστοβούλου Κυριαζῆ, Μαθήματα ἐκκλ. Μουσικῆς 1 Μέρος 17 ον, Δευτέρα Ἁγίου Πνεύματος, Ἅπαντα Εἰς τόν Ἑσπερινόν τῆς Γονυκλισίας, Ἦχος Δ,ce.Πα zq zg D Go ] G s k fe: x ] K π ξη ε ε θε θξα α μα

Διαβάστε περισσότερα

الزجبعبد ا ؼ ذ ا جذ ذ عفش صوش ب ا ج

الزجبعبد ا ؼ ذ ا جذ ذ عفش صوش ب ا ج الزجبعبد ا ؼ ذ ا جذ ذ عفش صوش ب ا ج Holy_bible_1 415 صوش ب 2 :3 فمبي ا شة ش طب : ] ز شن ا شة ب ش طب. ز شن ا شة ا زي اخزبس (SVD) أ سش. أف ظ زا شؼ خ زش خ ا بس [. H7854 Satan, ה שטן H1605 rebuke ויגער H413

Διαβάστε περισσότερα

Archive of SID Vector Error Correction Model(VECM)

Archive of SID Vector Error Correction Model(VECM) فصلنامه پژوهشهاي اقتصادي سال هفتم شماره چهارم زمستان ١٣٨۶ صفحات ١١٩-١۴٠ ارزيابي اثرات سياستهاي ا زادسازي مالي و تغييرات نرخ بهره بانكي بر توسعه بخش مالي در اقتصاد ايران (با استفاده از تكنيك (VECM علاءالدين

Διαβάστε περισσότερα

خالط فعاليت اي آه زشي پص شي

خالط فعاليت اي آه زشي پص شي بنام خدا خالط فعاليت اي آه زشي پص شي Name: Present Position: Address: Phone: Fax: E-mail: Majid Sirati-Sabet Associate Professor Department of Clinical Biochemistry, School of Medicine, Shahid Beheshti

Διαβάστε περισσότερα

الزجبعبد ا ؼ ذ ا جذ ٠ ذ االعفبس ا مب ١ خ ا ثب ١ خ

الزجبعبد ا ؼ ذ ا جذ ٠ ذ االعفبس ا مب ١ خ ا ثب ١ خ الزجبعبد ا ؼ ذ ا جذ ٠ ذ االعفبس ا مب ١ خ ا ثب ١ خ Holy_bible_1 ٠ جذ شى ز ١ ر اج ف الزجبعبد االعفبس ا مب ١ خ ا ثب ١ خ ا ال ػذ ر افك و ا زشج بد ف ا ش ا ذ فش ا ذ ٠ د ٠ ذ ف ا ف جبرب رخز ف ر ب ب ػ ا ز ف ا غجؼ

Διαβάστε περισσότερα

الحجبصبت ا ع ذ ا جذ ٠ ذ صفش ص ئ ١ اال ي ا ثب

الحجبصبت ا ع ذ ا جذ ٠ ذ صفش ص ئ ١ اال ي ا ثب الحجبصبت ا ع ذ ا جذ ٠ ذ صفش ص ئ ١ اال ي ا ثب Holy_bible_1 371 ص ئ ١ اال ي 11 :31 (SVD) أل ال ٠ حشن ا شة شعج أج اص ا عظ ١. أل لذ شبء ا شة أ ٠ جع ى شعجب. H3068 the LORD H1419 for his great הגדול H6213 to

Διαβάστε περισσότερα

بسم ا الرحمن الرحيم الطلاب و الطالبات الكرام... ا ليكم جميع حلول كتاب فيزياء الحادي عشر و الما خوذة من كتاب دليل المعلم الفلسطيني في الفيزياء..

بسم ا الرحمن الرحيم الطلاب و الطالبات الكرام... ا ليكم جميع حلول كتاب فيزياء الحادي عشر و الما خوذة من كتاب دليل المعلم الفلسطيني في الفيزياء.. بسم ا الرحمن الرحيم الطلاب و الطالبات الكرام... ا ليكم جميع حلول كتاب فيزياء الحادي عشر و الما خوذة من كتاب دليل المعلم الفلسطيني في الفيزياء.. لمشاهدة كل ما هو ممتع و مفيد في فيزياء الحادي عشر تفضلوا

Διαβάστε περισσότερα

نکنید... بخوانید خالء علمی خود را پر کنید و دانش خودتان را ارائه دهید.

نکنید... بخوانید خالء علمی خود را پر کنید و دانش خودتان را ارائه دهید. گزارش کار آزمایشگاه صنعتی... مکانیک سیاالت ( رینولدز افت فشار ) دانشجویان : فردین احمدی محمد جاللی سعید شادخواطر شاهین غالمی گروه یکشنبه ساعت 2::0 الی رینولدز هدف : بررسی نوع حرکت سیال تئوری : یکی از انواع

Διαβάστε περισσότερα

(POWER MOSFET) اهداف: اسيلوسكوپ ولوم ديود خازن سلف مقاومت مقاومت POWER MOSFET V(DC)/3A 12V (DC) ± DC/DC PWM Driver & Opto 100K IRF840

(POWER MOSFET) اهداف: اسيلوسكوپ ولوم ديود خازن سلف مقاومت مقاومت POWER MOSFET V(DC)/3A 12V (DC) ± DC/DC PWM Driver & Opto 100K IRF840 منابع تغذيه متغير با مبدل DC به DC (POWER MOSFET) با ترانز يستور اهداف: ( بررسی Transistor) POWER MOSFET (Metal Oxide Semiconductor Field Effect براي كليد زني 2) بررسي مبدل DC به.DC كاهنده. 3) بررسي مبدل

Διαβάστε περισσότερα

٢٢٢ ٣٩٣ ﻥﺎﺘﺴﺑﺎﺗ ﻭ ﺭﺎﻬﺑ ﻢ / ﻫﺩﺭﺎﻬﭼ ﻩﺭﺎﻤﺷ ﻢ / ﺘ ﺸﻫ ﻝﺎﺳ ﻲﻨﻓ ﺖﺷﺍﺩﺩﺎﻳ ﻱ ﻪﻃ

٢٢٢ ٣٩٣ ﻥﺎﺘﺴﺑﺎﺗ ﻭ ﺭﺎﻬﺑ ﻢ / ﻫﺩﺭﺎﻬﭼ ﻩﺭﺎﻤﺷ ﻢ / ﺘ ﺸﻫ ﻝﺎﺳ ﻲﻨﻓ ﺖﺷﺍﺩﺩﺎﻳ ﻱ ﻪﻃ مجله پژوهش ا ب ايران سال هشتم/ شماره چهاردهم/ بهار و تابستان (٢١٧-٢٢٢) ١٣٩٣ يادداشت فني بررسي ا زمايشگاهي تعيين رابطه عمق جريان غليظ در محل غوطهوري ٢ *١ حسن گليج و مهدي قمشي چکيده جريانهاي غليظ در اثر

Διαβάστε περισσότερα

يﺮﻫز ﺖﺠﺣ ﺐﺳﺎﻨﺗ ﺚﺤﺒﻣ.ﺪﯿﺘﺴﻫ ﺎﻨﺷآ ﯽﯾاﺪﺘﺑا ﻊﻄﻘﻣ زا ﺐﺳﺎﻨﺗ ﺚﺤﺒﻣ ﺎﺑ ﺎﻤﺷ ﺰﯾﺰﻋ زﻮﻣآ ﺶﻧاد ﺪ

يﺮﻫز ﺖﺠﺣ ﺐﺳﺎﻨﺗ ﺚﺤﺒﻣ.ﺪﯿﺘﺴﻫ ﺎﻨﺷآ ﯽﯾاﺪﺘﺑا ﻊﻄﻘﻣ زا ﺐﺳﺎﻨﺗ ﺚﺤﺒﻣ ﺎﺑ ﺎﻤﺷ ﺰﯾﺰﻋ زﻮﻣآ ﺶﻧاد ﺪ مبحث تناسب حجت زهري دانش آموز عزیز شما با مبحث تناسب از مقطع ابتدایی آشنا هستید. تناسب نوعی رابطه بین اعداد است که در آن اعداد و کمیتها به دو صورت می توانند با یکدیگر نسبت داشته باشند. مدل : تناسب مستقیم:

Διαβάστε περισσότερα


KELEBIHAN SURAH AL-FATIHAH KELEBIHAN SURAH AL-FATIHAH Diterbitkan oleh Jamiyah Singapura Percuma 2 Kandungan Mukadimah 5 Surah Al Fatihah dengan terjemahannya 9 Masa dan Tempat turunnya 10 Keagungan Surah Al-Fatihah 11 Kesimpulan

Διαβάστε περισσότερα

آزمون تجربی چسبندگی هزینهها: شواهدی از بورس اوراق بهادار تهران

آزمون تجربی چسبندگی هزینهها: شواهدی از بورس اوراق بهادار تهران ژپو ه شاهی تج ربی حسابداری سال سوم شماره 10 اتبستان 1131 صص 101 144 آزمون تجربی چسبندگی هزینهها: شواهدی از بورس اوراق چکیده بهادار تهران سحرسپاسی * زهرا فتحی ** سکینه شیبه *** تاریخ دریافت: /92/30 24 تاریخ

Διαβάστε περισσότερα

فصل 5 :اصل گسترش و اعداد فازی

فصل 5 :اصل گسترش و اعداد فازی فصل 5 :اصل گسترش و اعداد فازی : 1-5 اصل گسترش در ریاضیات معمولی یکی از مهمترین ابزارها تابع می باشد.تابع یک نوع رابطه خاص می باشد رابطه ای که در نمایش زوج مرتبی عنصر اول تکراری نداشته باشد.معموال تابع

Διαβάστε περισσότερα

کنترل جریان موتور سوي یچ رلوکتانس در سرعت هاي بالا بر مبناي back-emf

کنترل جریان موتور سوي یچ رلوکتانس در سرعت هاي بالا بر مبناي back-emf No. F-13-AAA- کنترل جریان موتور سوي یچ رلوکتانس در سرعت هاي بالا بر مبناي back-emf علی آشورنژادمقدم دانشگاه صنعتی اصفهان قاین ایران aliashoornm@gmail.com جواداسدالهی دانشگاه آزاد اسلامی واحد گناباد قاین

Διαβάστε περισσότερα

( Δ > o) است. ΔH 2. Δ <o ( ) 6 6

( Δ > o) است. ΔH 2. Δ <o ( ) 6 6 تغييرات انرژي ضمن انحلال: اكثر مواد در موادي مشابه خود حل ميشوند و اين پديده را با برهمكنشهاي ميكروسكوپي بررسي كرديم. براي بررسي ماكروسكوپي اين پديده بايد تغييرات انرژي (ا نتالپي) و تغييرات بينظمي (ا نتروپي)

Διαβάστε περισσότερα

تحلیل و بررسی تاثیر SVC و SSSC بر روی سنکرونیزم ژنراتورهای سنکرون و پايداری گذرا و دينامیکی شبکه قدرت

تحلیل و بررسی تاثیر SVC و SSSC بر روی سنکرونیزم ژنراتورهای سنکرون و پايداری گذرا و دينامیکی شبکه قدرت تحلیل و بررسی تاثیر SVC و SSSC بر روی سنکرونیزم ژنراتورهای سنکرون و پايداری گذرا و دينامیکی شبکه قدرت زينالعابدين اجتماعی امید خسروجردی سیدرضا کاظمی اندبیلی کارشناسی ارشد دانشگاه بیرجند 1- کارشناسی ارشد

Διαβάστε περισσότερα

نارفاس ونير ةديدلجا drive the change

نارفاس ونير ةديدلجا drive the change GôaÉ S ƒæjq Iójó G drive the change عن ق رب الأناقة واجلاذبية... موا صفات جعلتها حتظى باإعجاب اجلميع òncéjك ábéfcg إلى آفاق جديدة 2. 1. 3. 4. رين و س افران رم ز الأناق ة احلقيقي ة تع بر رين و س افران

Διαβάστε περισσότερα

ﺎﻫﻪﻨﯾﺰﻫ ﺰﯿﻟﺎﻧآ سﺎﺳا ﺮﺑ ﺎﻫ ﻪﻟﻮﻟ یدﺎﺼﺘﻗا ﺮﻄﻗ ﻪﺒﺳﺎﺤﻣ یاﺮﺑ ﻪﻄﺑار

ﺎﻫﻪﻨﯾﺰﻫ ﺰﯿﻟﺎﻧآ سﺎﺳا ﺮﺑ ﺎﻫ ﻪﻟﻮﻟ یدﺎﺼﺘﻗا ﺮﻄﻗ ﻪﺒﺳﺎﺤﻣ یاﺮﺑ ﻪﻄﺑار اراي ه رابطهای برای محاسبه قطر اقتصادی لوله ها بر اساس آنالیز هزینهها در ایران چکیده در تحقیق حاضر تعیین قطر بهینه اقتصادی براساس هزینه های موثر روی اجرای عملیات لوله کشی در ایران مورد مطالعه قرار گرفته

Διαβάστε περισσότερα

هل العدد الذي يقول لكن نجنا من الشرير محرف لوقا 11:

هل العدد الذي يقول لكن نجنا من الشرير محرف لوقا 11: هل العدد الذي يقول لكن نجنا من 4 الشرير محرف لوقا 11: Holy_bible_1 الشبهة يقول البعض ان العدد الذي في لوقا " 4 11: و اغفر لنا خطايانا الننا نحن ايضا نغفر لكل من يذنب الينا و ال تدخلنا في تجربة لكن نجنا

Διαβάστε περισσότερα

مطالعه تجربی بر انجماد سریع با استفاده از تکنیک جدید فراصوت

مطالعه تجربی بر انجماد سریع با استفاده از تکنیک جدید فراصوت مطالعه تجربی بر انجماد سریع با استفاده از تکنیک جدید فراصوت ایمان باقرپور دانشگاه آزاد اسالمی واحد سروستان باشگاه پژوهشگران جوان و نخبگان سروستان ایران bagherpour.put@gmail.com چکیده: نرخ انجماد یکی از

Διαβάστε περισσότερα

هیئت اندازه مدیرعامل وظیفه دوگانگی مدیره هیئت استقالل جمله از ش ركتي حاكميت متغیرهای ثانیا و مييابند كاهش درصد 48 ميشود.

هیئت اندازه مدیرعامل وظیفه دوگانگی مدیره هیئت استقالل جمله از ش ركتي حاكميت متغیرهای ثانیا و مييابند كاهش درصد 48 ميشود. حسینیان کاظم سید مرکز نور پيام دانشگاه حسابداری ارشد کارشناسی دانشجوی خوزستان سیمان شرکت مالی امور رئیس و عسلویه بینالمللی مقدم عبدالکریم دکتر نور پيام دانشگاه مدیریت و حسابداری گروه استادیار رفتار ب ر

Διαβάστε περισσότερα

مقایسه رادارهایRAR و SAR

مقایسه رادارهایRAR و SAR مقایسه رادارهایRAR و SAR نویسنده :آمنه رجب پور بوشهری دانشگاه آزاد اسالمی واحد بوشهر کارشناسی ارشد گروه علمی مهندسی برق در این مقاله rajabpour342@yahoo.com نام ارائهدهنده: آمنه رجب پور بوشهری کد مقاله

Διαβάστε περισσότερα

دینامیک آئروسل ها خواص جنبشی آئروسل ها

دینامیک آئروسل ها خواص جنبشی آئروسل ها دینامیک آئروسل ها جلسه 9 خواص جنبشی آئروسل ها مکانیکی ته نشینی اینرسیایی نفوذ الکتریکی نوری فرایند ترکم ذرات کواگوالسیون چگالش 1 سرعت ته نشینی ρ : article density (kg/m3) d : article diameter (m), g: acceleration

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ع فو و درگ زر کے ف ضاي ل مع ایک ا ہم مدن ی وص تی

ع فو و درگ زر کے ف ضاي ل مع ایک ا ہم مدن ی وص تی عفو و درگ زر کے ف ضاي ل مع ایک اہم مدن ی وص تی Και μια Σημαντική Μαδανί θέληση Αυτό το φυλλάδιο γράφτηκε στα Oυρντού (Πακιστανικά) από τον Σαίχ-ε-Ταρίκατ Αμίρ-ε-Άχλ-ε-Σούννατ, ιδρυτή της Δάβατ-ε-Ισλάμι,

Διαβάστε περισσότερα

ΓΕΦΥΡΕΣ. Οδηγός δίγλωσσης υποστήριξης προσφύγων

ΓΕΦΥΡΕΣ. Οδηγός δίγλωσσης υποστήριξης προσφύγων ΓΕΦΥΡΕΣ Οδηγός δίγλωσσης υποστήριξης προσφύγων Α Έκδοση: Κέντρο Ανάπτυξης Εκπαιδευτικής Πολιτικής Γ.Σ.Ε.Ε., Ιούλιος 2016 3ης Σεπτεμβρίου 36, 104 32, Αθήνα Τηλ. 210 5218700 www.kanepgsee.gr/ Εmail: info@kanepgsee.gr

Διαβάστε περισσότερα



Διαβάστε περισσότερα

ب عى ان پيصبينيضکستنهاييدرچنداليههايمتقارنباروشانرژي

ب عى ان پيصبينيضکستنهاييدرچنداليههايمتقارنباروشانرژي ( ) - : : 1386 : معادل ب رسي افضا م ىذسی داوشکذي داوشج مشخصات سيذاحمذگلچ بيان وامخاو ادگي: وام 1:8928:8 داوشج ئي: شماري افضايي( اي )سازي افضا م ىذسی تحصيلی: رشت آزاد داوشج ي ت دشكي حسيىي حسيه را ىما: استاد

Διαβάστε περισσότερα

ازالگوريتم ژنتيك. DTW,Genetic Algorithm,Feature Vector,Isolated Word Recognition دهد.

ازالگوريتم ژنتيك. DTW,Genetic Algorithm,Feature Vector,Isolated Word Recognition دهد. اراي ه روشي جديد در بهينه سازي سيستم هاي پردازش گفتار با استفاده ازالگوريتم ژنتيك ع يل اكبر برنگي ايمان اسمعيل زاده و هومن نبوتي مركز تحقيقات سجاد aliakbar_berangi@yahoo.com imanesmaailzadeh@yahoo.com

Διαβάστε περισσότερα

نقش نگرش والدین به خواندن در پیشبینی نگرش خواندن خودپنداره و ادراک خواندن دانشآموزان پایۀ چهارم و پنجم ابتدایی

نقش نگرش والدین به خواندن در پیشبینی نگرش خواندن خودپنداره و ادراک خواندن دانشآموزان پایۀ چهارم و پنجم ابتدایی نقش نگرش والدین به خواندن در پیشبینی نگرش خواندن خودپنداره و ادراک خواندن دانشآموزان مریم چگینی 1 چکیده 2 علی مقدم زاده نسرین چگینی 3 پایۀ چهارم و پنجم ابتدایی تاریخ دریافت: 39 10/01/ تاریخ پذیرش: 39 00/26/

Διαβάστε περισσότερα

تاثیر بار سطحی الکترودها روي برهم کنش جذبی یا دفعی پروتي ینها چکیده: الیاس علیپور هدایت االله قورچیان

تاثیر بار سطحی الکترودها روي برهم کنش جذبی یا دفعی پروتي ینها چکیده: الیاس علیپور هدایت االله قورچیان تاثیر بار سطحی الکترودها روي برهم کنش جذبی یا دفعی پروتي ینها * الیاس علیپور هدایت االله قورچیان تهران دانشگاه تهران مرکز تحقیقات بیوشیمی و بیوفیزیک "این مقاله در مجموعه سمینارهاي تحصیلات تکمیلی بیوفیزیک

Διαβάστε περισσότερα

RDA of Vitamins and Minerals

RDA of Vitamins and Minerals RDA of Vitamins and Minerals Nutrient/ Ingredient RDA Life Stage Group 5 0-6 mo 50% - - 6 7-12mo 50% - - 8 12 4-8y 250% 500% - 20 9-13y 250% 500% - 25 14-18y 250% 500% - 30 19-30y 250% 500% 30 31-50y 250%

Διαβάστε περισσότερα

فصل ٤ انتگرال کند. در چنین روشی برای محاسبه دایره از درج چندضلعیهای منتظم در درون دایره استفاده میشود

فصل ٤ انتگرال کند. در چنین روشی برای محاسبه دایره از درج چندضلعیهای منتظم در درون دایره استفاده میشود فصل ٤ انتگرال ٤ ١ مسأله مساحت فرمولهای مربوط به مساحت چندضلعیها نظیر مربع مستطیل مثلث و ذوزنقه از زمانهای شروع تمدنهای نخستین به خوبی شناخته شده بوده است. با اینحال مسأله یافتن فرمولی برای بعضی نواحی که

Διαβάστε περισσότερα

ΔΙΗΜΕΡΙΔΑ «Το σύγχρονο εργαστήριο ποιότητας νερού» Ξενοδοχείο Classical Athens Imperial, 22-23 Μαρτίου 2010

ΔΙΗΜΕΡΙΔΑ «Το σύγχρονο εργαστήριο ποιότητας νερού» Ξενοδοχείο Classical Athens Imperial, 22-23 Μαρτίου 2010 ΔΙΗΜΕΡΙΔΑ «Το σύγχρονο εργαστήριο ποιότητας νερού» Ξενοδοχείο Classical Athens Imperial, 22-23 Μαρτίου 2010 Συνδιοργανωτές: Εταιρεία Μελέτης της Μικροβιολογικής Ποιότητας των Υδάτων, Ε.Δ.Ε.Υ.Α. «Προσδιορισμός

Διαβάστε περισσότερα

Archive of SID. چكيده واژههاي كليدي: 1- مقدمه 3/3) و. گرديده است.

Archive of SID.  چكيده واژههاي كليدي: 1- مقدمه 3/3) و. گرديده است. و 1 بررسي و مطالعه عملكرد سنسورگازي ساخته شده از پوشش نانوسيمي اكسيد روي چكيده 2 1 * امين نكوبين مصطفي خديوي 2- كارشناس ارشد دانشگاه آزاد اسلامي واحد نجف آباد باشگاه پژوهشگران جوان نجف آباد ايران * nekoubin@gmail.com

Διαβάστε περισσότερα

Liturgia Verbi. Παπα βενεδικτου 16ου. a Papa Benedicto XVI in Maronita cathedrale peracta Τελεση της ακολουθιας του θειου λογου

Liturgia Verbi. Παπα βενεδικτου 16ου. a Papa Benedicto XVI in Maronita cathedrale peracta Τελεση της ακολουθιας του θειου λογου Liturgia Verbi a Papa Benedicto XVI in Maronita cathedrale peracta Τελεση της ακολουθιας του θειου λογου Χοροστατουντος της αυτου αγιοτητας Παπα βενεδικτου 16ου die 6 Iunii 2010 6 Ιουνίου 2010 Ecclesia

Διαβάστε περισσότερα

جريان ديفرانسيلي CDBA

جريان ديفرانسيلي CDBA پياده سازي فيلترهاي آنالوگ مد جرياني با استفاده از DTA محرم حسين پور و بابك قصاب زاده اهرابي گروه مهندسي برق الكترونيك- دانشگاه آزاد اسلامي واحد تبريز babakahrabi@gmail.com m.hosseinpour.n@gmail.com چكيده

Διαβάστε περισσότερα

Refugee Phrasebook/Greece March 2016-b

Refugee Phrasebook/Greece March 2016-b Refugee Phrasebook/Greece March 2016-b Kurdish (Sorani [ ردی را ] / Kurdish (Kurmancî) / French / Greek phonetic / Greek alphabet / English These icons come from the The Noun Project (CC-BY 3.0, not edited).

Διαβάστε περισσότερα

نادرگرب ماجنا اب ینزخم تایصوصخ یسررب یاهرگ ناشن قیفلت و یا هزرل یاه هداد نیدایم زا یکی رد کورس دنزاس رد یا هزرل ناریا برغ بونج یتفن

نادرگرب ماجنا اب ینزخم تایصوصخ یسررب یاهرگ ناشن قیفلت و یا هزرل یاه هداد نیدایم زا یکی رد کورس دنزاس رد یا هزرل ناریا برغ بونج یتفن 75 شماره 20 برگردان انجام با مخزنی خصوصیات بررسی نشانگرهای تلفیق و لرزهای دادههای میادین از یکی در سروک سازند در های لرز ایران غرب جنوب نفتی 3 بیدهندی مجیدنبی و 2 کمالی محمدرضا 1* امیرزاده مریم تهران تحقیقات

Διαβάστε περισσότερα

عوامل جلوگیری کننده از موازی سازی عبارتند از : 1.هزینه I/O 2.هماهنگی/رقابت

عوامل جلوگیری کننده از موازی سازی عبارتند از : 1.هزینه I/O 2.هماهنگی/رقابت عوامل جلوگیری کننده از موازی سازی عبارتند از :.هزینه I/O.هماهنگی/رقابت ممکن است یک برنامه sequential بهتر از یک برنامه موازی باشد بطور مثال یک عدد 000 رقمی به توان یک عدد طوالنی اینکه الگوریتم را چگونه

Διαβάστε περισσότερα

مطالعه اثرات سینتیک هاي شیمیایی برروي احتراق در کوره هاي متخلخل

مطالعه اثرات سینتیک هاي شیمیایی برروي احتراق در کوره هاي متخلخل مطالعه اثرات سینتیک هاي شیمیایی برروي احتراق در کوره هاي متخلخل نگین معلمی خیاوي 1* سیامک حسین پور 2 دانشگاه تربیت مدرس تهران (negin.moallemi@modares.ac.ir) * چکیده در تحقیق حاضر احتراق پیش آمیخته هوا/متان

Διαβάστε περισσότερα

الگوریتم هوشمند تخصیص منابع برای برون سپاری وظایف در محیط رایانش ابری سیار

الگوریتم هوشمند تخصیص منابع برای برون سپاری وظایف در محیط رایانش ابری سیار الگوریتم هوشمند تخصیص منابع برای برون سپاری وظایف در محیط رایانش ابری سیار شیما رشیدی 1 و سعید شریفیان 2 1 دانشکده مهندسی برق دانشگاه امیرکبیر )پلی تکنیک تهران( Shima.Rashidi@aut.ac.ir دانشکده مهندسی برق

Διαβάστε περισσότερα

ارزیابی وضعیت راندمان انتقال آب در کانالهاي بتنی شبکه آبیاري دشت گرمسار و بررسی شرایط بهبود آن

ارزیابی وضعیت راندمان انتقال آب در کانالهاي بتنی شبکه آبیاري دشت گرمسار و بررسی شرایط بهبود آن » اولین همایش ملی چالشهاي منابع آب و کشاورزي «انجمن آبیاري و زهکشی ایران دانشگاه آزاد اسلامی واحدخوراسگان اصفهان 24 بهمن 392 ارزیابی وضعیت راندمان انتقال آب در کانالهاي بتنی شبکه آبیاري دشت گرمسار و بررسی

Διαβάστε περισσότερα

مق دمة ال طبعة الا ولى مق دمة ال طبعة ال ثالثة

مق دمة ال طبعة الا ولى مق دمة ال طبعة ال ثالثة ح خ ٣٧٣ ا لمعج م من الث اني الجزء كلمات فهرس ٣٨٣... ٣٨٥... مق دمة ال طبعة الا ولى مق دمة ال طبعة ال ثالثة ٣٨٧... Iconostasis εἰκονοστάσιον ٣٨٧... ٣٨٨... Iconostasis ٣٨٨... Baptistère Baptistery ٣٨٨...

Διαβάστε περισσότερα

ميثم اقتداري بروجني دانشده ي برق دانشگاه يزد 1_ مقدمه

ميثم اقتداري بروجني دانشده ي برق دانشگاه يزد 1_ مقدمه ي ا کنترل سرعت موتور القايي با استفاده از شبکه ي عصبي ميثم اقتداري بروجني دانشده ي برق دانشگاه يزد meysameghtedari@yahoo.com است. چکيده: در اين مقاله ابتدا مقدمه اي در مورد ويژگي هاي موتورهاي القايي وکنترل

Διαβάστε περισσότερα

- عنوان گایدالین: راهنماي بهداشت آب و فاضالب در شرایط اضطراری و بالیا - تعداد صفحات:

- عنوان گایدالین: راهنماي بهداشت آب و فاضالب در شرایط اضطراری و بالیا - تعداد صفحات: < راهنماي بهدا شت آب و افضالب رد شرایط اضطراری و بالیا الزامات دستور ا لعم ل اه و ر هنم وداهی تخ ص ص ی مرکز سالمت محیط و کار مرکز سالمت محیط و کار ژپو هشکده محیط ز یس ت دانش گاه علوم زپشکی تهران اتبستان

Διαβάστε περισσότερα

هلول و هتسوپ لدب م ١ لکش

هلول و هتسوپ لدب م ١ لکش دوفازي با كيفيت صورت مخلوط به اواپراتور به 1- در اواپراتور كولر يك اتومبيل مبرد R 134a با دبي 0.08kg/s جريان دارد. ورودي مبرد مي شود و محيط بيرون در دماي 25 o C وارد از روي اواپراتور از بخار اشباع است.

Διαβάστε περισσότερα

دهمین همایش بین المللی انرژی

دهمین همایش بین المللی انرژی طراحی و بهینه سازی ژنراتور سنکرون مغناطیس دائم برای کاربرد انرژی تجدید پذیر هیدرودینامیکی با استفاده از الگوریتم مورچگان امیر نیک بخش - سید اصغر غالمیان دانشجوی کارشناسی ارشد دانشگاه صنعتی نوشیروانی بابل

Διαβάστε περισσότερα

مدير مسئول: رئيس كل ديوان محاسبات كشور )دكتر عبدالرضا رحماني فضلي( سردبير: دكتر اصغر عربيان نظارت بر اجرا: 362/ ساختمان شماره دو ديوان محاسبات كشور

مدير مسئول: رئيس كل ديوان محاسبات كشور )دكتر عبدالرضا رحماني فضلي( سردبير: دكتر اصغر عربيان نظارت بر اجرا: 362/ ساختمان شماره دو ديوان محاسبات كشور فصلنامه علمی-پژوهشی بر اس اس نامه ش ماره 3/207132 مورخ 90/10/13 وزارت علوم تحقیقات و فناوری فصلنامه دانش حسابرسی دارای درجه علمی-پژوهشی است. هیأتتحریریه: دانشگاه تربیت مدرس استاد دکتر عادل آذر دانشگاهشهیدبهشتی

Διαβάστε περισσότερα

طراحی بهینه یک ریز شبکه مبتنی بر انرژی های تجدیدپذیر برای یک منطقه ای روستائی در استان خراسان رضوی

طراحی بهینه یک ریز شبکه مبتنی بر انرژی های تجدیدپذیر برای یک منطقه ای روستائی در استان خراسان رضوی No. F-5-AAA- طراحی بهینه یک ریز شبکه مبتنی بر انرژی های تجدیدپذیر برای یک منطقه ای روستائی در استان خراسان رضوی عبداله امیری شرکت توزیع برق خراسان رضوی- دانشگاه صنعتی امیرکبیر مشهد ایران مرتضی محمدی اردهالی

Διαβάστε περισσότερα

طراحی و بهینه سازی موتور سنکرون سه فاز مغناطیس دائم با آهنربای داخلی جهت کاربرد های سرعت پایین

طراحی و بهینه سازی موتور سنکرون سه فاز مغناطیس دائم با آهنربای داخلی جهت کاربرد های سرعت پایین همایش ملی مهندسی برق و توسعه پایدار موسسه آموزش عالی خاوران طراحی و بهینه سازی موتور سنکرون سه فاز مغناطیس دائم با آهنربای داخلی جهت کاربرد های سرعت پایین حمیدرضا قلی نژاد سید اصغرغالمیان 1- دانشجو کارشناسی

Διαβάστε περισσότερα

موتورهای تکفاز ساختمان موتورهای تک فاز دوخازنی را توضیح دهد. منحنی مشخصه گشتاور سرعت موتور تک فاز با خازن راه انداز را تشریح کند.

موتورهای تکفاز ساختمان موتورهای تک فاز دوخازنی را توضیح دهد. منحنی مشخصه گشتاور سرعت موتور تک فاز با خازن راه انداز را تشریح کند. 5 موتورهای تک فاز 183 موتورهای تکفاز هدف های رفتاری: نحوه تولید میدان مغناطیسی در یک استاتور با یک و دو سیم پیچ را بررسی نماید. لزوم استفاده از سیم پیچ کمکی در موتورهای تک فاز را توضیح دهد. ساختمان داخلی

Διαβάστε περισσότερα

متلب سایت MatlabSite.com

متلب سایت MatlabSite.com بهبود پایداري گذراي توربین بادي سرعت متغیر مجهز به ژنراتور القایی دوتغذیه اي با بهرهگیري از کنترل کننده فازي علی اصغر صمدي علی مالکی مصطفی جزایري دانشکدهي برق و کامپیوتر دانشگاه سمنان a.a.amadi@gmail.com

Διαβάστε περισσότερα

اهمیت میترینگ در شرکت ملی نفت ایران وضعیت موجود و چشم انداز آتی بررسی موردی برخی از اشکاالت پیش آمده در عملیات پرووینگ عادی و نشانی:

اهمیت میترینگ در شرکت ملی نفت ایران وضعیت موجود و چشم انداز آتی بررسی موردی برخی از اشکاالت پیش آمده در عملیات پرووینگ عادی و نشانی: M E T R O L O G Y ماهنامه علمی تخصصی و ترویجی مرکز ملی اندازه شناسی سازمان ملی استاندارد ایران مرکز ملی اندازه شناسی صاحب امتیاز: سازمان ملی استاندارد ایران مدیر مسئول: نیره پیروزبخت شورای سیاست گذاری:

Διαβάστε περισσότερα

تنظیم پارامتر اندیکاتور های تحلیل تکنیکال با استفاده از بهینه سازی چندهدفه گروه ذرات و سیستم استنتاج تطبیقی فازی-عصبی

تنظیم پارامتر اندیکاتور های تحلیل تکنیکال با استفاده از بهینه سازی چندهدفه گروه ذرات و سیستم استنتاج تطبیقی فازی-عصبی فصلنامه علمي پژوهشي دانش سرمايهگذاري سال چهارم/ شماره پانزدهم/ پايیز 1931 تنظیم پارامتر اندیکاتور های تحلیل تکنیکال با استفاده از بهینه سازی چندهدفه گروه ذرات و سیستم استنتاج تطبیقی فازی-عصبی ابراهیم عباسی

Διαβάστε περισσότερα

پایش دمای سطح زمین و بررسی رابطه کاربری اراضی با دمای سطح با استفاده از تصویر سنجنده ETMو OLI )مطالعه موردی: استان قم(

پایش دمای سطح زمین و بررسی رابطه کاربری اراضی با دمای سطح با استفاده از تصویر سنجنده ETMو OLI )مطالعه موردی: استان قم( پایش دمای سطح زمین و بررسی رابطه کاربری اراضی با دمای + سطح با استفاده از تصویر سنجنده ETMو OLI )مطالعه موردی: استان قم( علی سرکارگراردکانی 4 مرضیه حاجیلو 1 سید علی المدرسی 2 نسیم زرنگ 3 1.دانشجوی کارشناسی

Διαβάστε περισσότερα

Oleh : Syaikh Muhammad At-Tamimi Alih bahasa Muhammad Yusuf Harun, MA. Editor : Munir F. Ridwan Muh. Mu inudinillah, MA.

Oleh : Syaikh Muhammad At-Tamimi Alih bahasa Muhammad Yusuf Harun, MA. Editor : Munir F. Ridwan Muh. Mu inudinillah, MA. TIGA LANDASAN UTAMA Oleh : Syaikh Muhammad At-Tamimi Alih bahasa Muhammad Yusuf Harun, MA. Editor : Munir F. Ridwan Muh. Mu inudinillah, MA. 3 DAFTAR ISI P e n d a h l u a n 3 1. Mengenal Allah Azza wa

Διαβάστε περισσότερα

آموزش اتوکد (AutoCAD)

آموزش اتوکد (AutoCAD) آموزش اتوکد (AutoCAD) تهیه و تنظیم: سید مسعود توفیقی اسفهالن ایمیل: Captain_k2@yahoo.com سامانه پیام کوتاه: 30002105000010 وبسایت: آموزش اتوکد (AUTOCAD) فهرست آموزش نرم افزار اتوکد )AutoCAD( درس اول: -

Διαβάστε περισσότερα

Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988

Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988 ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΥΠΟΥΡΓΕΙΟ ΠΑΙΔΕΙΑΣ ΚΑΙ ΘΡΗΣΚΕΥΜΑΤΩΝ ΓΕΝΙΚΗ ΓΡΑΜΜΑΤΕΙΑ ΕΡΕΥΝΑΣ & ΤΕΧΝΟΛΟΓΙΑΣ Αθήνα, 15 Οκτωβρίου 2014 Αρ. Πρωτ.: 2988 Θέμα: Έγκριση πρόσκλησης εκδήλωσης ενδιαφέροντος με απευθείας ανάθεση

Διαβάστε περισσότερα

An early anonymous Greek translation of the Qur ān

An early anonymous Greek translation of the Qur ān An early anonymous Greek translation of the Qur ān The fragments from Niketas Byzantios Refutatio and the anonymous Abjuratio [Una traducción griega anónima temprana del Corán. Los fragmentos de la Refutatio

Διαβάστε περισσότερα

مطالعه شاخصها و خصوصیات جوانه زنی بذر و استقرار دانه رست گیاه دارویی یافته / دوره چهاردهم / شماره / 2 بهار / 91 ویژه نامه گیاهان دارویی

مطالعه شاخصها و خصوصیات جوانه زنی بذر و استقرار دانه رست گیاه دارویی یافته / دوره چهاردهم / شماره / 2 بهار / 91 ویژه نامه گیاهان دارویی فصلنامه علمي پژوهشي دانشگاه علوم پزشكي لرستان مطالعه شاخصها و خصوصیات جوانه زنی بذر و استقرار دانه رست گیاه دارویی مورد L) (Myrtus communis احمد اسماعیلی 1 و 2 حمیدرضا عیسوند 1 عبدالحسین رضاي ی نژاد 3

Διαβάστε περισσότερα

ال صعوبات اللغوية خلريجي ال شريعة والقانون يف اململكة

ال صعوبات اللغوية خلريجي ال شريعة والقانون يف اململكة امل ؤمتر الدويل 160 اخلام س للغة العربية ال صعوبات اللغوية خلريجي ال شريعة والقانون يف اململكة العربية ال سعودية د. اإبراهيم بن سليمان احلربي ملخ ص البحث يواجه خريجي ال شريعة والقانون عددا من ال صعوبات

Διαβάστε περισσότερα

بررسی تاثیر ادوات مختلف FACTS بر پایداري ولتاژ

بررسی تاثیر ادوات مختلف FACTS بر پایداري ولتاژ بررسی تاثیر ادوات مختلف FACTS بر پایداري ولتاژ 3 2 1 حمید فتاحی حمدي عبدي و آرش زرینی تبار 1 دانشجوي کارشناسی ارشد علوم تحقیقات کرمانشاه en.hamidfattahi@gmail.com 2 گروه برق دانشکده فنی و مهندسی دانشگاه

Διαβάστε περισσότερα

// Κεντρική σκηνή/ Για 10 μόνο παραστάσεις Δημήτρης Μπογδάνος Mon Petit Prince Μια παράσταση για ενήλικες με ανήλικη ματιά

// Κεντρική σκηνή/ Για 10 μόνο παραστάσεις Δημήτρης Μπογδάνος Mon Petit Prince Μια παράσταση για ενήλικες με ανήλικη ματιά ΔΗΜΟΤΙΚΟ ΘΕΑΤΡΟ ΠΕΙΡΑΙΑ ΠΡΟΓΡΑΜΜΑ 2016-2017 21.09-16.10.2016 // Κεντρική σκηνή Γκαίτε Φάουστ ΜΕΦΙΣΤΟΦΕΛΗΣ Μα όρια δε σου έβαλε κανείς, Μπορείς ν αρπάζεις ό,τι θες -θα το γλεντήσουμε! Μην είσαι ανόητος,

Διαβάστε περισσότερα

آموزش نرم افزار MATLAB

آموزش نرم افزار MATLAB آموزش نرم افزار MATLAB فهرست مطالب فصل اول : آشنایی با و کار با ماتریس ها فصل دوم : محاسبات سیمبولیک و چند جمله ای ها فصل سوم : کنترل جریان محاسبات )ساختارهای شرطی و حلقه ها( فصل چهارم : ترسیم نمودارهای

Διαβάστε περισσότερα

اندازهگیري جریانهاي بزرگ در آزمایشگاه جریان قوي با استفاده از کویل روگوفسکی

اندازهگیري جریانهاي بزرگ در آزمایشگاه جریان قوي با استفاده از کویل روگوفسکی No. 3-F-TRN-766 جریانهاي بزرگ در آزمایشگاه جریان قوي با استفاده از کویل روگوفسکی محمد حامد صمیمی سلمان محسنی حسین محسنی موسسە پژوهشی فشارقوي الکتریکی دانشکدة مهندسی برق و کامپیوتر دانشگاه تهران تهران ایران

Διαβάστε περισσότερα

Archive of SID چكيده - 1 مقدمه

Archive of SID چكيده - 1 مقدمه كاهش مصرف سوخت در ديگ هاي بخار به ازاء هر تن بخار توليدي 2 2 1 فرشاد پناهي زاده شهرام هاشمي مرغزار محمود فرزانه گرد پروين فرخ فر مركز پژوهش پتروشيمي بندر امام (ره) تحقيقات فني و مهندسي f_panahizadeh@yahoo.com

Διαβάστε περισσότερα

طرح در زمین کاربری تحقق میزان ارزیابی سبز فضای کاربری بر تأکید با شهری توسعه دورود(

طرح در زمین کاربری تحقق میزان ارزیابی سبز فضای کاربری بر تأکید با شهری توسعه دورود( Journal of UrbanLandscape Research, Vol., No., 0 / www.julr.ir 393 تابستان و بهار / شماره اول/ سال / شهر«منظر»پژوهشهای فصلنامه دو های طرح در زمین کاربری تحقق میزان ارزیابی سبز فضای کاربری بر تأکید با شهری

Διαβάστε περισσότερα

تهیه و تنظیم : طیبه معظمی

تهیه و تنظیم : طیبه معظمی آمارزیستی مقدماتی تهیه و تنظیم : طیبه معظمی 2931 بیش تر مردم با واژه آماربه مفهومی که جهت ثبت و نمایش اطالعات به کار می رود و در یک مفهوم وسیع تر ارائه پاره ای از مشخصات عددی چون میانگین درصدها و... است

Διαβάστε περισσότερα

Khotbah Jum at CATATAN. Vol. II, Nomor 3 16 Hijrah/Mei Pemimpin Redaksi & Penanggung Jawab: Ahmad Supardi

Khotbah Jum at CATATAN. Vol. II, Nomor 3 16 Hijrah/Mei Pemimpin Redaksi & Penanggung Jawab: Ahmad Supardi CATATAN Khotbah Jum at Vol. II, Nomor 3 16 Hijrah/Mei 2008 Diterbitkan oleh Sekretariat Pengurus Besar Jemaat Ahmadiyah Indonesia Badan Hukum Penetapan Menteri Kehakiman RI No. JA/5/23/13 tgl. 13 Maret

Διαβάστε περισσότερα



Διαβάστε περισσότερα

راهبردهای بیان مخالفت در بین

راهبردهای بیان مخالفت در بین )س( فصلنامة علمي- پژوهشي زبانپژوهی دانشگاه الزهرا سال ششم شمارة 3 زمستان 393 راهبردهای بیان مخالفت در بین دانشجویان دختر و پسر سیدمحمد حسینی مجید عامریان تاریخ دریافت: 90/8/ تاریخ تصویب: 9//0 چکیده تحقیق

Διαβάστε περισσότερα